Otolemur_garnettii Locus MAP9
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii MAP9
Otolemur_garnettii
MAP9
GeneScaffold_4901
SNORA2
4724..4860
32078
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCTTGCCAGGCCCAAGGCCGGGGCCGAGGGTCCTCAGGGTCGCGGGGAACTTTGCGGCA
GGAGTGGCGAAGGTGGATACAGAAAGCGGGACGTAGCGGCCGAAGGAGACGGGACGGAGA
TCTCAGTTGGGTGTGCACGGGGTGGGGGGCACCGGGCGCGGTGAGGAGCAGGCGGGGATC
CGGCGCCACCTGGCTAGGCCAGGAATGGTCCCCGGGCGCGCGCTGCTGTGGGTGGCCCAG
TGGCCGAGACCCAGGCCGCCTTACCCTAAGCACAAGAAATAGCAATTTTAAGGCAGCCCA
TCGCGCAGACGGTGTCATTTTGTTTTGCACAGCCCTGTTAACACTTTCGTGAGAGGGTAA
AAATGGCTTGTTAAATCCATCGCTGGCTGTTTGTTTAGCATGATGGTCTTTTTCTCTGGG
TAGCGCTGTCTGCGAGCATTTTTTTGTGTGTGCGATATTGGTGTTGGTGACTTTTATGCT
GGTAGCCTTTTAAATAAGGCGTGACTGTTTGGTCTGCAGTCTCATTTTTGAAGAAAGGTG
ACAAACAAGGCTTATTGGCAGTATTTTGTTAAATTAGCCTGTTGGAATCATTCATTTCCC
ATTTCTTAAAATGGTTGCAGAACTATTTTAGGATTACTTCCATTCGAGTTCTCCTGTTTT
GAAAGCAGCCTTGTGAGAATTTGGCGTTTCTTTACAAGAACTCTTTACTTTTTTAAGTGA
AGACATAGCGCAGTGTTCATACGGGATGCTTTTCTTAATTGCGTTGGCTTTGGGGAGCAC
CAAATGGGTGACAGAAGTCCTCAAGCATGCAATTTATTTTTTGGTATTTGTTTTTTCTAT
ATTTCTGATTTGTTTTTTCTATCTTTCAGCCACCATCCCAGGTTAAATTGTTCCAATATT
TATTCACGATTTCATAAAGGTAAAGAGAAAAATAATACACTATGTCTGATGAAGTTTTTA
GTACAACTTTGGCATATACAAAGAGTCCAAGAGTTACCAAAAGAACTACTTTCCAGGTAA
AGTCTTTCAAAGCAGTTTTATTTTGAAGGATTTTAGAATGTAAACACTATAATGTTGGAT
TTGGTGATTGCAGGAACAGTCCTATATAAAACAGAAGCAAATCTTAACATTTCTTTTAAG
GTTTTGCAGATGATTACATTTGAGTTCCAGACCAAACCCTCTGTTTAGCTTTGATGCCAC
CAAAGAGGCCTCATTATTAGGTTCTTACCAAGTTAAAATTAAAATTGCAGTTTTATTTTA
TTTATTTTTTTAAGTCAAAAAGATTCATTTTTTTTATTTTTATGTCCAAGCACAAGGGTA
ATGAAATATATTTTCCATGCAAAATATTATATACATTAAATAACATACAGTGGTAACAAT
GCAGTGTAGGTTTCCTGGGAAACAGACTCTGTGATAGAAATATATAAGCAGGAAGTGGAT
TTATTCAAAAAATGTATTTCTCTGTATAGAAATATACAAGCAGGAAGTGTATTTATTGGG
CAGTGCTGTCTAGATAAGGACCAGTGAGAGTGGAAGAATGAAGCAGGAAGACAGAGCAAG
AAGTTGAACTCTATCAAAGTCCTGACAAATATCTCAGTTGATCCCTTGAGGAATTTTTGA
AGTTGGGAAAGCCCCTTAAAGATGTCTGAATTGAGGCAATGGCCAGTCTTTGGATATCTA
CCGCCCCACAAACATGAATCTTGAATGAGACAACTTTTGCCCCTGGCTAAAGAGAGTCAT
CTCATTAAACTTCAATTTTAAATTGCCATTTTTATATAAAAATATTTTTCCACTGTAACA
TGATAATTGTTTTCCCTATTGGGTCACTACAATTTTGAACTCAGCCTCTAAAGTGTGGAT
TATAGATAGCCATTTCTACAACATGCTAAAACCAAAGCTTCTAACAGTTTCTTCTATAAT
GGCAGTTTCTATAATAATAAATCCTATCTCAATTGAGTCTCTTCTTGCCCTAATTATAAC
CTGCAATTAATTTATTTGCTATTGTACATTTCCTCCACTGTAACTATAAGCTCTATGAAG
GAGGGGGTTCTTTCCCCTAATGCTCTGCATTGAGTTGGAGGGCTTAGGTGCAAGTCATGA
AGTAGGTTTGCAGTGAATGCTTATTGGATGAATGAAACCTAAGTTTGAAAGCACTTATGA
ATGAAGCATTGTTTGTTTAAAGAATGAATTCTAAATATGAGACCTCCACATTTGGATGGG
AATTGATTTTGATTATCTCATTTCAGGATGAGCTAATAAGAGCAGTTACAGCTCGCTCAG
CCAGACAGAGGAGTTCTGAATACTCAGATGACTTTGACAGTGATGAGATTGGTATGTGAA
GGAAAGTAACCACTTTTCTTTTCATTCCTTTTGTTTTGTGTTTTAGCCACCTCCACCTTC
CATAATCACTTATTAAAATAGTACCTATGAATTCACTAGTTTTCGATTTCTAACTTTTTG
AGTAGAAAGCTTCTTAACTTTCAAGATGTTAAGATGTTGTATATTGTCCTTGGTTGTTTC
TGAATGTGCACATGAAAATATAAACTAATTGAAAGCAGGTTTGCAATAAAAAGATAGTTG
TCTGTGGTAAAACACCTTGGAGAAGACAGTTCATTTTTAAGGTCAACCCTAGGAGGCCTT
ATAGCTAGTTAGTCTCTGGCACTCACAGAACTAAGCTTTGGTCACATTGGATTCACTTTT
ATAATGCTTGTTATAAATTGTATGTTTTTTGGCTATAATAAGGGGCTGGTTTTTAAAAAA
AGGCACTTTATGTTTCATGTATTAGTATCACTATGATTTAATTTGGCACCCTATACACAC
TCAATAAATACATTTTAAATAGTGAAATTGAAATTATTTTATATTTATAAAATAATAAAT
GTCAGTGAAAACACCCAAAGTTAGCTGTTTATTAGAACTGAAAATCTCTTTATAAAACAG
ATTTGCATGTATCCATTTTAGTAATTTCATTTCAGACTTTAAGGTAACATTACTTGTTTG
ATGAATTTAATGTAACCATCACAATTTTGAAAAATACTGTCAAAAACATCTTTTTTCCAT
TTTACAGTTTCCTTAGGTGATTTTTCTGATACCTCAGTAGATGAAATTCATTTAAGAAAA
AGTGATGATTTTCAGATATCAGATGACGAGAAAGATCTCAGACTGTCTTTTTAAAANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCGAAGAAAATTCACTAAGGTTCAGTTTTCCAAGGAGGAAGTTCCTGGTGTGA
TCAGTTATTACAGTAGTGCTCCCCACAACGCTACTGAGCTTTAAGGACAAGGAGCAAAGG
TAGAAAGAAGCAGGGACTAATCCCTGTGATGTGTCCTGGGCCACCACACAGGAATTTTTT
TTTTTTTTTTTTGAGACAGAATCTTAAGCTGTCAACTTGGGTAGAGTGTGTGATGTCACA
ACTCACAGGAACCTCAAACTCTGGGGCTTAAGCGATTCTCTTGCCTCAGCCTCCCAAGTA
GTGGGACTACACCTGCCCACCACATCGCCTGGCTATTTTTTGGTTGCAGTTGTCATTGTT
TGACAGGCCCGGGCTGGATTCGAACCCACCAGCTCTGGTGTATTTGGCTGGCACCCTAGC
TGCTGTGCTGCAAGTGCCAAGCCCACACATGAACTTTTATGTGGGAGGTTAAGGATTTGG
TATCTTCCAGTCTTCTTTCTTTCTGTTTTATAAAGGATATATTACTAAAAATTGTAAAAA
GATCTCGTTAGGTTATATCATCAGTCAGTGGAGTGCTGGTAAATATTTCATATTTTGCAT
AAGGTATCTTTAATAACATCATACAAAACTTAATTTCAGGCATATTCGGGAGATATCCTC
CAGCCTCCCCACAATCCCATTAACATTAAGATGAAGAGAGACTATAAGTAAAAACATCAC
AATAGTGTCCAGAACACTGGAGAAAAAGCCACTGTATATTAGTTATTTATGACTGCAGCA
AAGATGTTAAACCTCACTCTCTCCAGGAGGAGGGGGAGAAAGCCTCCTCTTCTTGTCTTA
CCAAATAGTATTGAGGATTTATTGAAATGCATCTCAGAAGCTATAAAATGCTACAAAAAT
GCAAACATGAGGCACAATGAAAAAATTAGCGTTCTAAAATCGACCGTTTAAATGTAGTGA
GTAAAAAATCAAAGATGAAGAGGGAGGAATAAAAGTGAGTGTGGTTGGCCCTGAATCAAG
GCCAGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGTGCCTAAAGAATTATCTTTCTATG
GTCTGTTGGCTATTTCAGAACTTTGGAAATGTAATGGTCAATTCATTAGAAAGAAACAGT
ATGAGTTATTGGTGATAGATGTAGGCTAGTATATATTTGTAGTCTTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCTAAAAATTCATCTGAGTCAGATGAGTGTATATAATTA
GAAATTGATGGTGGACACATTCAGTAAAGTAGTAAGCCACCTATTTCATACCTTTTTTTT
AAAAAAACCTATGGTGAATTAAATGAATAAGGAAATAGTGTATTTTGGCCACTAGATGGC
ACCACAATTCTAAGTGTTCCACGTAGTTGTATGTAGTATATGCAATATTATATTCAGTTT
GTGTAACATAATTACCTAAATAGGTAATCTTATACATTTGAGCATGAAACAAAGCATTTT
TTAAATGTAGTGGCATTTATTTTTCTTTTTGAGAAATTGACAATTCTGGAAGTGGAATTT
GGTATAAAATATGCTAAAGTCATTATTCCCAGGTTCTTCGGGTTGAATAAAAATTGAGGC
TAGTGGTACTAAGATAATGTTTGACATATGGAATACATTAAATATTTAAATGAATCAATG
ACTGCATGAATGATTTGTTTGTGATAGAGGGAATGTAGTTCATGAATTTATTCTCTGAAT
TCTTTGACTTTTTTAATACAATATACATATTTGGAACTCTATTTTTAGTGTGGTGAGATA
TTTCTGAGTAGCAAGTAATGCTTTATAAAAATATGAGAACTGGAGGTTTTTTCTGTTATA
AGAAATCCAATAATCAGACTTTCACTTTGTATGACTTTCACTCACTTCATAAGTAATGAT
TATAGAAAGTATTTTCCTCAGGGTATGTTTTTGTGAACATTAACTGTGGAGGCAGGAGGT
TGCTGCTTTATTCCCATATCTGCAGCTTACTAGAGATTTTAATCTTGGGCACAAGGCCTC
TTTGATCCTCAGTTTATTCATTTTTAAAACAGGGATAATAGTTGAACTTGAGGTAATTAA
ATGAATTTGCCTATTTGAAGGGCTTCTAACAATATTGGCATAAATTTTAGAAAGCTATAA
TGTTTTGATAATTTCTTTTACTACTTAACATTTGTTAATAAGATATCATTTACTTATTTG
TGTATATTTATCACGAATACATTATATTTTAATTTGGTATAAGCACTGTGATAGTAACTA
AATCTAGGACATTGAGAAGATGTAGTAGCAATCATCCAACACATTACAAGTGTGTTGGAA
GATGTAAATAGTGATAACACAGAAAAATGGGCACGTAAATTTACTTAATGATATCAGGAA
AGGCTTCCTATAGGAGATGGTGATAATAATAGCAGTAATGACAAATAATAGCCATAGTCA
AGATCTTGTCTATAAGTGACCCAACCCAAAGAACTTCAGTAGAAAGGGGAAGTCATTTCC
TTATTGAAGATGGTTGTCAGAAGGCCTTGCTTCAGGGGTGATTTAAGGACCCAGTGTTTT
TAGGATGCCTTTTGGATTCTCTCTTTTCTCCCCTTTACTTCTTCTGTAACTCCCTGCTCC
TCTCATCCTCCGCCCCAGTTAGTGTAGCCCTTGGTCCTATTTTTTTGTACTCATGGCTGC
TTTTTCACACACAGTCCTTCATTTGGCAGGATAGAAAGCTACTAACAGTCTCCACATCAC
ATCCTTCTATCTCCATGACCTTAAAGACATGTCTTCCAGCTCCAAATAGACAAATACTGA
AACATCTGCCTGACCTCAGGACAAATTGCTCTTGACAGTGGAATTGAAGTTTCTGTGACA
AGCTTGGAATGGGATGTATCCTGGGCACACTCTTCTCACTGAATATGGAGGAGATATTTG
TTAGTCCCTCAAAATCACATGGATGGAGTACAGGAGAAACTGCTTTCAGTAGGGCGTAAG
CAGCGCTGATAACCCTCCCTTCGCAAACTTGAACAAATGTTCGCAAAAATGACAGGGAAC
TATTAATGATTACAATGCGATGAAGACACGATACGCAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTCACACCTTTCAGGCATTATAGAATATGCTGCTTAAACTTAGGTTCAAAAGACA
TGCAAGAATTTTTCAGGAGAAGGGGCAAAAAGTGGACATTGTAGGCAGAGGGATTAGCTG
GGAATAAGAATATGGCAGCAGGAGGGATTGGGCCATGTTTGTAAAACCGCTATTAGTCTA
GGATTTCAGGTACACAAATTATGAAATGGCTGTGCCAGTAGATAGGGCATTATAGATAGT
CAGAGGCAAAACCATGAAAGTCTTCAATATATCTCAAAGGCAATTGCACTTTTATTTTAC
AGAACTGGATTTATAGGGAGCTATTGAAGAATTTGTGGAGAGAAGTGATACAGTCTGATC
TGCATTTTATAAATATCATGGATGCAGTCATGATATTTATCATGTTGTAAATGAGAGAAG
TATGTAGCAAGTGGAACCAATAGGATATTGTGGTGCCTTGGATATAGGGAAGAACAGTGG
GAAGAATGTAGGACTTTTGGCTTTGGGGTTGAACATTTGCCCAGAGTTGAGGACATAGCT
AAAATTGTCAAAGAAACATTCATAGTGGTACTAATTTGGTATGGTTGTGGAATCCTTTGG
CAGCATTCATAAGCCCTTTAATAGGTAAAGATGAGAAAGGTTTTAATTAGACTAGTTCTA
AAGTTTTAGAAGAATACATTTATAGAACAATAGAGAAATAAAATATGTAGAACAGGTAAA
ATTCAGACAATAAGTATGTAAGTGGAAAATTCTCCTATCTATGTAGTGAGTGCTAGATGC
ATACCGGTATTAGACTCTAGTGTTAGACTTAGGAGTAATGGAAATAGTAATAACTATTAC
TGACTGTTTAATAACTGCTAAGGAAATTTTATAGACTCAAAGAATAGTAACTCATAGATC
TAAATCTTCTAGGTCAATGTTCTTTTCCTTAGTGAGAATTAGCACTTCAGTCTCCTTTGT
CTTGTAATTTTGTTTAAAAGAAAACAAGCTATAGAGTCCTTGGGTGTGCCCATTATCACT
GCCTTGATTATGAGATCAGTAATGTGTACAAGGCCTGGTATCAGGAACCCAATAAAGGTT
TCATTTTATAGAAGTAGAAATTGAGGCAAGGTTTTATTTGTTTTCGTTTTAAAAAATTAT
TTTTGAATACTGTGAAGTACATGAAGTTGAAGAGTTAACTTCTCACAAAACTTAAGTATG
CTACTTACTTTCAGGGTGGCAACTATTTTTTTTTTTTAACTTTGATTATTAATGATCACT
TATTTGTGCCTTACTAGAGCTTTGTATGGAGAACAGATTTGGGCTTCATCTGGATTCTCC
AGGATAGAGAGCCCGAAGTATGGTGTACCCTAGTGCAATAAAGCATGTAAAGGTGTGGTC
TTTTTTTTCCCCTAACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAGCATTGTTTTGTGT
ACCATTAAAGAAGAAGAAAACTCTTCCAATGAAGCTACAACACACCAGTGATTATAAGAT
GCATCCAATACAGGAAATTGAAATGTGAAAAAAATTGTTTTTCTGAATCATAATATTGAA
TATTTGTAGTTTCAAGATTTTTGTTACATATATATCCTTTTATTAGGATATTATATAATT
TATATAATTTATGGCTAAGAACAATATAGTCAGTGTTATTTTATTCATTTGATTTTTCAT
TCAGCAAATGTATATTGAAAGTTCATGGCACTGTTCTGTGCCACTTTGAGATATAACTAA
ATGCAATTAAATGTGGCCTTCCCTGTTTCCTTCTGGGAGTTCACTGTGTATTGTTAGGAG
CTAGAACTCCTAGTCCCTCCCTTAGTATTTCACTGTGGGAAGCAAACTTTCCCTTTTGAA
CACTTCAGAAAGGAAAGTACGAGAAGAACATCCTTCTCCATAATCTGCTTAGGATTATGA
ACTAACTTTACCTGATCAAGCTTCTTTCTTTCTCTCAGTACTTGTTAACAGCACTGGTGT
GTAAGGATTTCCTCCATGGAAGTAACACTCCCAGAGGAGCTCCTCTGTGCTTCAACTAAA
TGGAGGAATCCCTCTAATTCAGACCTGAAGTAGGTTTGAAGGCTACCAGTTCAAACTTCC
AATCTTCCTCTGCAGTTCAGCTTCACCAGTAGAAAGGTGACAGATTGATACACATCTTCT
GACTCTTCTGTGCTATTTCTTTGTTCTGAATAATAGAAGAAAGCAAACAATTATTTTACA
TTTAATGACATTTTCTGGTCAATTGAATATTACACTAGTTTCCTGTAGCTGCTGTAAGAA
ATTGTCACAAACTGGATGACTTAAAACAACAGAAATTTATTCTTTGTTCTGAAGGCCAGA
AGTCCAAAATCCAGGTGTCCACAGGGGCTGGTTCCCTCTGGAGGCTTTACAGAAGGAAGT
TGCTGGCAGTCCTTAGTGTCCCTCGGCTGTACCAGCATCACTTCAATCCCTGTCACATCA
CCATGTGGCCTTCCCTGTGTCTGTATGTTTCTCCTCTTTATCTCCAAACATCACCAGTTA
TGAGATTTAGGGCCTCGTTAATCCAAATGTGTCATCTTAACTAATCGTATTTTTATCTTT
ATAAGGTTACATTCAGAGGCTCTAGATGGACATAATTTAGGGGGAACACTGTTTAACAGG
GACAGGTTCCTAACTTTAAATGCTGGATATTTCTCTTGATTAATTTTTTTTTAAAGTATC
TGAAGTTTAAAGTAACATCATACTATGACAGAAAATTTAATAGCGAATAGCCAACCACAA
TCGCACCACTTGGTGGCAGTGATGTTCATTCTTTTTGTTTGCCCTTCTAGTCTGTTTTCC
TATGTTGTTTTATCATATTTGCCTTCTTAACATTTGTAATACTTTGTATCTTGCTTTTTC
TTTGTCTCTTGGAATTAAATCATAAAGCCATAAAGCTAGGTGATTTTTGGGACTGCATTT
ACGTTAATGACTATAACATAGCCCATAATCTAGAGCTATTATTTTATTGTTGATTAGACT
AGACACTTCTATTTTAAACTATCCGAATTTCCATATTCTTTATTATAAAAGTCTTCCTGC
TCTGAATCTTCTTTAAGTCTACCTTGTCAGAGATTTCCTGTCTATATTTTGTTTAAGCCT
TTTTTGCTTTTATATTAAATATTTTTTGTACCTTCACTCTCAACGTTTCCGTCAGCGTTC
AGCTGTGCTTAGGTAGCTTTCGTGAACTCTCACTTAACACTGCACCCCTGCCCCTGCAAG
CATCACAGCCAAAAATTGGAAGGGGGAGCTACATTTGCTTTCTCACGGCATCCATTCCTC
CCACCTTCCCTGAGCACACAGTGTGTGTGTGTATGTGATATCTGTGTGTTATTCATTTGT
TTAACCTGTCATTCCTAGGATAAACTCTGATTGGTGATGATACGATATTTCCTTGTGGGT
TTGCTTTGTTAATATTTGGACTTCTGTATCTATATTTATGAAGGCTATTGGTCTATAATG
TTTTCTTATAATGTTATCAGGCTTGGGTACTGAATAAGTTGGGGTGTGTATCTTTCTCCT
TTATTTTTTAAAAGGTTGTTAACTGTGAAACCAGAAATTTGGTGTCGTTTTTTCCTTAAA
TAAAAATATTTCACCAGGAGTTTTCTTTGTGGAAATGTATTTGGCATTACACTTTATTTT
TCATAGATATTTTGATATGCAGATTTTCCTTTTCATCAGTTTGATAATTTGTGTCTACTG
AGAAATGTGTCCATTTCCTCTGATAAGCGGACTTTAGAGACACAGTTATTCATGATAGTC
CCTCAGCCCTTTGATGACTGGGATTATCATGACATTTTTGTTTCTAATACATATACTTGT
GTCTTCTGTCTTTCTTATTAAATCTTAATAGGTATTGCTTAGTTTTAATTAAAATTAGTT
TTATTAACAAACACGCTTTGATTTTGTTAGTTTTTTCTATTGTCTGTTTCCAGTTTAACT
GATTTTCAGTCCTTTTTATTCCTTTTTCTTTATGTTTAATTTATTTATCTTTAAATTTGA
AAATTTTCTCACTGATTCTAAGCTTTTCGTTTATTCTGTTAAACCCACTCAAAGCCATAA
ATTTCCTTCTGTGTGTTCTTAACAGCCTTGCATTTTTAGGTGACTTTTATTTTTATTATT
ATTTTTTAAAATATATTTTTAAATTTCCCTTGTGATTTCTTTTTTAAATTTTATTTTTTA
AACTGTCAATGCAGATTTTAGGGTTATGAGATAGTTTTAATAATGCTCTTGGTCCCACAG
ATCTTAAGAACTAAACTTAAGTGGTAAATCCATTTTTTTTCCCCAAATAAAACAGGATCC
AAGTCTTTCACCATCATCGCTTAAGGAAGGTCTTAAAGATTCTTTTTCACCAGGATCTGA
GGGAAAAGCATCCATAAAAGGTGGTTATGTCTAATTATTGTATCTTATTTTATTCGTGAA
TTCTGTGCTGGAATCCTGTTTCTATAAAAAATACCATAGTATTTTGCACAGTTACAACAA
AATATGTGTTTGTATTTGTTTGGATTTTATTCCCAACTATGCAGTTAACTAATTCTGTGC
TTTAACTTTTTTATTTTCATTTTTATTTTTTGAGACTGAGTCTTTCTCTGTTGCTCAGGC
AGAAGTGCATTGTCATAGGTCACTGCCACATCAAACTTCTGGGCTCAAGTGATCTTCCTT
CCTCAGTGTCCTGAGTAGCTGGGACTACAGGCACTTGTCAGCATTCCTAATGAATTTATT
TATTTATTTATTTTTTTTTTTTGTAAAGAAGTTGTCTTGCTATGATGCCCAGGCTGGTCT
TAAACTCCTAAGCGGCAAATAGTCCTCATACCTCAACCTCCCAAAATGGTAGGGAANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTAGTTATTTTCTCTTCTCGGTCACTTTGAAAAAAAGATTTATCCAAGTTCCA
CCATGTATTTTCTTCATATTTTATTTAGGATAAAAAGGATTATAGACTTTCATTTTAAAG
GAAAGTGAGCCAATTTCTTTATCGACATTATTGATTCAGGAGGGGGTTTCTAATACTGGT
ATTCTATCTCAATATAGTTCAGGATGAAGAGTTTGCTGAAACCATAATTCCCTGAAATCA
GATGAAACTGAAGAGAATTCATTTTCAACAGACTTAGTTACTACTACACTTGAGAAATCA
AAGGAAAGTCAAGTAACTGCTGATGACCTTGAAGAAGAAAAGGAGAAAGCTGAACTGAGT
GTGGAAGATGACACAGCAGTGGATCCACTACTGTCTGAATCTCCGGGTATCTTAATATCC
ACCAAGGCCACAGGATCCACAAAGGTATTTATATACATTTTATATTACAGATTAAAATTT
GAAGTAGAACTTTAAAATACTTTATTTTTGGTGTTATTTACTTTTGAATTACCTGTGTAA
AACTCATCTTTTCATAGTGGTATTATATTGTCGAGTGGTTCTTCTATAATTCAATAGAAT
TTTAATTACAAGGAAAGTATGCATCGAAGATAATGAAACCTGATATTTTATTAAAATAAA
CAGAAGCAAATGATTACACAGCAGTCATTTAGTAAAAAAAAAAAAATACACTTTTAAATA
TCTTAGAAATAAATACCTAACAAAGATATTTGCACCAGAATGTTTATTGCAGCCCAATTC
ATAATTGCAAAGTCATGGAAAAAGCCAAAATGCCTATCGATCCATGAATGGATCAATAAA
TTGTGGTATATGTACACCATGGAATATTATGCAGCCTTAAAAAAAGATGGAGACTTTACC
TCTTTCATGATTACATGGATGGAGCTGGAACATACTCTTCTTAGCAGAGTATCTCAAGAA
TGGAAGAGAAAGCATCCACTGTACTCAGCCCTACTATGAAACCAATTTATAGCTTTTCAT
ATGACAGCTATAATCCAACTATAGCCCAAGAAGAAGGGAAAGAATNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATACCCAAGGTCAGTGATGGAGCCATATTTTAAATCTTGGCTCCAG
TGTTGTTCTTTTCATTGAATAGACTGATTAACAGCTTCAATGATTTCATTCATCAATTGA
GTCATCAGTACTCTTCAAATGTAAATGTATAACTGTGATAATAAACTGATGTTAAAAATA
AAAATAAAAATAAAGCAAGTGGCCAAAATAATCTCCCCTAGTTTACCTTACTTCAAAACA
ACTTCCCCATAATGGCCATAATGAAACCAGCAGAATTGATACATGCAGGTTTAGCCAGGA
AGAAGCATCCTGGTAGAATTGAAAGTTGGTGATCCCCACAGAAAGCAAGGATTTCTTTCT
TTGAACATTCCAAAGTGTGGTAGAATCGGAATATCAGAAACAATTCTATAAAGCCAAACT
CAGTTCTTTTGTGCCAGAGCTTGAGCCTGTCCCTTGAAGTACTGAGAGATTAAGTAGCAG
GCCTATCTTTGGTGTCCCTTTTTGGTATCAGAGGGAACACTGTGTCATGGTGGGCATGAA
ACTAACTAAAGCCTGGTTTCTCTGTGAAAAATTGCATTCATCCTTGGATCTCTCCGCATA
TGTACAATTCAACAATTTTACTACTAGTAATAAAACTAGTAACTGTAATAGCCGCCCTAG
AGATATGTGCCTACCACTCACACGGCCTGTTGTTGCAGCCAAGAAACACAGGCTTTAGAA
TTGAATAGATGCTGCCATCTTAGCATATGCTTCAAGAAGCTCTCCAATTGTGTGTGTGTT
TTAGTGTAGCCATTCATTCTATTTGTTAATATGCTGTGTTTCTAAGTATTAGGCTTGTCA
GGTGCTTCATCAGGTTAAGAGTAGTTATTTTCTCTTTTGTCGGTCACTTTTGAAAAAAGA
TTTATTCAAGTTCAACATGTAATTTTCTTCATATTTTATTTTGGAATAAAAAGATTATAG
ACTTCATTTAAAGGAAAGTGAGCCAATTTCTTATCGACATTATTAATTCAGAAGGGGGTT
TAATACTGGTATTCTATCTCAATATAGTTCAGAATGAAGAATTTGCTGAAAACCATAATT
CCCTGAAATCAGATGAAACTGAGAGATTCATTTCAACAGACTTAGTTACTACTACACTTG
AGAAATCAAGGAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCATTCCCTTTTTAAGAGATGGATAGTGTCATCATCAAGAACATTATTATTATAGAA
ACTTAAGAAACAGATTTTTGGTATGTGGATTACTTGTCCCTACACTGAATTGTACCTGAG
TACTATTCTTTGAAAATTTATGGCATAGCATTTTTAGTTTTTGTTGTTCCTAAACTTGGT
CTTTATCTCTTATAGCAACAGTTATCTGGCAGCTATGTATATTCACTGTTAGGGGAAGAG
AGCAGTACTAATGGCAAACATGTTGAGCAGGACTTTTATACTACAAGATAACAATATACA
CACACGAAATACAGCTTGTATTAAAATGTATGGAGACGTTCCTTAAGCCACGTTCTAGGC
ATATCAGCCTTAGCTACCTGAGAGGAAACACTACTGCTGGGGTAGGGATGTGTTTACATC
TGTGCTCACTTTACTGCTAGCACCAATCAGTCTGTGTAAAGTAGAAAACTTATCCCTAAA
GAAGAATATTCCAGAGTTTATAGATAGTATCTTAAAAATCGGCATAGAGGTCATTATACA
TTAGAAAAGACAGCCCTAATTTAGAATTAGAAAGTGAGATCATAGTATACTCTTTTGACT
GCACTCATGCCTTTATTGTTATTCTCTACTGAGTGACCTTTCTTAGGTCTGAATCAAACT
GTTCCCTATTAAAGTCTCTTTGTGGTTTTCTCATCCAAAGAAAAAAACCCAAACTCTTTA
CCGCCTCCTAATGATTTCATATGGCTCTTCTCTGAGCACATAGTCCTCCATTCTGCCCAC
CATTGGCTGTGCTTCCCCACCATTCACTTTTGTCTGTTTCAGAAGTATCAAGCTATTTCC
TGTCGCAGGCTTTTAGCACTTGCTGTTTCTTTATTTCCATTGACTTTCCCATGAGTCCCT
TCCACTCATTATTTCTCCCAGCTTTGATATCAGCCCTTCAGGGAGACTCTGCCTGATCAA
CTTCATTCAAACAGCCCCTTAGACCCCACGCGTCCCTCTCTGTCACAGTACACTATTTTG
TCTCCTTCGTGAGTCACATTTGTTTATGTGTTTATTGTTAGCCGATCCTCTCTAAAATGC
CCTCAAGGGCATTTCTTTCAGTGATTTCCTCCCAATGCTTGCTGTGTTTGACACAGATGT
TTTATAAACACTGATTTATTGGCAATTTGGCTCCTCAGCATAACAGTTATAGTTTTGGTG
AATAAATTATCTATGGCATTTTCTGTTTAATAGAAAACAACTGAAGATAGAAATATGAAG
AATGCCAAGTCAACCAATAATAGAGCGTCCAGTGCATCTGCCAGGTAACAGAGTTCTCAG
GGACTTTCATTTAGAGATTTGAATTCTAGCAAAGGCAGTTTTAATTTAACTTCATAAAAG
AAATTTCAGTTGGCATTACTTTGTTTCTTTTTTTTTTTTTTTTTGGCAGTTTTTGGCCGG
GGCTGGGTTTGAACCCACCACCTCTGTCACATGGGGCCGGCACCCCACTCCTTTGAGCCA
CAGGCACTGCCTGGCATTACTTTATTTTCTCTTAATTTTCATCTCATGAGTAAGGGAGTA
GGTTACATCATGATAAAAACTCCTTGGTTGATTATATTAGAAGAATTAAGAAATGATTAA
GTCTATTACTGGTTGTTTTTATGCCTGGCATGTCTTTGTAATACCTTTGGTCTCCAAGAT
CTGCCTTCTTGGAATAATTGTCTTCTTTCCTAATGTCAGTGATTAGGGATTCTCCATACT
CTACACTGTTCCTATGTTTCCTGTGACTGTACATACAAAGCAGTAATAAAGCTAAAGTCC
AGCAGTTTTTGATTAAGTGCCTTTGTCTAAACATGAAAAATTGTACTTAAAGCCTCCAGT
TTCTATGAACTAAGTGAGTTTACTAAAATGATCAGAATCTATACAAGCTTCATCCATGCC
AGTGGTAATGCTTAACTAGTAAGTACTAATGGAAACCTTCTGAATCTTTTAAATTGTTAT
TAATCACATTTTCATTTACTAAATAGAACAAGGCCAATTGAAATTTATAGCTTTGTGGCT
GAAAATATGTACTTTGATTTTCTGTGTTGTAACTATTCAGTTCTGCTGTCGGAGCAGGAA
AACAACCAAAGACAAAGCTTAAGTGAGCGACGAGAGCTGGAGTGCAATAAACGTTATGTA
TCAAATCAGGTGGCAGACCATATTTTCTTACCAGGCCCTGAAATATGGGGCACTAATCTT
TATAATTTTGTATTTTTTTTTTTTTGAGACAGAGTCACGGTTTGTTGCCCTCTGGAGAAT
GCTGTGGCGCCCCAATTCACAGCAACCTCAAACTCCTGAGCTCAAGCAATTCTCTTGCCT
CAGCCTCCCACCTCCCAAGTAGTTGGGACGATAGCTGCCTGCCACAGCACCTGGATTTTG
CTCTCTTTTGTTTTTGTTTGGTTTAATAGGCCCAGGCTGGGTTCAAACCCACCAGCCCCT
GAGGATGTGGCTAGCACCCTAACCACTGAGTTACAGGCGCCCCCTCTAATTTTATATTTG
TAGTTGTTTATGTAACAAAATAATGCAAGAAAATACTCAAAGAATGATTTTTAAAACCTA
CTGTATTAATTATGTTTTTCATGTAATTTGAAGTGTGGTTCATGTCCCTTCAAAAGGTTC
TAATTATAAATATCTAAAAGAAATGATCATTTTAAAGCACTATATAACTTAAAGTTATAA
AATGTGGTGTTATGTTGAATGAGGCTCTTCATATACAAAAAAACACAATATGTTTACATA
ATTTTTGAAGTAATTATGCATTATATTACAATGTAGTTTTCAAATATAATAGTTGTCTAT
TCTAACAGATCTCGCTTATACCAAGTGAAAATGTAATGTTTAATTTTTATTTATTTGGAC
CTTTTCAGATTAATGACCTCTGAGTTTTTAAAGAAATCGAATTGTAAAAGGAGAACTCCA
TCGGCAAGTACTTCTTCTCATTATTTAGGGACTTTGAAAGTCTTGGACCAAAGGCCTTCA
CAGAAACAGAACATAGAACCTGACAAGGCAGATGCCATAAGGGCAGCTGTTTATCAGGTA
AAAAAAGAAAAATGAAAAAAAGAAAAAAAAACTGATCACTTTCATAAAGCTATACTTTTA
TCAAAGAATAAAATAAAACTATCAGAATGATGGTTTAATACTTAAGTTTATTACAAGGGA
AACATTTTCTTTTATAATATATGAGCAATCTAAAACTATTTTGCTAAATTATTCCCTTCC
ACAGTTCACTTATCATAGTTATTTTTAAAGGAAGAACATGCTATTTCAGTTTATAGAAAT
ATGGCAGAAGCTAAATTGTTGTACGGTCTATGCATGTTTTTATGCTTTTGCTCTGTAGTA
TATTATTCTGTAAAAAAAGGTCTTTAAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTTTGTTAACTTATAGCCTTTATGTATTAAAATATTATCAGAGAAAGA
AAAATCATATGAGCTTAGATAGAATTTATATATTTTGTGTTTCCTTTTTTGAAGTTTTAA
TCAAATATTTCAGAAATGGCAGTCCCAATTTATTGGGAAATCTTGAATATCATATAGGCT
TTTTCTTGTTTTTATAGGAATGGCTAGAAAAGAAAAATACATATTTACATGAAATGCACA
GAATAAAAAGGATTGAAAGTGAAAATTTAAGGATCCAGAATGAACAGGTATTGTGAAATA
CAGAAGTAAAAATGTTCTTGATGTTTATGTCATTAAAATACCTCTGAATATTTAACTTTT
CTAAATCACTCTTTTTAAACAGAAAAATAACGTCTATACTAAAGAACTGATTTCTGATTT
TATTTCTGTTGTACTTTATGCATTTTAAACTGATACAAATGTTAATTTTACATGAAAACA
CAGATTTTTATTTTACATTTGTGTAGAAGAGCTACACTTAGCCAAGAGGATAAAGATAAA
TGAATACTATACATTCAGTACCCTTCAGTTTTCCTTTTTTGTCTCTTGAATCACATGTAG
CTTCCCCACCAACCTTGACCTGAGTTCTTGACCTGGATCCTCTCCCGCTGACTGCTGCTA
GACTTCCATTCTAGTTTCTCCTGTCCTTCTGAGTCCCTTCTCTAACTCCTGCTTCATTGC
CTGCAACACACTCAGTTCTTTCCTACCTTCCCAAATAAAAGTTCTGGAAAAAAACATTTC
ATTGTGCTACTCAATACTAAAGTAAATTTAGAAGGAAAACGTTTTACAAAGTGAACTGCA
CTGTAACAAACTGGTCCTGAGCAGAGCAGCATGGCAGGGGTGGTGCCTGTAGTGTAGCAT
CATTCTGCTGTAGGTCAGGACCACACATCTTCTCGTTAGATTCTCACTGTACTGTGGCAG
GTAGTGCTTTGACTTCCAAATTGTTCCCTCCATCATAAGGCATTGTGTCATTTAATACTG
TAATTATAAAGCAAACAATATTATGGGATTAGTTTGAATAAGAAAAACGGCAGCATACTT
GCAATACAGACTCCTGCATATCTTTTAGTCCGGCATACATTTTCAACATTTTGGATGTAA
TTGTAGAGTGAGAATGTTATGTTTCAAAGCTAGGGTTCAAACCAAACATTTACTCCTTAT
TTTGTGACTTTGCCTTACTCTAGCTTACGATATAAGCTTATACCTTTCCTGCCTTTTTTT
CTGAAATGTTTTTCCATGAACATTTTATCATACCACTTAGCCTACTACAATTGATTGTCA
TACATTTATTTAGTATACTTCCAAAAATAATAGTTGACTTCCTTCTCATGAATAGTAGGT
CAATAGCTGATAAACGCTTTTAGAAAAGGACATTTTGCGATAATTGGGATAATATTTTTA
TAAATTAACTTTTCCATTCTAAATTACTTGCTTTGAAACTTAACATATGATGAATATCAA
AGGATCAAAGATAAATGTGTGTGTGAGTATCCAGCTCTGGCTGTGTGTCTGTCTGTTATT
TTATCCACTACAGAAAAGAGCTGCTAAGAGAGAAGAAGCATTAGCATCATTTGAGGCCTG
GAAGGCTATGAAAGAAAAGGAAGCAAAGAAAATAGCTGCCAAAAGGAGGCTCGAGGAAAA
AAACAAGAAGAAAACTGAAGAAGAAAATGCTCTCAGGAAAGGGGAAGCACTACAAGTATT
CAAGATCTTTGAATATTTTTCTTAATTTGTTTTAAATATTAAAAATCTGAATCAATGCTT
AATCGTATTTTTACTTGTTTTATAATATTCACAGTAAGAAAATTATTCTAAACTTTTTCA
GGCTTTTGAAAAGTGGAAAGAGAAAAAGATGGAATATCTTAAAGAGAAAAATAAAAAGGA
GAAGGAATATGAAAGGGCAAAGAAACAGAAAGAGGAGGAAATTGTTGCTGAGAAAAAGAA
AGATAATTTAACTGCTGTTGAAAAATGGTAATCCCAAATCATAGGTCTTTTGATAGATAT
TGAGAGCACTTTTGGCTTTTCTAACATTTATTTACTTGAAATTTGCTAATACAGTATAGT
CTCATTATTGTCAATGACTTTAATGTGTTTAAGGAATCTTCATTATGTATTCTCCTTTCA
CTTTCCAATATTTTATACTATCCTATAAAGGAATGAAAAAAAAGAAGCTTTTTTCAAGCA
AAAGGAGAAAGAAAAAATAAATGAGAAAAGAAAGGAAGAATTGAAAAGAGCTGAGAAAAA
TGATAAAGACAAACAAGCTATTAATGAATATGAAAAATGGCTGGTAAGTATCTGTTGGTA
ATTGTACTCATGTCTTTTTCATGCACTTTTTTTTTTTTTTTACTTCCAGGTAGAGATGAT
CAGTAGTTATGGGATGAATAACATTAGAATTAGGGACAGAATAATCATTCTCTCCACCTG
TATATAGTGTATTTTCTTTGATTTACTTATTTCTGTTAATGCTTCTATTCCCTCAAACAC
CTATGCATAAAATTTCAGTTATAACCTTATTCCTAACCTACATCTCCACATTTGCTGTTT
ACCAATAATGTCCAGTCTTCCTATGCAGTGATTCTGAAATATAAAATCATAGAAAGCAGA
AAAGTACATGTGTACTACTGAAAGTATGCCAGATTATTTTGGATGGAACTTGGTCATGAC
ACACAATAACATTGAACTTACTAGTGAGAAAGTTATTCCATTTTTTATTCTCTTTTGCTA
TCTGTGATGACCTCTAGGAGAAAGTCTTATGTAGGTGTTTGGGAGGAACAATAGCTGGAT
ATTATATGTAAAATATACAGTGAAACCTCTGTAAGCTGACCTCCCAAGGCACTGTAACAA
ACTGGTCAACACACGGAGGTGGTCAACATAAGAAATGAGGCTACCGTACTGATAAGTACA
TGCAGCGCATGCCCAGTCTGTGAAAATTAGGTTAACTTAAGGAGATGGTCAACTGTGAAG
GTTCTACATATATTGTATGTATGTTTTGGTTCCCTTCTGTTTATAAAAATTGCTTTTGTT
GATGTCAATCAAAGTCCTATTTTCCATTTTCAAATATCAATAAAAATAGGATTTGTTATC
AGGTTTTGAGTAAGTAACACATTCTTCTAAGTACTTTACATGGGTAGGTAACAAATTCAT
GTACATAGTCTATACAATCCCATCATTTAGCAATCCAAAACTGTAAAATTTATCTACTAT
CTACCCAGTAGAGTTTCTTATCAACTTTTTAAATTTGATTAAAAATTTAATCCCATTCAG
CTAATTAAAAACCATCATCTAGGATAATTTTGATTTGTATTTTCTGGTTAGGATTAAGCT
TCAGCATCTTTCTTATCATTAGTATAAGGGCTATTTTTATATATACCTTTTTTCTGTAAA
CTGTAAATTCATAGACTTTGCATATATTTTTATTAGATTGTTGATTCTTTTTTATTTATA
GAAATTTTTATGTACTAGTGAAATTAGCCTATCATTTTTTATGCATTGAAGTATTTTTTT
TCACTCTATTGTTGGTTTTCCAACTTCGCTTATAGTATTTTATGCTTTAAAGAATTTAAT
TTTGGCTCGGCACCTGTGGCTCAAGTGGCTAAGGTGTCGGGTTCGAATCCAGCCTGGGCT
GCCAAACAACAATGATGGCTGCAACCAAAAAATAGCCGGGCGTTGTGGCGGGTGCCTGTG
GTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGATTG
CTGTGAGCTGCGATGCCACGGGCACTCTATCAGGGGAACAGCTTGCAGCTGTCTCAAAAG
AAAATAAAAAACGAATTTAATTTTATTTTTATATAGCAAGCATGTTTTTCTTGTCTTTTG
GCCTTTGATTTTCTTTTTTGGCCTTTGATTTTCAAGCATCATTGAAAAGACCTCCACACT
TTGCGGTTAAGAAAGGTCTCTCATTTTTTTCTAACCACTTGATGAGTTTAATATTAAACT
CAAAACGAGGGTTCAAACGAAAAATTTACTCCTTAAAATTTTAAAATTTGTTCTAATTAG
AATGTATCCTGATGTATGGTGGGAAATATGATTCCAACTTAATTTTTTTCCAAATGTATC
ATTTACAAAACAGCCCATCTTTTTCCCATTGATTTGAAGTGCTTTATTTTATGATACATT
CTTATATTTTGGGATCTGTTTCTTAACTCTTTGTTCCTTTGTCAATTTCATAATACATGA
ATGCCAGTGCTACACTGTTTCATTATTATTAGACTTGATATATCTAAATATTTTTCAAGT
ACATCTCCCTTTATAGTTTTTCATTCATAGTACTTCTGACCATTTTTGTTTATTTTTTCC
CTGTAAACTTAAAAATCAGCAGTAGTTAGGTGCATGAAACTAAAATAAACTATTTAAAGA
TAGGATAAAAAGGTAAAAGATAAAAAAGACAAAACACTTAAGAATAAACTTAAGAAATAT
GTAAGAGCAATACAAAGACAGTTTTAGAACTCTTCTGAACAATGTAAATGAAGACTTGAG
AAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACAGGGCTATTCCTGTCAGCAATAAAATA
AAAATTTACTATTCTAGTCCAGTATTCTATCCTCCTGAATTATCCCCGTCATGTTCTAGG
TTTAGAACAGGAAATTTTATAAAAATAAACTCTTAACTCCGCATTTTTCTCCACGAGTTG
TCTCACTTTTCTCTGCTTTTCTTCATAGCAAAACTAGTAGAAAGTTTTATCTACACTTTG
GTGGGTCTCCGCATCTTTTTTAGTCTTCTCCCACTTTAGTCTGGTCTGTGTCCTCATCAG
TACCCCCAAACCACAGGAAAGTTACAGGTTTACAGCTAGATAGTCTGATGTGTGTATCTG
CCCCCATTCACTGGAATGTCTCTGCATTATACGCTATAAACTTCCTCCTGGCAAGTGTTT
CCTCCTTGGCTGGCATGTTCCTCTCCCAGAGAAGTGTTCCTCTCACCTCCCTGTGTGGCT
TCATTCATTTAACATGGCTCCAAAGCACAGTATGAGTGATCGCACTCTTCTACCTTCTCA
TTGTCTGTCATCTGGCTCCCCATGTCTTGTCTTTAGCCTCCCACCAACGTAGTTGCACTG
GCAACCTTTTGTTCTTTCTCACATCTCAAGTTGTTCCCATTTGTCAAAGCGCTCACCTCT
TCTGTTTTCTCTGCTTGAAGTCCTCTCCGCCAACACTTTACACAAGTGGCTTCTCTTACC
TATCGTGTCTGACTTTAAAGCAACTTCCCCTGAATCTACTTTTCTTTTAAAGTAAGCCCT
ATTATAAAATTAATTTATAGCTTTCATATGAAATCTATAACCTAATAGCAACCTAAGAAT
ATGGGGAGAGGGGAGGGAGAGGGGAGGAGGGAATGAGTGAAGGGAGAGTGATTGGAGGGA
TTCACTTCTATGGTTTATCTTACAAGGGTCCAAGTGAATCTTTCTAAAAGTAGAATATAA
ATGTCTTAACATAATAACTAAGAAAATGACATGAAGGCTATGTTAACCAGTTTGATGAAA
ATATTTCAAATTGTATGTGAAAGTACTACACTATACCCCATGATTGCATTAATGTACACA
GCTATCATTTAATAAAAAAAAGAAAATTCACAAAAATCTAAATAAATGTTTGATAATGTG
CTAAAACTCAATAATACATAAAGAAACATGATGTTGAATTTTCAACTATTTGTAAAAAAT
TTAAAGAATCTCATGTTGCTGTAAACTTTATACATAGTAAATTGCCTTCTGAGAATCTAT
TCTCAGAAGTCCTCACTAACTTTTGGTAACTACTGTCTTTGAGGTGTAGAATTATGGATT
TTATTTCTATTTTACAAATTCATTTTTCATGTTATAACTTTTAATAGTAAAAAGATTAAG
TGTTGTTAATACCTATTGATAATATAAATTGGTGGCATTCTTTGGCTGTTTTTTATAACC
CATTAAATTAGGGAGTAATATATAAAATGGATTATTTTATTTTTCACTAAGCAAACTGAT
TTGAAAATAATGTTTACATGTATATATAAATATATCGTTTTCTACTTGCTTTTCAGGAAA
ATAAAGAAAGACAGGAGAGAATTGAACGAAAACAAAACAAACGTCATTCCTTTCTTGAAA
ATGAAGCACTTCCTCCATGGAGCCCTCCAAGCAGAACTATATTCTCAAGAGTGTTTTGAT
AATTCTGGTTCTTACTTATTTAGCTATTTATCAATTTGCCAATTTTAGCCAGGTATTTAA
AAATGTTTATTGAATTATTTTTAGTTAGAAGAATCTATTTTGATTAAATGCCAGACTCTT
CTACTGACAGTGAAAAAGATACTTTGGAGTTAATCAGTGAAAACATTTTTGAACTGTAGA
TAAACTGCCTCAAATGATAAGGTAATAATCAGATTGTCTGTACCATTAAAATACATAAAG
TTTTGTCATGTCTTGGTAATTCCTCCAGGGGAGTGATTCATGATCTCCTCACCAAGCGGG
GCATGTCATTTAAGTGTATTTAATCCAAATAATAAGAGTGAAACAATCTAGGTACTGTAA
TCATAGAAGTAATTCAAAATGTGGATGGTATGCATCTTGATTCATGTTTGTAAATGAATG
ATCATTCTGAAACTGATTTTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 2306..2390, 3127..3161, 3164..3172, 3175..3183, 3186..3212, 9158..9382, 12595..12679, 16767..16864, 16867..17010, 19293..19363, 20948..21116, 21737..21826, 23113..23274, 23401..23546, 23730..23862, 30956..31078
1001..1075, 2306..2390, 3127..3161, 3164..3172, 3175..3183, 3186..3212, 9158..9382, 12595..12679, 16767..16864, 16867..17010, 19293..19363, 20948..21116, 21737..21826, 23113..23274, 23401..23546, 23730..23862, 30956..31075
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved