Otolemur_garnettii Locus MRE11A
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii MRE11A
Otolemur_garnettii
MRE11A
GeneScaffold_143
SNORA51
107789..107913
114845
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTT
TCCGACTGAAGACGGCCGCGAGTCCCAATGGTGGGGCTTTGAAGAGTCCTGGTGTGGGGT
AATTTAGGAATCAGCCCTTTCCAATTTTTGCAGGTTCCCGGGCGGAAGGCCAGAGTGAAT
TGGACTCTGTGGGAAGGATGGGCCGAGTCGGCTGGGAAGGGGTCCAGGAGGACTCCGCGT
TGTGACTTCACAGTCCCGTGAAGAGGGTGTATAGAGTTCCCACAGAATCTGGAACTCCAG
ACGTGGGAGGGGTTGTTTCGCGGTGGCAGTCCTATCTCCCAGTGTGTTGGCCGTTTTCGG
TTGCCCTGCTGCAGCCTTAAGGTGTTTCTCCGCACACCACGTGTTTGTTTATTTAAACCA
GCTTCTCTTTTAAAAACAAGCCCGGTCCTTTAAAAAAAACCCAAAACTTTTGTTTGCGCA
GGAAATACTGCGTTCCCTCCATGCAGGACACTGAAACATTTCTGCGCATGCGGAGTCGTT
TGTGTACTAAACCAGAACTGTATGTAACACTTTTTGCCCCTTTGTGTAACGTACATTAAT
TTTCCATAAGAATGTGGTAAGGGAAAATAGGAGGTATCATAATGATGAAACTAGAATGGC
ACTGGAGAGGTATTATTTTCTATTCTTAGCCCATTAAAACCATAAAAGTATAATGAGTGC
TTAGATAAAAATGGAATTTCCAAAATTGATGACTACTTATTTAAGACGTCTGTACCATGT
GCAGTTTAAATTATGTTGGTTACATGGAGCCGTTTATAATTATGTTTTATGGTGTATTTG
TTTTCAGAATTTGCTAGAATTTGGAATCGAGTATATTTCCTGACATTTGAACCCAGGACC
CGGGGTTCTTGGAGAGGAACTTTGTCCCAGAGCCCATAAAAATGAGTCCTGCGGATGCCC
TGTAAGAACTTGACTTATGGAATCCTTTGTTTTGGGTTTCCAAAGCACAACAACTATAAC
CATTGTAAAAGAAAACTTTTTAAATAAATTAGCAATAAATAAGGAACTGGCATATAAACA
GAAATGTTAGGAATATTTGAAATGTTTAAAAATCCACACTACATTAGTTTATTAAAAGAT
AAAATGCAGCTATAGATCGGAGTCTTGCCATAGTTTGGCACATTGCTATAGTGTGTAATT
TTTGTTTTTAGCCTTTATCATAAGTTATTGGAGCTATAGACTTGAATTTTCATGATAAAA
TCTTAGTGTAATTCTATATAAAGTAGATTTTTAGAGTAAATTGCTCTAGTATTGTATAAA
CTGGAAATGAATTTGAGTAAAATGGAAATAAAAGATTGTAAAAGTTATGTGGAAAAACTT
TAGACTCCGAATCTTTTACCCTGGTTTAAAGTCCTTGGTTAGTACGAGCTGTGTGACTTC
AGGCAAGTCTACAGTTCTCTAAACCTTGCCTCAGTTTCTCCATTTATATAGTTGACAGAA
TAATGCCTTTCTCAAATTAAACTTGAGGTTTAAATGAGAGAATGCATATGAAGACACATT
ATAAATGGCTGTGGAAATATCTGGACATGTGATCTGAAAAGTATTCTGACCTAGCTATTT
GTTTATAACAATCAGAACTGTGTGCATATAAGTTTTGAAGTTTTTGAAGAAAGATCTTTT
CTGGAAATAAGTTTTGTATATAAAAATTTGAATTTTGGAGATATATATAATTTTTTTTTT
TGAGAGAGAGAGTCTTATTTTGTCACCCTTGGTAGAGTGGGTGAGCTGTGACACCCCACA
GCAACCTCAAGCTCTTGGTCTTCAAGACATCTTCTTGCCTCATCCTCCCCAGTAGCTGGG
ACTATTGGAGGTTGCCACGGCCCCTGGCTAGTTTTTCTATTTCTAGTAGAGATGTGGTCT
TGTTCTTGCTCAGGCTGGTCTTGAACTTGTGAGTGCAAGCACCTGCGTGAGTCTCCCAGA
ATGCTAGAATTATAGAGGTGAGCCACTCACCCAGCCTACAATTTTTTTTCTTAAAGTTAT
ATGGTTAAAAGAAAATAGGCTGGGTTTTTATCATGAGATGCCTGCCTCTTCCCTTGTACT
AGCTGAGATGAGTTCAGATATACAAATATTTTAAAGAATTAAAAGTTATATTACGTGAGT
ATTAATAACTATTTCAGGGTCAGGCACAGTGGTTCATGCCTGTGATCCTAGGGTTCTGGG
AGACTGAGGCAGGAGGATTGCTGGAGCTCAGTAGTTTGAGATCAGCCTAAACAAAAGTGA
CACCCTGTCTCAACAAAAAATAGAAAAATTAGCTAGGCCCAGTGGTACATGCCTATAGTC
CCAGCTACTTGAGAGGCTGAGACATGAAAGTTGCTTGAGCCCAGATGTTTGAGTTTATAG
TGAGCTATGAAGTAACATGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGAGTTCGTACCCAATCT
GATAAAAAGTCTTTTGCAGCAGGGTATTTATAGCATGAATTGGAGACCAGTTTGATGCTT
TTTAAAAAGTATTGACACTCAGGGTGGAAAGGGAAGTGAATGCGGGAGATATCACAAAGA
GAGGATTTGCATATTTTGGTTGTAGGAGGTAGGGATGAGGGGAAAGGGTGACTTTAACTC
TGAAGTGTATTGAGTCTGGGTGAGTGGAAGTACCAACAGTAGAAATAAATAAGGAAAAGA
TATTTATTTATATGGGAAGGTGGTGAATTCTGATTTGGACAAATTTAGAGTTGGAGATTC
TAGCAGGACACTGGACATTTCTAGCAGGCAGGTGAAATGTCAGTCTCAGAGCCCTAGAGA
GAGCTGGAGAGTGATGGGGCAGATTCTTTTTTTTTTTTTTTTTGGAGACAGAGTCTCACT
CTGTTGCCCTGGGCAGAGTGCTGTGGCGTTGTTACAGCTAACAGCAATCTCAGTCTCTTG
GGCTCAAGCAATCCTCTGGCCTCAGCCTCTGGAGTAGCTGAGATTATAGGCACCCACCGT
GACACCCAGCTAGTTTTCTATTGTTAATGGAGAAGTGGTCTTGCTCTTGGCTCAGGATGG
TCTCTAACTCCTGATTACTGTGCAAGCTCCTGCACCTGGCTGGTGACTTGCAAATTAGTA
TTTCTAAACTTTTCAGCAGAGTTCTCTCTAGTTTATCTGTAAGGCCTTTAGTTCTTCCTC
CTAAATATATATGGAACCTCTCTACTACTCTATCGTCATGCCAATATACTTAGTCCAAAA
CTTTTATCACGTTTTGCTTGGACTGCCGTAGCTACCGTGGGTCTTTCTACTTCTGTTCTT
TTCCCTTCATCTATGAGTGTAGCAGCCAAAGTGAACATTTAAGATCATAAATCAGATCAT
ATCACTCTGCTGCTTTACATCTTCCAAAAGGCCTTCCACTGAATCTAGAATAAAATGCCA
ATTGAGGTTCAACTTGATCTGGGCCCCAACCAGGAGACTTTGTTTCCTACAACTCTGCTT
GGTTTATAGGTTCCATCCACACCAGCTTGTTCTGTGACCTTTGCATGTCTGGTTCTTTCT
GTTTGAGCACTTTGATCTTAGCAGAGTTGACTTTTCATTCCTCAGTTCAAATTTTACCTT
TTTGGGGAGGTCTTCCCTGATAACTCCAGGTACTTTTTGGTCACACTACTCTGACTTATT
TTTTTCCCTGGCTCTTTCTGAAATAATTTATTGAATTATTTGTTTATTAAATGTCTCTTT
CACTGGAAGGTAAATTGCACCAGAGTGAAAAATCATGCTATGTCCTAGTACATAGAAAGG
ACCTAAGAGCAGTAAATACTCTTTTAATTTTTTTAATTGAATGGAGGGAAGGCTAGTATG
GTTTCCTTTGAGGATGAATTCTTCCTTCCAGGGCAGAGAAACTTAGGGCCAGAGGACCTC
TGTTTCCTGCCAGAGAATCCTGCATGTACTTGTTATGTTTTAACTCCTAGGCCCTAAAAC
ATTTTTTTCCCTGAGGATAAGCTTTCCTTTACGTTGTCCTTCCGTTCCCTCCTGTTTTTG
TTTCCCTCCTGCATCCCTTAATCTTAACTGCTCCACCCCTCTGTGGCTCCATGCTGGTAC
TTATTTATACTGTTGTCATGTTTCTTAATTTGTANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACATTGGATATTTTTTCTTCCATTCTTGAGATACTTTACTAAGAAGGACATGTTCCAG
CTCTATCCATGTAAACGTAAAAGAGGTATAGTCTCCATCTTTTTTAAGGCTGCATAATAT
TCCATGGTATACATATACCACAATTTATTAATCCATTCATGGGTCGATAGGCACTTGGGC
ATCTTCTGTGACTTGGCTAGTATGAATTGAGCTGCAGTGAACAATCTGGTGCAAATATCG
TTGTTATGAAGTGATTTTTGGTCTTTTGGATATACGCCTAGTAGAGGAATTGCATGATCA
AACGGCAGGTCTACTTTCAGGTCCCTGAGTATTCTCCATACTTCTTTCCAAAAGGGATGT
ATTAGCTTGTACTCCCATTGGCAGTGCAGAAATGTTCCCTTTTCTCCACATCCACGCCAG
CATCTGTAGTTTTGGGATTTTGCTATGTGAGCCACTCTTACTGAGTTAGATGATATCTCA
AAGTGGTTTTGATTTGCATTTCTCTAATGATTAAAGATGATGAGCAGCATTTTTTCATGT
GTCTATAGGCCATGCACCTATCATCTTCAGAGAAGCTTCTGTTCAAGTCCCTTGCCCACA
GTGAAATGGGATTACTTGTTCTTTTCTTATTAATAAGTTTGAGTTCTCTGTGGATTCTGG
TTATCAAGCCTTTGTCAGAAGCATAACCTGCAAATATCCTCTCCCATTCTGAGGGCTGTC
TGCTTGCTTTACTTACTGTGTTCTTGGCTGTGCAGAAGCTTTTTAGTTTGATCAGATCCC
AGTAATGGATTTTTGGTGTTGCTTCAATTGCCCAGGGGGTCCTCCTCATAAAGTATTCTC
CCAGGCCAATTTCTTCAAGTGTTTCTCTTGCACTTTCTCTAAGAATCTTTATAGTTTCAT
GTCTTACGTTTAAATCTTTTATCCAGTGAGAGTCAATTTTTGTTAAAAATTGTTTAGTGA
AAAGTGTGGGTCCAGTTTCAATCTTCTATAAGTTGCCAGCCAATTCTCCCTGCACCGTTT
GTTAAATAGGAAATCTTTCCCCCAATTTATATTTTTGATAGCTTATCAAAGAGCAAATGA
TGATAAGTGTCTGGGTTTATCTCTTGGTTCTCAATTCTGTTCCGTACATCTACCTCTCTA
TTTTTGTGCCAATACCATGCTGTTTTGATCACTATAGATTTATATTAGAGTTTAAAGTCT
GGTAGCATGATTCCTCCTGATTTGTTCTTATTTCTGAGTAATGTCTTGGCTATTCAAGGT
TTTTTCTGGTTCCATATAAAATGAAGTACGATTTTTTCCAGATCTTTAAAGTATGACGGT
AGTGCTTTGATAGGGATTGCATTAAATTTGGAAATTGCTTTGGGTAATATGGACATTTTA
ACAATGTTGATTCTTCCTGGCCATGAGCATGATATGTTTTTCCATTTGTTCACATTTTCA
GCTATTTCTTTTCTCAGAGTTTCACAATTGTCTTTATAGAGATCTTTCACGTCCTTTGTT
AGGTATCCCGAATATTTCATCTTCTTTGGCACAACTGTAAAGGGAATAGAGTCCTTGACT
TTTTTCAGCTTGACTTTTATTGGTATATATAAAAGCTACTGATTTGTGAGTATTGATTTT
GTATCCTGAGACTACTGTATTCCTTGATCACTTCTAAGAGTTTTGTGGTTGAGTCTCTGG
GGTTTTCCAGGTATAAAATCATATCATCTGTGAAGAGTGAAAGTTTGATCTCTTCTGACC
CTATTTGTATACCCTTGATTGCCTTCTCTTGCCTGATTGTGATGGCTAAGACTTCCATTA
CAATGTTAAAAAGCAGTGGAGACAATGAGCAACCTGCCTGGTTTCTGATCTGAGTGAAAA
TGTTTTCAATTTAACTCCATTCCATATAATATTGGCTGTGGGTTTAATGTAGATGTAAAG
AAAAGTTCCTTCTATACCTATTTTCTTAAGTATTTTGATCCTGAAAGGATGCTGGATATT
GTCAAAAGCTTTTTCTGGATCTATTGAGAGAATCATATGGTCTTTGTTTTTTAGTTTGTT
TATGTGATGTGTTATATTTATAGATTTATGTATATTGAACTGACCTTGAGACCCTGGGAT
AAAACCCACTTGATCATGGTGTATAATTTGTTTGATGTGTTGCTGGATTCTGTTTGCTAG
GATCTTGTTGAATATTTTTGCATCAATACTCATTAATGATATTGGTCTATAGTTTTCTTT
TCTTGTTGGGTCTTTTCCTGGTTTGGGGATCAGGGTGATATTTGCTTCATAGAATGTGTT
GGGAAGTATTCCTTCTTTTTCTATGTTTTGGAAAAGGTTGAGTAACATAGGTACTAATTT
CTCTTTAAAGATTTGGTAGAATTCTGATGTGAAGCCATCTGGCCACAGACTCTTCTTTTT
TGGGAGATTTTGTATAATCGATTCTATTTCAGTACTTGATATAGGTCTGTTCAGCATTTT
CAGTTCTTTCTGAGTAAGTCTAGGAAGTTGGTGTGCTTCCAGGTAGTGGTCAATTTCTTT
CAGATTTTCATATTTCTGAGAATAAAGTTTTTTGTAGTACTCATTAAGGATTTTTTTAAT
TTGTGAGGTGTCTGTTATTTCGCCTTTGTGATTTCTGATTGATGATACTATGGACTTTAA
TTTTTTATTTTTGGTTAGTTTGACCAAAAGTTTATCAATTTTGTCGAGTTTTTCAAAAAA
CCAACTTTTTGATTCATTGATCTTTTGAATAATTCTTTTGTTTTTAATTTCATTTAATTT
TGCTCTAATTTTAGTTATGTATTTTCTTCTGCTGGGTTTGGGGTTGGAATGTTCTTTTTC
CAGTTGCTTAAGATGTCCCATTAAGTTATTGACTTCCTGTCTTTTCCATTTTCTTGAGGA
AGGCTTGCAATAAATTTCTCTCTTAGGACTGCCTTTATAATATGCCACAGGTTCTGATAA
TCCATGTCTTCATTATTGTTTTGTTCCAAAAAATTGGCATTTCCTTCTTTATCTCATCTA
TGACCCAGCTGTCATTCAGCGTAAGGTTATTTAGTTTCCATGTCTTTGTATGACTATGCA
GATACCTGTTACTGGTGAGTTCAACTTTTATTGTGTGATGATCTGAGAAAATACAAGGAA
TAATTTCTATACTTTTATTGCTGAGGTTAGACCGTGACCCAAGATGTGATCAATTTTGGA
GGATGTTCCATGGGCTGATGAGAAGAATGTGTATTCAGTTTTGTTAGGATGAAATGTTCT
GTAGATGTCTATGAAATTCAATTGTTGGATGGTGAAGTTTAAGTCCAAAGTTTCTTTGCT
GAGTTCCTTATTGGAGGATCTATCCAACACTGCCAAAGGGGCATTAACATTTCCAACTAT
TATGGTGCTAGAAGATATTAAATTGCTCATGTCTGTCAGAGTCTCCCTTATAAATTAAGG
AACATTTTGGTTAGGCACATAAATGTTAATAATTGATACCTTATCATGTTGAGTGTTTCC
CTTAACAAATATGAAGTGACCATCCTTGTCTTTCCTTACTTTTGTTGGTTTAAAGCCTAG
TGTGTCTGCAAATAAAATTGCCACCCCTGCTTTTTTCTGATTTCCGTTTGTCTGGATTAA
AGATGCCCATCCCTTCACCCTGAATCTATATTTATCCTTTAAGGTAAGATGAGATTCTTG
TATGCAGCAGATATCTGGCCTGAGTTTTTGTATCCAGTCAGCCAACCTGTGCCTCTTAAC
AGGACAGTTTAAGCCGTTCACATTAATTGAGAATATTGATAAGCCTGGTAGTATTTTGGA
TGTCAAGTTTTTCAAAAGTCCAGTGGAAATTTTAAATCTTTTCACCACTGTGGAAATTGG
GTTTTGGTCAAGAATTTCAGAGTGAGTTTACTTTGGTGGAAGAGCATTGTGCTGGTCGTT
ATGGAGGATGGGTCTGAGGATATCCTGAAGAGCTGGTTTGGTTATGGCACATTTCTTCAA
TGTGTGTATGTCATTAAAGTATTTAACTTCTCCATTATAAATGAAGCTCAATTTAGCTGG
ATACAGGATCCTGGGCTGAAAGTTGTTTTGTTTGGGGAGACTGAGGGTCAGTGACCATCC
TCTTCTGGCTTGAAGGCTCAAGTGGCCAAGGCGCCAGCTACATATACCTGAGCTGGCAGG
TTCGAATCCAGCTGGGGTCCACCAAACAACAATGACGGCTGCAACCAAAAAAAAAAAAAA
AAAAAAATAGCTGGGTGTTGTGGTGGGCGCCTGTAATCCCAGCTACATGGGAAGTGGAGG
CAGGAGAATCGCTGTGAGCCTTGACGCCATGACACTACCCAGGGTGACAGCTTGAGGCTC
TGTCTCAAAAAAAAAAAAAAAAAATCTGCAGTCATTCTAATCTTCTTCCCCTGTACGTTA
TGATTTTCTTACATCTGGCTATTTGCAGGATTTTCTCATTCATATTAACTTTGGTGAAGT
TAATTAAAATGTGTCTAGAAGATGCTTTATTTGGGTTGAGTCATGCTGGGGTTCTAAAAC
TGTTTACTCTCTGAATTTCAGTATCTTGCCATGCTTGGGAAGTTCTTAATTATCTCTTGG
TGTAGCGTATCTGTGCCTTTTGGACCATCCTCTTCTCCTTCAGGGATTCCTATGAGGCGA
ATGTTTGCTCTTTTGGAGTGGTCCCACAGTTTTCTCAGGGAACGATCCATTTTTGGTGTC
TACTTCTCTTCTTCTTTGAGCATTTGGGAGCATTCAAAAGCTTTATCTTCAATGTCAGAG
ATCCTTTCTTCTGCCTGCTCCATTCTGTTACTGAGGGATTCTACTGTATTTCTCAGATCC
TTGAGGGCCACAAGTTATTGCCTCAAAGTGTCAAAATCTTTGGTGAATTTATCTTTGAAT
TCATTGAATTCTTGAGACAACTTTTGAATTGCTCCTTGAATTTCTAATTCCATCTTTACC
TCCATTCTGTTAGTCTTATTTGCAATCCAAATTCTGAATTTGATTTCTGACAACTCAGCC
ATTTGTTTATGAATGGCATCTTCTGTTGTGTCTCCTTTGTCATTCCTTGGTGGAGTTGTT
CTACTCTGATTATTCATGTTGCCAGAGTTTTTCTGCTGATTCCACCCCATGATTATTTTT
CACTGTTTGTCTAGAGAAGCTGGCAAGGTGAAAATTGAATTGAGGGTTCCCGGAGTTGTA
ATTAACCAGCCCTTTACCAAGGAACTGGGATTGGTGATTGCCACTTTACCCTTAGAGCTT
TACAAAGGTCCCCTTCAGAACTACAGCCTGAAACTCTGGGCACCTGTTTGGTGTGGTGGG
GCTAGATGGGGCTGACCAAGAATAGTGGGGCTAGTCTCTGTCTAGTGTAGTGAATCAGTG
GCTTTGGGCTGAAATCTCAGCTGTTAAGATATATAAGCAACTAAGATACCCCTACCCACC
ACAAGTAACAGCTGGAAGGGGAGAATTCCACACTCCCATGACAACACAACCAGGGTCCAA
CCTTGGTTGGTCCCCAGGTGTTTGGCTCAGGTTAAGAGTTCTAAACCAATTGTACCAGTT
GACACAAACATTGATCAGGTGAGAGAGTTCAAAAAGTCTTCAGCATCTAGGCAGCGGGCA
TCCACTGGCAGCTCAGTTTGACCACAGTGGGAGGGCCCATGGAGCTGCCACCACTGTCGG
GGGTGGTGCTGCTGGTCTGGGGTATTGCTGTGTAGAGTCCACGGGGAACTGGAGAGCCTT
GCCACTGGTTGCAAGAGTCACAGGAACTGGGTGGGGAACCAGAGGGCAGAGCTGCTGATC
CCTGGCCCAGGCCGCAGGAGCCTTATTGGAAGCTGGAGGATGGATTTGCCAGCCTCTGGG
GGCTTCTGGGGTTGCAGGAGCCAGGCCAGAGTTGCCAGCCACAGGCTGTGGGTCTCAGGA
ACCTGGCAGAGAGCTGAATGAAGCACAGAGTCCCTGGCCCTGGGGCTGTGGGTCACTGGA
GCTGGGGGTCGGAGCCTCTACAACCCAGGTCGCAGGGGCTGGGCAGAAGTTGCTGGCTGC
GAGCCACTGGTGGCCATGGGTTGCAGAAGCTGGGTGGGAGTCGGCCGTGCACAGGTTGCA
GAAGCTGGGCAGGAGTTGTGGCCAGTAGGCCACGGGTCTCAGGAGCTGGAGGGCAGAATT
ATTGGCCACAGCCACATGGGTCACAGGAGCCCGGGGAGTCACCAGAGATGTGCCACATGG
GTCACAGGAACCCAGCGGGAGTGGCTGGGGCTGCAGTTCACAGGAACCCGGTGGGGAGCT
GAGCCAGCTCAGCTGAGGAGCCGGTGGCCAAGACAGGGCAAGTCTCTCTCCTCTGTGACT
CCCCACCTCTATTAAAGTTAAGTTTCAGACCAACCGTCCCACAGCTCATGAGGTGCCCCG
CCCTAGCAAAAATCTGCTCTGGATTTTGTAGGGGGTAGTCTTCCAGACTGCCAGAAGAGG
GGGGAGGGGTAGACTGGAAGTTCAGGAAGGTAGGGAGAATATTAGATCAACTTTTGGCCC
AGGCAAAAGACTGCCTGGGCTTGTCGAGGTATCTCTCCTTGGAGGGAGTCCTGCCCTCAG
TCTCAGTCGTTCTCTTCCCTTTGGTGAAACAAAAGGTCCTCTCTGTTCTCTCCTAGCTTC
AAGCTGCTCTCCTGGGGGTGAGGGGGAGGGGAAGGATTCCTGTCCTCTTTGGGGATGGGT
TTTGTACCTGAAATTTATTTCCTTGGAGTCCCAGCTTGCTGCAGCTGGGGTGATGGGAAC
CTGTTGATCCTCTCTCTAAGCTCAGCTCCTGATCTTCTGCTTTATTGGGTTATTTTAGAC
ATTATTTCTCCTTCTGGACGTGAGCCTCTGCTGAAAGCTGGCATTAGTCGGCCATCTTGC
CTTCATTTGTCCCCTTGGCTATTTTATAGAGACAGGGTCTCACTCTGGCTCAGGCTGGTC
TTGAACCTGCTACCCACCTTGGCCTCCCAAGTGCTGAGATTACAGGTGTGAGCCACCATG
CCTGGCATGTAAAAAATATTTTTTAAAAAATGCTTTAATAGTGGCAAAATATACATAACT
TAAAATATACCGTCTTAACCATTTTTAAGTATGCAGTTCAGTAGTGTTAGTTCATAGTAC
TGTGCAACCAACCTCCAGAACTCTGTATTTTGCAGAAGTGATAACTATTAAGCAATAGCT
ACTCATTCCTTAATATATTTTTGTTTGTTTTGTTGATTTGTGCCTTTGACTGTAACCTTT
TGCTTTCTTATTTCTTAAATCATGGTTTTTCTTGAAGGTCTACCATAAATCCCACATTTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGCTTTTTTTTTTTCTTTTTTGAGACAGTGTCTCACTTTGTCATCTCGGTGGA
GTGTCGTGGTATCATAGCTCACAGCCACCTCAAACTCTTGAGCTTATCCTCCCAAATAGT
TGGGACTATAAGCACCTGCCACAGTGCTTGGCTATTTTTTTCTATTTTGAGTATACACTG
GAGTCTTACTCTTGCTTAGGCTGGTCTGGAACTCCTGGGCTCAAGTAGTCCACCTACTTC
AGCCTCCCAGAATGCTAGGATTATAGGCATGAGCCACCTTGCATGGCCAAAGATGGCTTT
TTTGAAGATGGCTTGGTAACCTACATTGAACTGAGATTAGTTGCCAGATTGGAAGGCCTT
TTGATGAAATAAAATATAAAATTTTAAATCATCTTACATAATAGTGTCTTTTGTGAGATT
TTTTTCTACTTCTTTCATCTATAGTTTATAAAAATTTTATCTGTAAAACATACTAATTTT
AACATCATTTTCTGTTGATTAGGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGA
AAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGCTGTTAAGAAAATACTGTAT
GGGTGATCGTCCTGTCCAGTTTGAAATTATCAGCGATCAGTCAGTTAACTTTGGTTTTAG
TAAGTAAGTATATTTATGTCCTTGAGTGAATGATTACTTGTGTATGATACTTTCTATGGA
AGATACACAAACAGATAAACTTGTATAGGTATAAGATCGTTTTAAAAGATGTACTAGAAA
TTGCTAACATTCTTGCCTCTGAAAGGAAGAGCTGGAGGCTGGAGCTTGCAGGCCACTGAG
TTGCACAGGTAGTAATGATAGAACTGAACAGTTTTAATCTAGGTCTTTTGGATTCTGAAG
TACATGGGTTTTCTTTCCCTCTTCTACAAATAAAAACCTTACACAGAGGTTTTCATAATT
TTGAAGGCCTGTTAATCATTACTTTTCATTAATCAGGCATGCCACTCTTACATGCTATTC
AGAAGCACCACTAATTGTTATTTCAAACTTTAATTGAGATGTATTGGTGCTTATGTTTTT
TTTTTTAAAGCTCTGAACTAGTGGTCATTCGCCGATGTAGATCATATAGTTTGCCTATGA
TTACATCACTATTTTGGAGGAGAATCCTAGGGAAAATAGCTTTTAGAAACCTTAATTAAC
TTTTTTTTTTTTTAAGGTTTCCATGGGTGAACTACCAAGATGGCAATTTCAACATTTCAA
TTCCAGTGTTTAGTATTCACGGCAATCATGATGATCCCACAGGGGTAATTATTATTTTCT
TATAGTTCAAATTTTAGAAACATTCACTTTAGTTTATCTGTGGAAAATATTCCTCCCCCT
TTTCTTAGCAATTTGTAGTCAGTGACTTTTTTTTTTTAAATTGTTCCCTTTTTCTTTTTT
TTAATTTTATTAAATCACAGCTGTGTACATTAATGCAATCATCAGTGACTTTTTAATCAT
TTTATGTAAGCTTTTATTTAAAAATCTGGAATAAGAATTTGTGTAAGAGGTATGTTTTTA
TTTTATGAGTGCTAAGCGTGGGAATACATACCTAACATTTATTTTTAAATTGCTTTATAG
TTTATTGTTGCTTTATATCTGTCTTGTAAAATCTCACAGAAGATGATTGTTTCATGAACA
TTTAAAAATCTAAATTAATTTATCTAATACATATTTGATGTGGCAATAAAGATTAGAGAC
CTTAAACTCAAAAATATCTTTACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACG
CTCTGGCGTCACAGCTCACAGCAACCTCCAGCTCTTGTGCTTAAGTGATTCTCTTGCCTC
AGTCTCCCAAGTAGCTGGGACTGCAGGTGCCCGCCACAACCATGGGGCGGTTCGAACCCG
TCACCCTAGGTATATGGGGCCAGCTGTGCTGCCCAGCAAATATGTCTTAAACAGGAAACC
AAAAACACTAACTTTAAAGACAAGCAATAAACTAGAGGTCATTACAATTAAGATACTCTG
TTAATTTAAATCATCACTGAGAGTATGAAAAGTCAAGCAACAGACTGTAAGAACATTTGG
GCGATCTATGTTTTAAAACAATGACTACTATTGGTTGGGCACAGGGGCCCACGACTGTAA
TCCCACCACTCGGGGAGAGCGAGGCAGGCGGATCGCTACTGCTCAGGAGTTCCAGACTAG
CCTGAGCAAGAGTGAGACCTTGTCTCTACAAAAATAGAGAAACTAGGTGGGTGTTTTGGT
GGGCTCCTGTAGTCCCAGCTACTCGGAAGGCTGTAGCAAGAGAATGGCTTGAGCCCAAGA
GTTTGAGCTTGCTGTGAGCCACGCATTCTACTCAGGGCAATGGCGTGAGTCTCTGTCTCA
AAAACAAAACAAAAAACAAGCAAACTCCTACAAATCAATAGAGCAGAAAGAGCACATAGT
TGGATAAGAAAATGGAGAAAGATGAACAAGCATTTCATAAAAGAGGAGATCTAAATAGCC
TTTCAGCAGGTAAAAATTGCTCCCATCATTAGTCATTAGAATAATGCAGGTTAAAACTAC
TGTTTAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGGAAGGCCATTTCTGCCTGAATGCTGGG
GGAAGGAACCACTCAATGCTTATTTTTTGAGTACCTACATGTAATATGTCCTTTACCTAT
ATTATCTCGTTTATTCCTTACCTCACTGCAACAAGATAGACATTACCCCCGTTTTACATA
TGAAAAAACTGAAGTTATTTGCCCAAAGTCACACTTAGGTGGCACTTAAGATGTGAACCC
AGAATTGTCTGACTTAAAGTTTGATGATCCTTATCACCATCCTTCTGTGTCTCTAGAGAA
TGATCAGGTGTCTACACCTGTCCTGTTGGATGGAATAGCCAACTAGTATAGTTGTGGCTA
TTGAGAACTTGAAAGGTAGCTAGTCTGAGGTAAGCTGTGCTCTAAAATACACTATATTTT
GAAGATTTACTACAGACAAAGAATGTAAAATATTTCTATTTTTGTTTAATTTATTTTTAT
TTTTTGACAGAGTCTTACTTTGTTGCCTGGTAGAATGCCTTTGCTATCATACCTCACCGC
AACCTGAAACCTGAAACTCTTTGGCTCAAGTGATCCTTTTGCCTCTACCTCCTGATTAGT
TGGGGCTACAGGCGCCTGCTACGACTGCTAGTTTTTAGAGATGGGTCTCGCTCTTGCTCA
GGCTGGTCTCAAACTTGTAAGCTCAAGCAATCCGCCCACCTGGGCTTCCTCGAGTGTTAT
GTATTACAGGCTGAAGCCAATGTGCCTGGCCTCAATAATTTTTTAATATATAGAGGGTGT
CAAAAATGGATACACATTTTAAGAAACAAACTGTATCAAATTTGTAATACTCAAGTCATT
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAAGTCCTTTTTGATCTCTTGAAAGTCTTTGAATGGTCTAAAG
CTTCATGGTCCAACACAGTAACCACTAGCTGACAGCCCTTGTGCAGCTCTCATAATCTAG
CAAGCAGAAAATCATGGTCATTTATATTTTAGATATGGAAAATGAGATCTGGGCATTATG
TCTGATTTTGCAATTGATAGAGCATGAAATGAAATATACATTAAAAAAAACTATTAACAA
TTGTTTTAATCACTTCAACATTAGGGAACAAATCTCCTGAAAAAGGTTTCTTCTCCTGTA
TTCAGACTAAAGACATTATTTCTCAATCATTGCCAGAAACACATCTCTGTAGTCATCCAT
TCTCCCCAGTCTCTTTATTGGTCCTGTTCTTCTTTCCATAAGTGGACTCTGTCTCCTCCC
TGTACCCTTACCACAACACTTCCCTATAAACTCTAGAACTCGTATAAGTGGCAGAGTCCT
GAGTGTCGCCATTCTCTTCTCTGAATGTTGCCCAGGTGGACTCTGAGCTTCTGTGTTCTG
TGTGGTTCTCTCACCCATGTTTTGTGGGCAGAGGAGGAGATTACTGTTCTTGCTCACACA
CACCACGTTCCTTCCTGCCTGAAGATACTCTGCTCTCATGAAGCTCACTCTGCTGGGCTA
AACTTGTCTTTCTCTTTCCCTCAAACTTTTTACCTACCCACCTACCTTTAATTTTGTGAG
TTTCTCGGTGCTTCAGCCCCTACCTAGATTAACTTCCTAATGTCCTGGACTTTGAATACC
TGCACTTTTTTGTCTCAGTTATATGTTCTGCATTCTACCTCAGCCGGCTATGCCATGGGC
CATGCCAAGGAACTCCCTTGGGGAGCTGGGCCACTTCTAGTTCCTGTGCTTCTGCATGGT
TAGCTTTTCTTCTGAAACCTCTTTAATCAGTGTTTGAAGTGTCAACCTTGTTCCTCCCAA
CCCTGCCTGTGTTGTTATTCTCCGTCTTAAGGTCCTGGCTTCCCCCCTTTTATAGTATTT
ACAGTTTATAGTTATTTTCTTGACTTGTTTTTGTTGATCTTTTTCACTAAACCAAGCTGA
GCCTATGGAGTACTAGAAGAATTGTTTTATTAAAAAGCATAATACTTTTATTTTTGTGCT
TTTACAATATGAATAAGAATGTTGTGTTTTTAAATACTTTTTAAAAATCTCATCCCTTTC
AATATCTAGTTCTATGCATGTTATAATGTATATGTTACTTCAAAAGTATATATACTTATA
ATTTATAATAAAGGGATAATGAAAAACATTACTAGAAGTTTAAATAAGAATTTAAGCATA
GCCCTCTCACATTTTTATTCCACATTTTGTTTATTTTAAGGTATATGTGCCTGAAATGGA
AAGTATTTTTTGAATGTACCTAGTAGCTGTCTGTCATCAAAAACTGGAGCTACTCATTAA
TAAATGATTCCAGAATTCAAATATATCTCTAAACAGTAAAATGAAATACTTTGAGTAGCA
CATTATTTAGAAGCAAATACATTCATTTTTTTAAACTCAAGTAAGAAAATAATTTTAAAA
TAATGATATGTCCATTTCAGGCTCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAA
TAAAAAAGTAACAATGTTGAGACCAAAAGAAGAGGAGAACTCTTGGTTTAACTTATTTGT
GATTCATCAGAACAGGTAAAAGTATTCTCTGAAAAATTTTGATCCAAGTACTGAGATTCC
CTGAATCTCTGGAAGCTCCTTCAGTAAAATGGCCTTACTCTTTCAAGGTTGTAGTGCAGG
ATCAGGCAGAACTTGGCTTTGTGTGACTTCATTTTGAAATTTTTCTTTGTATAAATTAAT
ACCTGTAAAAGAATATATGTAGCTTGTGGATAAGCCATAATAATAACCATAAAATCAATA
TTCCTGAATTCAGCAAAAATGTAGAATCTTATCAATACATTATCTTATCTTCCTTCTGTT
GTTTTTAATTTTAGATTAATCATACCATTGCTTTTCTTTATTATTTGATCACAAATACAT
CCATAATTGTGTTATGCTGTATATTTTACAGTTATTTTATTTCTCAGCATTTCTGAGATT
CATTCACCTTGCTGCTTAGAAATGTAATTAATTTTTACTGTTGTGTACAGTTAATGAACA
TTTCATTTCTGATTTTCTTGTTTTTATAAACCTGGCTGTTACAAACATTCTTATGCACAT
CTCCTGGTAAATATATGCAAGTGTTTTTCCGGAATATGTAAATATAGCTAGATTAGCTTT
CTTCTGTTAGTTTTAAGAAGTCTAATCTGTCATTAGAGTATAGGATGGATTGAAAGGAAG
AGAAACTTGAGAAAGCAAGATTTCCTATGTGAGCACTACAGTGAAAATGAGCTTGTGAAG
GTGATGGCAGATTATATGATTTATTACAGTCATCCCTCTGTAGTCAAAGTGGGGGATGGT
TTACAGGATGCCCCGTGGATTTAAAAATCCTCAGATGCTTGCATAGAATGGAGTAGTATA
ATAGAACTCTGTAAAGTGACCACCCAAGGGACTGCAACAAACTGCTCAATGTATGGAAGT
GGTCAACGTAAGGAACTAGGCCTACTGTACCCCTGTGTACATGTGGTGCATATCCAGTCT
TTGAAAATTAGGTCAACTTAAGGAGATGGGCAGTGTAGGGATGTGGTCAAATATGGAAGT
TCTACTGTAATTGCATATAATCTATACTCACCCTCCTATATACTTTAAATCTAGAGTACT
TATGATACAACATATGCTATGTAAATTCTTGTCATACTGTATTGCTTTTTAAAATTTGTA
TTTTTTATTGTACTCTTACTTTTTGGTTTTTAAATATCTTTGATGCATGATTGGTTGAAT
CTGAGAAATGGTAAATACAGAGGGCCAGCTATATTTATTGAACACATTTACTAGATGCAG
ACTGTGCATTTATTGAATACAAATTTATGCTAAGTGTTGGGTAAAAGAAAGGATTAGGAG
TCTGACTTTGTTTTCTTGTGTGTGAGTTCTTGAATGAACATTGTGAGTTTCAAAGAAGGA
GCAGGCCAGAGTTTTGATGTGTGTGGTCTCCACGTAACTTTTCACCACTAGGAGTTGTTC
TTTCTCTTGCTTAGTGCTTCCCAGTTCTACCACACTTTGTACTATGCTAAAGTAGCGATA
AGTTGGAAGGAAAACCCATAAGGAATTCTGGGAATTTAAGCCAGGATGAAAGGTAGAATG
GCAGCATTGGTACGAGGAAAGGGTAGTCAGCGTAGTTTGTTGATTCATCTCATTGCTGGT
GATGTTAGCCTTGATCATTTGATTATGGGGGTGCATACCTGATTTCATCAATGTAAATTT
CCCATTTTCTATTTCACAATTAATAAATATTTTGAGAAAAATACTTTGAGACTATCCAAA
TATCCTGTTTCACTTTAAACTTTCACCCAAGATCTATCCATTGGTGATCTTATCTCCACT
ACTATTGTAGTGCTGTAATAGCGATTTTTTTAAATTTCCCTCATTCTTTCTGTATTTATT
TATTTTTGAGACAGAGTCTCAGTATGTTGCTTTTGGTCGAGTGCTGTATTGTCACAGCTC
ACAGCAACCTCAAACTCTTGGGCTCAAGCAATTCTCTTGCCTCAGCCTCCTAAGTAGCTG
GGACTACAGGCACCTGCCACAACACCTGGCTATTTTTTGTTGCAATTGTCATTGTTGGTT
AGCTGGCCGGGGTCAGGGTTCTAACTTGCCAACTTCAGTGTATGTGGCTGGCACTGTAAC
CACTGTGCTATGGGCACTGAGCCTCTTTCTGTATTTATTAATTGGAATTCTTTTGTAAAG
AACTTCTGTCTCTTCTGCTTCCCCATTTATTTACTTATTCAGTTATTCATTTTATTTATA
TTATTATGGATTTAAGGATCTTTTATTTTATTCTTTGAGATATAATACAATACTGTCATT
TTTTTTTAATCCTTACTGTTCCTTGGAATGTTTCCACTTTGATCATAACAGCACCACAAG
ATGTTCCAGGCTCTTGTATTTTTCTGCCCTAGACCGGGAATCAACCACTTCTCTAGGGAG
TTTCTAGCTCCTTTAATTGTGGTGTTCAGAAACCCATATATGGGTACTGAGTGTCTTATT
GCTACTGGGCTCTCTTAACACCCCCCCCCCCCCACTGAATAAAGCTAACAAATATCCAGC
TAAGTATATATAAACCCTCCCAGGGAATAAAGCTAAGTAAATATACAATTATGTATAGTA
ACCCATACATATACATCCACATCTGTATTTCTGTATCTAACTGTGTGTTAAAGAAATAAT
TGCAAATTCATCTTCTAATCCAGCCCCACAGGGTCTCTCTGTGTCTTCCCCCTTTCTTTA
CTTATGACTTCTTTTGCTAACTGAAACCTAGATTACATTATCTCCAATATATTGACTTAT
TTTTTTTCAGTGCAGGTTTACATATAAAGTAATTTCAAAATTGCTAACCCATACCCCCAT
CAGAAACAAATCTGCCAAATTGGGTACAGTGTTTATGTAAGTTATTTTAGTCTTTAGCCT
TGGTATATCTAGTCAAAATACCATTTTCCAAAGTTACTTAGCTCTTTCCTCCCCAGTCCC
TGCATTGTGGTTGTGGGATTCTTCTTTAATGCCCTTAGATTTGTCTGTTACCTTGTGCAG
CTTTAGATACTTCTTTTCTTGTTGTTTTAAAAACAGAAGGTTTTTTCTGATTGGGTGGGA
ATTCTTGAGTCTTCTGTGTTTTATTCCTCTCTCTCTCTTCTTTTTTTTTTTTTTACATCA
TTGGGTTTTTCTCCTGTGTGCAAAAGAAGGAAGAATCTGAAGAGGACTTTGTTATGCAAA
ATCTTTCAACAAGGATGTTTTGATTAGCTTCTAAGTCACAAATTAGAGCCAGCACTCAGC
GAAGGCAGGCGGAATGGCATCATGTTATATTTGAGAGTTTCTTTATTGTGATAATCTCAT
TCCCTAGTTGTGTGTTTTTACATTAAAAAAATTTTCTGGCCACTCATTTGATTTTCTGTC
TTCTCTGCATTCGTTCTGCGTAGCCACACTGATCTTGCTAGTCTTGAACTTACTGAACAC
TTTCTTGCTTTAGCACTTTTGCTCTCTGCTCTTCTCCTGCCCAGGACTTTCTTCTCTTGC
TAACCGATCCTTCCTTTCAGTTCTCTGCTCCTTGGTACTTGTCAGAGAGGCCTTTCCTGG
CTACCCCATATATATGGAGGGTAATATGTCCCTCATGTAACTTTTTATTTTTCTTTATGG
TACCCATCACTGCCTGACAGGTCACATACACACCCACTCATACACACATGCACACATGTA
TTTTGTATTATAGATTGAGTATCCCTTATCCAAAATGCTTGGGACCAGGAATGTTTCAGA
TTTGGGAATTTTTTGGATTTTGGGTATTTGCATATGTATAATGATATCTTGGGGTGAGAC
TCATACCTAAACATAAAATTTGTTTATATTTCATGTGTACCTTATACTTATAACCAGAAG
GTTGTTTTATATAAGATTTTAAATAATTTTGTTCATGAAACAAAGTTTGTGTTAAGTACT
TATGTGGAATTTTCTACTTACGTCTCAAAAAGTTTTGTATTTTAAATTTTGGGATTAGGG
ATGCTCAACATATATTGTTTATATCCTATGCTACAACAAAGACTTGGTGTCTTCAATCTT
GAAGAAGCCTAGCATTTCTAGCATAAAGTTGAGAGTAAGTATTTGTTGGGCAAATGAAAG
ACTATTAATTTGGATTAAGTGAATGTTAAGTTGAAGTACTTGAACACTTTAACTTAAATC
TCTGATGATAAGTTAACGTTAAGGGAAACTTTTTCTTCTTGTCTTCACTTGAGATTTCAT
GTATCTTTTTAAAAATTTTTTGTTTCTAAAGAATATTCTTTTTTTTTTTTTAAATTTCAG
ATTGATAGGAGGGTACAAATGTTTAGCTACATGGTTTTCATTCTAAGTACAGTCAAATTA
TAGTGAGCCGTCACCCAGGGGTGCACTGACACCCCCACACCGTGCACATGAGCAGGGTCT
CACCAGTCACCTCCACCTCCCCGCTCCCTTCTACTCTCCCCTCACTAGAGGACACTTGTG
TGTTTTTCTTTCTTGGATTTCACATATCCTTAAATAACTGGTCTAGGTATAACACTAGAG
TTTACAAATCATTTTATTTATTTTTTATTTCAGGTTAACATGAGAGTACCAACAACTAGG
TTACAATGGATGCATTTGTTAGGTAGAGTCCCTCTTGCAAATCATTTATGTGATAATTTA
TATTAAAACTCTTATCTCATATGTAAGATTAACAGTTTCACTCCCATTTTTATAATTAGT
AAAAGATGACATTAAAAATTATTGGACATTTGTACTCAACTCATTTTCGTTTTCTGTATT
TTTTCAGTATATAATTATACTGATTTATAGATTTCAGCTATTGACAAAGCTTATGCTTTT
CTGATATGGCCAAGGGGGATTCCTACCTGTGTAAAACCTTTGATGATCTTCCCCTAAATG
TAGAATCGACTGCTTCCTTTTTTTAGGGTTTCCACTTGTTTGTATTCTGAAGTTTGTAAA
CCTCTTGAGGTCTATTAATTATCTTTCCATTTCCAATCTCTCGCACAGTTTCTGGCACAT
AGAATGAGGTAATAAATCTTTAGTAAATGGAGGAAAAGTCCTATATAGGTGTATTTAATA
TGAAAGTTTTCTAAATCGCTGTGAATTTACATTATTTATTTTTCAAAATCTTGGTATAGG
AGTAAACATGGAAGCACTAACTTTATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
GTTATCTGGGGCCATGAACATGAGTGCAAAATAGCTCCAACCAAAAATGAACAGCAGCTC
TTTTACATATCGCAGCCCGGAAGTTCTGTGGTTACTGCTCTTTCCCCAGGAGAAGCTATA
AAGAAGTGAGTAATGGTTATATATTTCAAGTCAATTTTTAAGGAATCCTTGCTATAATAA
AATTCTAATCATCTCCTAGGTTCAAAGTATAAGCAATATTGTTATTTATATGATAGATTT
ATTTATGAAGATTGATTATTCTATATAATCTTACTGTTTTCCAATATTTTTTAGCCATTT
TCAATAACAGGTCATCCAATTGGCATTAATGATTTTGTACTCATTAGGCATATTTAAAAC
TAACATTTTTATTTATTAAATTTAAGTTAGATGCTGTAAGTGGTGACTAATTTCACAAAG
TCCATTTATAAACAAATTCCCTTAAGACCATTTTAGATTTTTCTCACTACAAATGCAATT
TTATAGCATATTTCATTTCTTTTAATTCTTTGGGGAAATGATGTAGCAAAAAAGAATACT
TACCAGTGATTGAACTTAATTTTTATAATGGGTTTTGCCCATTGAATCTACTCAAGTTCT
GATTGTTATGATGATAATAGGTTTAAAGAGTATGGTCATAGAATGTCTGTGTGTTGGGGT
GTTTTTTCATGGTTCTGGTGTGAAATCATGTATGTGTGTATATATATAATAATATGTAAT
ATAGTCTATACATACTACTTTTGTAGTCTTTTTTTTTTTTCTTTTTGAGACAAAAATCTT
AGTAGCCCTGGGGTTGAGTGCTGGGGCATCATATCTCACAGCAACCTCAAACTCTGGGGC
TCAAGTGATCCTCTTGCCTCAGCCTCCTGAGTAGCTGGTCACCACAGCGCCACGTAACCC
TGCTAGTTTCTATTTAGTGAGATGGGTCTCATTTCTCAGGTCGTCCCAAACTCCTGCGCT
CAGGTGATTTACAGACATGAGCCCCTGGTCGTGGGCTGCTTTCCTAGTCTTGATAACATT
TTATTTTGCTTACTATTATGCCTGTCTTTCCATGTAACTGTATATTTGTTCAAGCAGAAA
AAATAATGGGTGAGTAGATTTTATTCTGGGGAAGGAGAATGTTTACCATTTTTTCCTTTG
ATGATAACGTTAGTATTAAATTGCCAAAAATATTTATTTTTAAGGATGTGATGTTATCAA
AAAATATTTTATAAAGTAAGAAAGTAAGAAGTAATATAGCTTTGATGTGCACATTTTCCT
GAGGAAATGTACGTTGTGACTAGATTTTTATTTCTCTCCATTTCAGACATGTTGGTTTGC
TGCGTATTAAAGGGAGGAAGATGAATATGCAGAAAATTCCTCTTCAGACAGTGCGGCAGT
TTTTCATGGAGGATGTTGTTCTGGCTAATCATCCGGACATTTTTAACCCAGATAATCCTA
AAGTAACCGAAGCCATACAAAACTTCTGTTTGGAGAAGGTAATATTTTTAAATAAATTCA
ATAAGACCTACTTTAGTTGAGGGAGTATTTCAGTCCTATGAACCACTTACTAGAGTGGAG
AGAGGTTCCCCTCTCTCCTAACAGTTGATGGTATATAGTCTATTGCTGGATGAAGGGCTC
TGCTTGAGATCCACTGAATCAACTTCACCTAAATCCTTTGTACTTTGAATGGTAACATGA
ATACAGAGAGGAAAGAAGATGATGGTGACACAAAAGTAATAGAGGTCCATTTGAAATACC
CAGATGTTTGACCTGGTACCTGGCAAAAATGTGCTCTGTTGACCACAACAAAATTTTTTT
TGTTGAGTTCAAAGAATTGACTTGGATGATTTTATTATAGATCTGTGCTATCCAGTATGA
TAATCATTAGAATGTGTGGCTGTTTACATGTAATTAATAAAAATTAAATCAAAAATTCAG
CTCCTTACTTGTTCCAGCCATATTTTAAGTCTTCTATATCCACATGTGGCTCATGGCAAC
TCTGTTGATATTGCAGATATAAAACATCATCATGGAAAGTCTGTTTGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTCTCAAACTCCTGACCTCAAGCCATGCACC
TGCCTCAGTCTTCCAGAATACTAGGATTACAGGTGTGAACCACCATTCCCACCCATCCTG
ATTTATTTGGTTTTTAGTTGGTAAGATGAAATAAGCCTTATTGAAATATGAGTAGAAAAT
TGGAACAGGAGTAATGTTTTAAATATCTTTTAAAAGAATTACTTTAGAGCAATGTTTTTC
AACCCTTTTAATCTCACAGCACACTTGAACCTATAGTTAAACTTTTGTGACACACTTAAA
TTTATGTTGATTAAAAATAGAGTAAAAAGAAAACTATACTTACTGTACTTTGAATTTATT
TTGAAAATAATTTGATTGATGATCTTTAAAAATTTTCACAGCACATCTAAAATCCTCTCA
CAGCACAGTAGTTGAAAATCACTGCTTTTGAGACTGAAAAAATTATTTTATTAATAATTT
CTCTGAAGAAAAACATTAAGGAATAGTATTAATGAAAGCATTAGAAGAAGGTATATTTCA
GGTGTTTAAATTACCGAGGAAATAAAGATTGTTATGCTGTTCAGAGAAATTCAAATGGTA
GGAATATAAACTTCTATTCGGCCAATTTAAATAAAATTTAGTACTTTGATATTAATCTTT
ATTTTTATTTTAAGATTAAGGTAATGCTTGAAAATGCTGAACGGGAACGTCTAGGAAATT
CTCGACAGCCAGAGAAGCCTCTTATACGACTGCGAGTAAGTCCTGTTTACATAAATTAAA
CTATTAATTTTCAAAGTATAGTAGTGTACTGGATTTTTGGAAAAGGAGTAAGAAGAGTCT
TTATAATAATAAAGAACAATCATCATTGGAGGCAAAAACAATAAAGCTGCAAGGATTTGA
CTTAATCATAATTTGTTAGATTTGATAATTTCTTCTTTTTCTCATTTTCTTTTTTTCTCA
TTGTTGTTCTGTTTAATAGATTACCAGCGAGCTCTGACTTCACCTTTAACTCTCCATCTC
TCACTCTGGCCTTCTTGGGGTCTCTGAGCATGTCTGACCCACTCACTGCCCTCAAGGCTG
CTCCCCTGTCACCTGACCACGGCCCCACCCTCATGAAGATTACACTCCCACACCTTCTCT
GCAGAGCTCCTCACTTGACTTTCTTTTCCTTCCTCTTTTCCTTTTCTCCCCCATAACACA
TAATACACTTGGTTATTCTTTGAATTTTTTTCTATGCCTATGAGCCTGCTTATCTTTTCC
ATTGTGATATAAACAAAGAAATAACCACAGGCCTCTTTACCTCTGTGCTTTTCTCTTCTA
GTTCCTACCCTGTCTTTCTTACTCTCTTCCAAGCCCCTAAACATATATAACCTGTCCTCT
TCATTTAACATTCTCTTCCCCAGGTCACTGTAGTCAAGGCTGGGACCTCCCATAGCAAGT
AGAAAAGGTGAACTTGAGTTGATTTTTTTTTTTTTCTCATCTTGCTGAATCACTCTTTGG
CACTCTCTGAGTTCTCTGTATCCCTTCCTAACTCTTAGCCTTTTTTTCAGTCTAGGTATA
TGCCTTTTACAACCACCTACAGAGTAATGATTCCTAAACTTTTACTTAGACTTCCATGTT
GATATATCTGTACATCTAGGGTTCCCCAACAACCTGGTACTCAAGGAGTATGGTCCTTAA
ACCAGCAGCATTGGCATCACCTGGGGAATTACTAAAAACAAAGACTCTCACGCCACACAT
CAAGTCCAACTGCATTTTAACAAAATTCTTGAGAAATGTGTATGCACATTAAAGTTTAGG
AAATCCTGGGATATAGATCGTGGAGGTAAAGGGGATAAACAGTTCAGTCTAGAGTGGGAC
TGCTGGGGTTTGATTCTGGCACTGCTACTAGGTATATGACATTGAGCAACTAGATCTCTT
GTCCCTTGGTTTGTACACCATAGATTTATGAGATCCAGATGAATTACGTTATGTACAATA
AGTGGTCTGGTCCCTTTTCTCTATCCCACTGTTACTGCTGTACTTGAGTCCTTATTATCA
CTTACTGGATTATTCCTGCAGCTTCCTGCCAGGGCTCTGCCTCTTGTCTTCCCATCATTA
GCTTTTTCTCCACCATAATGCCCAGGTGATCTTTGTACAATACCATCTGTGTGTCTTTCC
TGTTGGAAACAACTTAATGATCCCCTAGCACTGACAGGAAAAAGTCTAAACTTTTTAAAG
TAGTACTTGGAAGTCTATGATCTGGTCTAAATCAACCTCTTTGTTTTTATCCTCCCTTCT
CTGCAGGCACATCTCAAGCTCTAGTCTTGTCTGACCAAAAGTTAACAACTTCCTGGACCC
AGTAGCCTTTATTTCCCTGGAAACTTTGTGCCTGTTCATCCTGCTATGTGGAGCACAGTT
CCCTTTTCCTTGCTTACACTTTTAGTACCCACCTGGAGCTTCCCTCTTCAAGAACGACTT
TCTTGATCTGACCTCATTGGTGCCTCTTCCTCTGTGTCCTCATTCTATTTTGCACATACC
TCTTACAGCACCAGTCACATTTTTGTTTAATTTTTTTAACCCATATATCCAAGGCATGAA
CCAAGCCTGGGCACAGATGGAAAGCCAAGTTGGGACAAACAGGGGGTTGCTTTGTCTCTG
GCTGATAGGAGATGGGCATGACCAACCAGATGCCTATTCTTCCCAGGTTGAGGCAGGCAG
AATGCCTAGAACATTGAGTTTATTTAATGAATGGGTTTTATGACTCTTAGGAGCAGAAAA
TTACAAATAAAAAGCTAGGCTGGTATATTAATTGTTAAAATGTCTGAAGAGTTTTTGGGG
GAGTTTTAGGATTTAGTATTCTGTCTCTTAAAATATGACCACTATAGAGATGGTCTAGGT
ATGTAATAGAAAGTTACTTTAAGGAAATCATATAGTTGTCTTCATCAGAGCAAAAGATAC
CATTTTTCTCATCTATGTTTGCGGGCACCATTAGAACTAAGCAGATATAAATAGGAAATT
CTTATTCCTTTACCTAAACATAGTAAATCATTCATTCATTCATTCATGAAACAAAAGAGC
AGATATTGACATGTAAGTAATACTGCAAAGCTACAGTGTATTTACTAAAGGGGTCTCATT
AATTTATTAATATGTTGGCTCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCCACGTA
CACCTAAGGTGGCGGGTTCGAATCCCCAGCCCAGACCCGCCAAACAACAATGACGGCTGC
AGCCAAAAAATAGCCGGGCGTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGTGG
AGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGCCACGGC
ACTCTGCCCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAATTATATTAATA
TGTTGTACAAATCTTATGGAGTTCCTTCTGTTATGGATGCTGGAGGACACAGCAACACTA
AAACAGATGAGGTTTTGCATCTGTTGAGCTTACAAGAGGTAGAGATGTGAGGAGAGACAT
AATAGATACCAGGTAAATGAACAGAAAACGTAGCAGGTAGTGCTGTGTATGATGAAGAGC
GGAAATGTTGGTGCTAGTTGGGCTGGGGAGCATTCTGGATAAGCTGGTGGTGTGGGGCAT
GCTGGTTCCCGGATCTTACTTTGAGAATAGTTAGTTTAGGAAAAATGATCATATGTCTTA
GAAGGGAAGGTGGTGCTTCTCTTTGTAAGGTCTATTTACCATTATGGACTTTTTAGATAG
AGCCTGCCTTAAAAGAGATTGTTAGTCCCATCAAGATGCACATTTTGAAGATAATCATTC
TCTAAGCTCACAGATTGGAGGCTTTTCTACTTGGATTTTCCCAGCATCCATCTTTGTCTA
GTATGAAGGCACATCCCTAAGATGATAGAGCAATTAACTAATACATGTAGGGTTGTCATT
TCATGGTTTTTTTTTTTCTTTGAGACATAGTCTCACTACGTCCACCTCAGTAGAGTGCTA
TGGTGTCATAGCTCACAGCAACCTTAGACTCTTGGGCTCAAGCTATTTTCTTGCCCCAGC
CTCCCAAGTAGTTGGGACTGCAGGTGCCTGCCACAACACCTAGCCATTTTTTTGTTGTTG
TTGTTGTCATTGTTGTTTAGCTGGCCCGGGTTGGGTTCGAACCCACCAGCCTTGGTGCTG
TGTCTGGTGCCATAATAACTGTGCTATGGGTGCCAAGCCGGGTTGTTATTTTATTTTGAT
GTTCTTTGTTTTGTTGTCTTGAAAGTTAAGAAATATGTTTAGAAATTCTGCCTTCTTCCT
TTGATGAGGTGCCTGGTAGGTACCTAGATATTAATGTCATGGGGAGATGTAATCATTTCA
ACACTGGAAATTACTGTTTATCTTGATTCCATTGAACAAAGTATTTTGCTCACAAACTTT
CCAAGCATTCTTTTCTCAATAGGATAAATGTTATAACACCATCATGATCTTTTAAATGTA
TTGTAAAAATTTATAAATTTAATAGTATTGAGCATAAGCACTATAAATACTGAATAATGA
GTATGTTTCTTACAAGTTAGCAAGCTGTTAAACTTACCTTTCGTATGGTTACTCTGTATT
TCCAGGTGGACTACAGTGGAGGTTTTGAACCCTTCAGTGTTCTTCGCTTTAGCCAGCAAT
TTGTGGATCGGGTAGCTAATCCAAAGGACGTTATCCATTTTTTTAGGCGTAGAGAACAAA
AGGAAAATACAGGTAAGCTAGTTACTTTTACAGGTTACAAAATGCTCTTACAGGGTTTGT
GTAATTAATCTTTAGTAAAAAAATATAAGAATGATGAAAGGTGTTTAGATATGATTTTAA
TATCTTAGACAAATAAACTGACAGATAGAATAATTAAACCTCTCATTATCTAAAAATTAG
ATATCATTTTTATTTTTTTATTTTTAATTAGATACCATTTTAAATCTGTTGACACCAATA
AAGAAATGGATGGCTTTCTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGATCATGTAAAATATAG
AGGCTCTTTTCCTTAGTGCTGTGCGTCACAATTTTCATGGAACTCTACAGTCCTTATTTA
TAAGTAAGTGACCTAAGTTTTTATTAGCCTAAGTTTAATGGGCTTCTGTTTTCACTGTCA
AATTGTGATCAGAAATTGGGTATGTTGTGAATTCATTCTGAAACAATCTTTCATATATTT
AAGGGAAACTCATATAATACGGTTTTAGGGGGAAAAGATCCTTATCAGAGAATTGTATTT
TTATTTATTTTTTATTAAGTCATAGATCATGACATCATACACATAGATCATGAATATATT
CATGCATATGTGGGGTACAATGTGCTGATTTTTTTTTTAATATAATCTGTCATGGTTAGA
CCAAACCAATGAACATAGCTTTCACCTCATTTACTTGACTATTGTGCCAAAACATCTATG
TTCTACACTTGACAGATTTGACTTGTACCTTGTCATATGCTCCATAGGTGTGGTCCTGCC
TTTTACCCTCCCTCTGTAATACCCCTCCCTTCCCACTCCATTTCTCTCCTTTCATAAGAA
AGTGTGAGTAAATATAAGTAGGTTTCATCGAAGTACTGAGTACATTGGATACTTTTTCCT
CCATTCTTGAGACATTTTACTCAGGAGAATATGTGCCAGATCCCTCCATGTGAACATAAA
CGACGTAAAGGCTTCAGTCTTTTTAAAGGCTGCATAGTATTCCATGGTATACGTATACCA
CAATTTATTAATCCATTCATGGGTCACTGGGCACTTGGGCTTCTTCTATGACTTGGCTAT
TACGAATTGAGCTGCGATGAATAATCTGGTGCAAATATCTTTTTTTCAAAGTGATTTTTG
GTCTTTTGGATATACTCCTAGTAGAGGAATTGCAGGATCCAACAGCAGGTCAATTTTTAG
ATCCCTGAGTGTTCTCTGGACTTCTTTCCAAAGAGAACATATTAGCTTGTATTCCCACCA
ACAGTGCAGAAGTGTTCCCTTTTCTCCACATCCATGCCAACATCTGTAGTTTTGGGATTT
TGTTATGTGGGCTACTCTGACTGGAGTTAGATGGTATCTCAAAGTGGTTTTGATTTGCAT
TTCTCTGATTAAAGAAGACAAGCATTTTTTCATGTGGCTGTGTACCATGTGCCTCTCTTC
TTCAGAGAAGCATCTGTTCAGGTCTCCGGCCCATAGTGAAATGGGATCACTTGTTCTTTT
TTTGAGTTCTCTGTGGATTCTGGTTATCAGACCTTTGTCAGAAACATAACCTACAAATAC
CTTCTCTCATTCTGAGGGCTGTCTACTTGCTTTACTTACTGTGTTCTTGGCAGTGCAGAA
GCTTTTTAGTTTGATCAATCCCAGTAATGTATTTTTGGTATTGCGTCAGTTGCCCTGGGG
GTTCTCCTCATAAAGTTTTCTCCCAGACCAGTTTCTTCAAGTGTTTCTCCTGCACTCTGT
CCAAGAGTCTTTATGGTTTCATGTCTTAGGTTTAAGTCTTTAGTGAGAGTCAATTTTTGT
TAGAGGTGAAAGGTTGTGGGTCCAGTTTCAGTCTTCTACAAGTTGCCAGCCAATAGAGAA
TTGTATTTTTATATTATGAATTTTAAGGAGTTGCTTCTTGACAATGGTTTACTTTAATTG
CACATCTTTATCGGTTCCTTGAATGTTATGGGAGTAGCATTCATAAGAAAACAGACTATA
TAATTAGTACCTTACCTTTTTTGAGTTTCATTCATACTGAGTTTTGTTTAGTGAGTTGTT
TTAATTTGTTTAAAGCAAAATTGCTCATTGGAAACAATGGCACTTCTGTATGTATTATTG
AAAGTGTTTTGTATCTTGGCCAGCTTTGCCCCTTGGCAGCATGCATGACATTGTGCCAAT
TACTAAACTGCTGCAGTTTTTCATCTACAAAATCAGGATAATAACCGTGGTTGGCCTGAT
GGAATTATTGTGAGGATTAGATGATAGACTGTGGGTAACTGCTTTTAACTAGCGTCTGGC
GTGGTAAAATATAGCAATCGTGTTCATGAAGAAAGATCGTTGTTTACTTGTCGTCGCCAC
CTGGCAAAAGAAGCATGAAACTCTGTGCCTCTTTCCTTTCTAGGCTGTTGTATATACTTT
TTCTCTGCCTGAAATGTTTGTCTCCCTTTTTTGCTTGGTGAAACTTACTTGTTCTGAAGT
TTTTTTATTCAGGTGATAAACTGCCTTTGATACCTGCATATGATTTTCAGCCTTCTTTGA
GAAGAATAATTGCGTCCTTATCTACATGTCATGTTCTCTATGGCACTCACAACCTCGGAT
TGTAATAATTTATTCTTGAGGGTAGGGAATGTGTCTTTTTCATGTTTTTTTTTTTTTGTT
TGTTTGTTTGTTTGTTTTAAGAGACAGTAAGGTGTTTGGGAATGGATCTCATTATGTTGC
TCAGGCTGATCTTGAACTCCCAGGGTCAGGTGATCCTCTTGCCTCTACCTCCTGAGTAGC
TGGGACTATAGCTGTGCACTATTGTGCCTGGCTTTATTGTTGTATTTTTAACACCAGATC
CCACGCCTGCCAGACATTTAATATTCATTTACCAGGTAAGGGTTTTGGCAGAGCCTATAC
TGGACCCTGTGTGTTTTGACTTTCTGCCTAGCAATTCTTTCCAGTCTACACCAAGTATTT
TTGAGACAATTGTCTTTTTTAGGAATGCAGTAGAAGTGCTTTCGGTGTTCTTCCCATTTG
TCTTACAGAATGTTAAAAAGATATGTACTTGAGGGTTGAGATTTAATTACATTAATAATT
TTAACTGTTAGATCGGGGACATTCTTAAATTAAACTGGCTCCTTACGTTTTGAATTGTGA
GTACTTAGTGGTGACTCCTAGTAGAGTTTTATGCCACTGCTCTGTCTCATCCCAAGGCAC
TAACAGCTTTACCCATGATGATTGCTTTGTATTATCAGTACAAATGTACAGACAGTGAGA
AGGCTGAAAGCATCTTAGGATGATTTTGAAAGTAGTTTTGGCTATGTGCATCCTAAAAGG
GACCTCCAGGGGTCTGTGGTCCACCTGGTGCCAGCAGCTGCAGGAGATTTGGAAAAGGAA
TACTGACTGGGAGTGGGAAGAAGAGTGGCTGTCAGCAGAAATGGTTGGTTTTGCCTCAGT
TTACCATGTTGAGTAAACTGAGTATCGATGAAATTTGACCTTCTCTGCTGACAACCTATA
ATAAGTTTGGCCACTTTAACATTATAACAGAAACCACTATTTTTTGATGGATTTCTTTTT
TGCTAGAAGAAGAGATCAACTTTGGGAAGCTTATCACAAAACCACCTTCAGAAGGAACAA
CTCTAAGGGTAGAAGACCTTGTAAAACAGTATTTTCAAACTGCAGAGAAGGTAATTTCTT
ACTTGAACATGGCTTGCTTTCTTTCTTTTTTTTTTTTTTTTGAGACAGAGTCTCATTATG
TTGCCTTCAGTAGAGTGCCTTGGCGTCACAGCTCACAGCAACCTCAAACTCTTGGGCTTA
AGCGATTCTCTTGCCTCAGCTTCCCAAGTAGCTGGGACTACAGGCGCCTGCCACAAGGCC
TGGCTATTTTCTTGTTGCAGCTGTCATTGTTGTTTAGCAGGCCTGGGCCAGCTTCGAACC
TGCTATCCTCCACACATGTGGCCGGTGCCCTACTTGCTAAGCTACAGCGCTGAGCCTATT
TTCAAAGATTTTAACCAGTACACCTACAACAGTGTTCCTTTCCATAGGGACGTAGTCCTA
GGTTGCCACCACTGAAATCTTTAGCAATAGAGTAGTCACTATATGATGGGCACTATCCAT
GCCCACTCCACCAATCAGGACTGCAATCTCCTCATCCACCAGAAAATCCATCTAATCAGT
TTCTAGTCCCTATCTTACTGCATTTTTTGGTGGGACTACATGTTACCACATGCATTGATC
CATGTCCTCTGAAAAGCAGACACCAAAATAAGATTAGACACGTAATACCCATCAGGGAAA
TAGGGAGGGAGTGAAAAGAAACATGGAGAGCCAGCCAACTGGCAAGGCTGATGGCAAGGT
TGACAGAGAGTTCTTGAGCCAAATTCCATAGGAGGAATCTCACATGTGGCAGGAAAGGCC
TGCTTCGGTATCTCTCTGCTCCTTTCAGTCACTGGCTAGGAGTAACCTGTATGAAGCATG
GCCTTAGTGCAAATGTGGTAATGCACAGTAATTGATTGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTCAAACTTACTATCTTGTATATATGCCACTCTGAGATCTTC
TGGTTGTGTTAGCTGCTGAAACGAATTTCCACAAACGTAGTGGTTTAAAACAACACAAAT
GTATTATCGTCAAGTATGTATGTAGAAATCTTACACATCTAGACACGTCTCACTGGACAT
TCTGTGTTCCTTTATGGCGTCTCCAAGGGAAAGTCCAGTTCCTTCCCTTTTCTAGCTTCT
AGAGGTGCCTACATTTCTTGGCTCTTGGATTCCCACTTTTATCTTCAAATCTAGCAATGG
TGTGTCTCTGTGACCATTTTCGCACAGTTATATCTCCCTCTGATTCCTTTCTATCTCTCT
TTTCCATTTTTCAGGACCCTGTGATTACACTGGCCCCACCTGGATACTCTCTGCTAATCT
CTGTATTTTACAGATGGCTTTATTTCCCTTTTGTCATGTCTTCGCAAGTCCCATATTCAC
AGGTCCCAGAGATTAAGGTGTAGACATCTTTAGTGGGCATTATTCTGCCTTCCACACTGG
TTAACCTGATCTCTAAGATTAATCATTACCTGCCGTTTCTGGACTCTGTATTCCAGCCAC
TGAGACCTCTACAATTTCACCTGTCCTATACTCCCCTCCCTTTTCTGGTGTTGACTTTGT
TTTTTCAGGTCCTTAATGCTTACCAGTAGGCTTAATTACTGTTCACTGTTTTGGGGGTTG
TTTTTTTTTCCTTTTCCTTTAATAACTAGATAACTTTTGTATTTTTCTCTGATAACATTA
TTCTGTAATTTTCCTTGCTCGTATATGATTATTTTGCAAGAAATAGATGCCATTTCTGTA
TCTAGTGATTTATATCTGCCTTACAGAATGTACAGCTCTCACTGTTAACAGAAAGAGGAA
TGGGTGAAGCAGTACAAGAATTTGTCGACGAGGAGGAAAAAGATGCCATCGAGGAATTAG
TGAAATACCAGTTTGAAAAAACACAGCGATTTCTAAAGGAACGTCACATTGATGCTCTAG
AAGATAAAATTGATGAAGAAGTGAGTAACTAATTTAGATGGTCTGTTTAGACCATCTGTC
TTTAGGAGTAGCTCTGAGTTTTTTTTTCAGATAAATCAGTATTTAACCTCTCCAATTTGT
TTAGTATCCTCATCTATAAAAGTGAGATAATAAAATGAAGATTAAATTGGAAAATGCCTA
GAAAGTGAATAGAATGGAGTCTTATACATGTGATTGTCCTGAATAGATGTTACTGGGATT
CCCCATAGATCAGGGGTCCTAATCTTTTTTTATAGAAGACCAGTTCACTGAACCTCAGAG
CGTTGGAGGACCAGACTATGGGCCCTGCGAAGAGTCGCTGCTAAGCAGGACAGGCAGTGG
TCGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTTTACCAATCAAGTTGTAGAAAACCAGTTTAAAGTGTTGTA
TGGGGGAAATATTGTGTATGGGCAGAGCTTTTATAAATGTTAAAAAATTAAACATTTTAA
TAGAATAAGGAACAAAGGACATGAATAGGTGGTTCACAAAAGAAATATAAATGGCTAATA
AGCTTATGAAAGTGTTGTTTAGCCTAGGATAATCAAACTAAAATATATTTTTTATTTGTC
AAATTGGGAAGCAATTTGAGAAAAATAGTATCTAGTATACTGCTAATACAATATTATATT
TGATTAGTGATTTGAGAAAAATAGTACATATGGTGTACTTTTGATGCAAGTATTATGTTT
GAATAACTTTACTGAAAGTAGTTTGGCAATTTGTATCAACAGATTTAAGATTTATCCTTA
AACTCAGCCCTGGAAATTTTCCTCCAAAAATAAAAATTTGTGTATGGATTGATTCATATT
AGGATTATCCACAGTAGGGAATAATTGGATATGTTTTGATACAGTAAATGGTGGCATGTA
TGTAGTATAGAATTCTATGCCACCATTATTATGTCAAGTTGGAATAGAATTCCAAGGATG
CAAAACTATGGATAATACAATTCAGTTTTAATCTTTTATGTGAGTGTGTGTGTACATACA
AAGAATGAAAGAAAATATTCTAACCATTTTATCAGTAGTTGTGTCTAAGTAGTTGGATCA
TGGGGTATCACTTTCTATATTTTCCACATTTCCCCAAACAGAAGAACAAAACATTGTTTT
AAGAGCTCATTCCCTTTGGCTTTCATTTTAGTGCTTTTAATGAACATGGTTTCCTTAAAA
CCTTATGGTGTCAATGTGTATCTTAGTGTTATTCAGTGCCAGTCAGCTACTTCCAGAGTG
AGGACAGGTAATCTGGATGTATTGTGTTTGGTAATTTTTAGCATAGATGGATTCTCAGGT
ATCACAAGTTAAACGTGACCATCCCTACCTGGAATGACATCACAGCTCCTGGGCCACAGA
GAGAAAGAAAGTGTGAGAATCTGTGTGTGTGTAGTGTGCTGGTTAATAGGGCTGAGGGTG
TGAGACCTGAACTAGACTGCCTGTGTTCATAATCAGAACCCTTATTACCCATCAGTGATC
TAGCCTCTTTGTACCTCAATTTCCTTATCTATAAAATGAAGATAATAATAGAACCTTCTT
CAGGATTAAAGTATTATTCCCGGCTGGGCTTTGTAGTTCACGCCTTTAATCCTAGCACTC
TGGGAGCTGAGGCAGGTAAGATTGCTTGAGCTCTGGAGTTTAAGACCAGCCTAAGCAAGA
GCAAGACCCAGGTCTCTACAAAAAATAAAAGAAGAAAGAAAAACTAGCCAGATTTGGTGG
TTCATGTCTGTAGTCCCAGCTACTGAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCC
CACTGAGCTATGGGCGCTGAGCCTTGAACATGGCTTTCTTAAACATTTCTTAATTTAAAA
TATATTTAACTGATACTGTAAACAAAATGAATCCTCAGAATGTTTCTGTGAAGGAAGTAG
GGTGACTGCTAATTACATGTATTTGTGGTTGTTAAACATCTAGAAAAATTCATGCTTAAT
TAATGTTATTAATATCATTATAATATCACTATTATGTTGATGGTGTTATTCTTGCTCTAT
TTTTTTATCTCTACTGTAAAAGTCCAGTATCTACTTTTCTCAAATTTGGATGTAATTTCA
GAATTACTTTATAAAGACATAGGGTGAAACCACTCAAACTTACTATCTTGTATATATGCC
ACTCTGAGATCTTCTGGTTGTGTTAGCTGCTGAAACGAATTTCCACAAACGTAGTGGTTT
AAAACAACACAAATGTATTATCGTCAAGTATGTATGTAGAAATCTTACACATCTAGACAC
GTCTCACTGGACATTCTGTGTTCCTTTATGGCGTCTCCAAGGGAAAGTCCAGTTCCTTCC
CTTTTCTAGCTTCTAGAGGTGCCTACATTTCTTGGCTCTTGGATTCCCACTTTTATCTTC
AAATCTAGCAATGGTGTGTCTCTGTGACCATTTTCGCACAGTTATATCTCCCTCTGATTC
CTTTCTATCTCTCTTTTCCATTTTTCAGGACCCTGTGATTACACTGGCCCCACCTGGATA
CTCTCTGCTAATCTCTGTATTTTACAGATGGCTTTATTTCCCTTTTGTCATGTCTTCGCA
AGTCCCATATTCACAGGTCCCAGAGATTAAGGTGTAGACATCTTTAGTGGGCATTATTCT
GCCTTCCACACTGGTTAACCTGATCTCTAAGATTAATCATTACCTGCCGTTTCTAGACTC
TGTATTCCAGCCACTGAGACCTCTACAATTTCACCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTATCCTCATCTATAAAGTGAGATAATAA
AATGAAGATTAAATTGGAAAATGTCTAGAAAGTGCCTAGAATGGAGTCTTATACATGTGA
TTGTACTGAATAGATGTTACTGGGATTCCCCATAGATCAGGGGTCCTAAACTTTTTAAAC
AGGGGGCCAGTTCACTGTCCCTCAGACCGTTGGAGGACCAGACTATGGGCCCTGGGACGA
GTCGGCTGCTAAGCAGGGACAGGCAGTGGTGGCAAAAACACCTGGTGGGCCAGATAAATG
TCCTTGGCGGGCCGCATGTGGCCCTGGGCCGTAGTTTGAGGACACCTGCCATAGGTAGTA
AGTATCTTCTCTTGAAGATCCCTAAAGTGCTTTTAAATTAACTCATAGGATGAAAATTCC
TGTTTATCTCCAGTTTTTAGTAAGTTTTGATTGAGATTTTGAATTTTATCTAGAAATTTT
ATTTAAGCATAAAAGCAGTGAAAGAATTACACATGAAAAGCTGTTTAGATTTGGCTACAT
AGAAGTTTTAAATCTTTACACATCAAGTTGTAGAAAAACAAATTTAAAAGTGTTGGTATG
GGGGAAATATTTGTGTATGGGCAGAGCTTTTATAAATGTTAAAAAAATTAAACATTTTAA
TAGAATAAGGGAACAAAGGACATGAATAGGTGGTTCACAAAAGAAATATAAATGGCTAAT
ATAGCTTATGGAAAGTGTTGTTTAGCCTAGGATAATCAAACTAAAATATATTTTTTATTT
GTCAAATTGGGAAGCCAATTTGAGAATAATAGTATCTAGTATACTGGTAATACAATATTA
TATTTGATTAGTGATTTGAGAAAAAATAGTACATATGGTGTACTTTTGATGCAAGTATTA
TGTTTGAATAACTTTACTGAAAGTAGTTTGGCAATTTGTATCAACAGATGTAAGATTTAT
CCTTAAACTCAGCCCTGGAAATTTTCCTCCAAAAATAAAAATTTGTGTATGGATTGATTC
ATATTAGGATTATCCACAGTAGGGAATAATTGGATATGTTTTGATACAGTAAATGGTGGC
ATGTATGTAGTATAGAATTCTATGCCACCATTATTATGTCAAGTTGGAATAGAATTCCAA
GGATGCAAAACTATGGATAATACAATTCAGTTTTAATCTTTTATGTGAGTGTGTGTGTAC
ATACAAAGAATGAAAGAAAATATTCTAACCATTTTATCAGTAGTTGTGTCTAAGTAGTTG
GATCATGGGGTATCACTTTCTATATTTTCCACATTTCCCCAAACAGAAGAACAAAACATT
GTTTTAAGAGCTCATTCCCTTTGGCTTTCATTTTAGTGCTTTTAATGAACATGGTTTCCT
TAAAACCTTATGGTGTCAATGTGTATCTTAGTGTTATTCAGTGCCAGTCAGCTACTTCCA
GAGTGAGGACAGGTAATCTGGATGTATTGTGTTTGGTAATTTTTAGCATAGATGGATTCT
CAGGTATCACAAGTTAAACGTGACCATCCCTACCTGGAATGACATCACAGCTCCTGGGCC
ACAGAGAGAAAGAAAGTGTGAGAATCTGTGTGTGTGTAGTGTGCTGGTTAATAGGGCTGA
GGGTGTGAGACCTGAACTAGACTGCCTGTGTTCATAATCAGAACCCTTATTACCCATCAG
TGATCTAGCCTCTTTGTACCTCAATTTCCTTATCTATAAAATGAAGATAATAATAGAACC
TTCTTCAGGATTAAAGTATTATTCCCGGCTGGGCTTTGTAGTTCACGCCTTTAATCCTAG
CACTCTGGGAGCTGAGGCAGGTAAGATTGCTTGAGCTCTGGAGTTTAAGACCAGCCTAAG
CAAGAGCAAGACCCAGGTCTCTACAAAAAATAAAAGAAGAAAGAAAAACTAGCCAGATTT
GGTGGTTCATGTCTGTAGTCCCAGCTACTGAGGAGGCTGAAGCAGGAGGATCCCTTGAGC
TCAAGAGTTTGAGGTTGCTGTGAGCTAAGATGACACCATGGTACTCTACTCAGGGTGAAC
AGAGTGAGAATCTGTCTCAGAAAAAAAAGTATTTTTCCTGTATTTTCCCTCCTCTATAGA
ATCATAACAAACATGCTAGTGTTTCTTTTTAGCTTAAAAAACAAAACTCTCGATCCCATT
TCCCTTTAGCTACTACTGTGTTTCTTTGTTCCTCTTTTTATGGCTTCAAAGAGTTTTTAT
ATGTTCTGCTCCTTCCTTTTTCTCTTAAACCCATTCATTCAGGCTTTTGACACCATTGTT
CCAGCGAAGCTGCTTGTGTCAAGGTCACCAGTGACCTCCGTTGCTGAATCTGCTGTCAGT
TTGCAATCTTAAATGTCACTTGACCTCTTGTGAGACATTTTTCATTGACTTTCCAGACAG
TATTCTTTTCTGGTTTTATTCCGACCTCACTGGTTGCATATTCTCAGTCTCTACTGCTGA
ATCCACTCATGTCTCCAGCCTCTTTAATTGGGGTGCCCAGAACTAAGTCCTTGGGTCTCT
TTTCATCTATACATACCCTTTGTGATCTCACCTAGCTTCCTGGGTTTTAATACCATCTGT
TGATGACTTTCAAAAGTCTAGCCCTAATTCCTCCTGTAACTAAGACTTCTGTTGCCAACA
GCCTGCTAGGCATTCCCATTTGGGTACTTAAGAGATGCCTCAAACTTCTAATAGTCCTAC
TCTGAATTGCTGATCCTCACCCCCTGCTCTCAGACCTGCTCTCCTGTAGTGTGATAGTGG
AAGCACCATTTTTTCAGTTGCTCAGGCCAAGATTTTGAAATCATCCTTTCTTTCTGTCAC
CTATAGGCTGAGTGTCCTTTTTATCTTTGCCGTTAGATGTATGAGTACGCGCTATCTGAC
TGGCTCATGCTACCTTCATCACTGCCGTTGGTGAGGGTGTCATTGTTTCTCACTGGATCG
TTCAGGGTAAAGGTGGTCTCTCTGCTTCCACCTTTACCCTTCTTCCCCGTACACTCTCCC
AGTCTCCCCCCACCACCGCCCCGCCGCCACTGCCAATTCTGTTCTCAAGTCAGCCAACTG
AATTCTCACATATTTTAGATCTAGTCATTCCTGCCTACAAAAAAGTCTTGACAGTTGCTC
ACAAGGCCTTACTCCATCTGGGTTTCTGTTATTTCTTTACCTGTATATCTGATCCAGTTA
CAACAACCCCTTCTTATTTCCTAAATACACCAAGGTCCCACCCACTTAAGATAACTATGT
TAGGAAGCCTCCTGGATGTCTTGCAGCCAAATATACAAGAGTGATTGAGCAATGTAATAA
AGATTCAGGCCTCATCAAGGAGAGATTTATAACTATTTTGCTGAAGTATAATACCATGGG
ATATTAGAACTTTTTTCCTCTATAGTCTGACAGACTGTTTTTCAGTGACATGTAACATTT
TGGCAGCAGGTGATATAATTTTGCTTTGGGCCAATATATTTTTTAAAGAGTACATTTCTG
ACTTTTTTTTTTTTTTTTTTTTTTTGAGACAGTCTCACTTTGTTGCCCTAGCTCACAGCA
ACCTCAAACTCTTGGGCTCAAGTGATTGTCTTGCCTCAGCCTCCCAAGTAGCTGAGACTA
CAGGCGCCCGCCATAGTTGTTGCTCTGGCTCAGACTGGTCTAAAACCTGTGAGCTCAGCC
AGTTGTCCACCTTGGCCTCCCAGAGTGGTAGGATTACAGGTGTGAGCCACTGCACCTGGC
CCATTTCTGAAATTTTAATGTGAGTAACTAGAAAGATGTGATTTCTTTAATCAGTCTTTT
GTCAGGAAAATTATTAAATTTCCAAGTTTTATGTTACAGTGTAAAGTATTTCTTAATCAT
TTGTAGCCCATTACCTTATTTTTACACAACTGGAATAAGCAACATGAACATGTTTGTGAT
GACTCTTACTATAATCTAGGTACGTCGTTTCAGAGAAAGCAGACAAAAAAATACTAACGA
AGAAGATGATGAAGTTCGAGAGGTAATTTTTCTGTTGTAAATTCCTATGCTTATATTCAG
TTTGTTAAAATAACTAGTAGGTATATTTAGAATAGTCCAGTAGGCCAGTGGAGTCCATGA
TGGATAGGAGTGAGCAGGTGTTGGGTAAGGATAGCCGCCTTTTGATTGATTTCAGTTCAG
CCTACAAATATTCTGCCCACTGATGTTGCTTTCTTCTTCTTTTTGCTCCTGTCTAAAACG
TAACTTACTTTGTTGTATGTGTGTGGGAGGGGGCATATACAACAAGAGCACTTATTAATC
AAAGTAATACCCAATTGCTATCAGAGCATCTTAAAGGTATAAGATAAAATCTTACTCTAT
TGAACTGATATATTTTGGGCAAAAAAGAAACTTAGTGTTTTGGTTAGCAGTGTTACCAGA
GGTAAATAATTAAAATAATTAAAGATTATTCCATTGCTAGTTCTAAACTGTTACAGTGAC
TCAGCACCATCATCACATCATCTCAGGTTATAACCTATAGGTAGCACCATTACTGATTTG
GGCCTCTTATCTGATACTGGTGAATCACAATGAATCTATTTTCTAAATTTCTAATGTCCT
GTGTTTATGATGCTATTTAGTATTTAAAAATGGACAGAGAATCTAAGGCCAGGGGGCTAC
ATGGAGCCTTCTGGATTGCTGAATGTGGCCTTTTGACTTAATCCAAATTTTACAGAACAG
TTTAGATTTGGTGGAGGGGCCTCACTTGGGGGATCCGAGGACCCCGTGTGGCCTTGAAGC
TATGAGTTCTAACCCCATTGTGTCTACAAGATTTTCTCAGCTTAGTCGGTAAGAGACATG
TGAGGAAAATCTTTAATTATTACTAGGCACCTGACTTATACTATCTTAGTTTCCATTTTA
TAAATGAGAAGACTGAAACTAAACTCAGGGTCACATTGTGATGGAGCTGGAATTTGAACC
CAACTGCTTCTGCCTCCAAGTCTAAATTTTTCCACCATCCTCTGTCCTATCAGTATTTTA
GATTATAATAATATTAATTCAATGCATGGCCAACGAATGGCTAAAAATGAAAAACTTCTA
AAACTATCAGGTCACACATCAAAACTACTGTTGATCATATGCAAGATAGAACTGCGATGC
CTTTTACAGGTGGTTTTCATAAGGTAAAGGGGAAAAGGTATACATTAGGAAACTCCTTAT
CACATTTTTTGTATTTATAGTCATTCATTATAAGGTGTGCCCTTAAAATAGAAAAGATAG
TTCAGCAAAGAACAAGAATGAATGCTAAGAGAAAATGATTCCTGGTTCTTAGATTATCCC
GCTTGACCTCGATTAACCCTTTCAATTTAACAGATTACAGAAATACTTATGTTTGAATGG
GTCCTTTGTATTTGAAACCACTAATTTCAGTTTTCATTAATCTTTTAAAAGAGAAAGGAT
GAACATTTTATACAGGGAAGAAGTATGAGTTTAGACTCTCAGCTGTGTTTTAAGGCTTTT
TCAGGTAATCAGAGTTTCCTAAGTAATTTTTTAGCAAGCCATAGGATGGCACATATATTT
TCATTATCAGCTTACCACTCAGAGCATAGACAATGGAGTTTGACATTTTGCTAAAATATA
ATTCATGGGTTTTGAGTATCATTTTAGCTTACAATATGAATCACATAACCTCAGAAAAAG
ATGTCCACCACAAAAGAGAAACCTTAACTAACTTTAAAGACAAACATAAAGTATGAGTAT
GGCATTTAAACAAAAAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGAAAAATGTAAAAACTATTCTAACTCTGACCCATAGTACTTAGTTTACTTGGATTCT
AATTTCTTATAATCTATTTGAGTTTGAGGCAGGTGGTTATCTTCTTTCAAAATGTAATAC
CAGGTACTATCAACAGAGTGAAAGGTAACCCACAGAATGGGAAATGATAATTACAAATCA
TATCTGATAAGGGTTTCATATCTAGAATATATTTTAAAAACTTATAAAACTCAACAGTAG
CAACAACAATGAAAGTTCAATTTAATAGGCAAAAGGCCAAGTGCTTTTTTTGGCTCACAA
CTGTAATCCTAGCACTCTGGAATGCCGAGGCTGGAGGATCTCCTGAGTTCAGGAGTTCCA
GACCAGCCTAAGTAAGAAGGAGACCCTGTCTCAACTAAAAAATAAAAAAAAACTAGCTGG
ACATTGTGGTAGGTGCCTGTAGTCTCAGCTACTTGGGAGGTTGAGGCAAGAGGATTGCTT
GAGCCCAAGGGTTTGAAGTTGCTATGAGTTTTGATGCCACGACACTCTATCCAAGGTGAC
AGAGTAAGACTCTGTTTCAAAAATAAATACTTAAAATTAAAAAATGGGCAAAAGACTTAA
AATAGACATGTCTACAAAGAGATTTACAAATGATCCATAAGCCCATGAAAAGATACTCAG
CATCACCAATCATTAGAGAAATACAAATCACAATAATATATCACCTCATACCCAGAAGGA
TGTTTATTATTGGAGAAAAAAAGAATGTAAGTTTTGACAACAATGTGGAGAAATTGGAAC
CCTTGTGGATTGCTGGTAGGAATGAAAAATGAGACAGCTGCTGTGAAAAACAGTATGGCA
ATTCCTCAAAAAATTAAACATAGTATTACCTGTATCTTAACAATTTTACTTCTAGATATA
GAACCAAGAGAATTTAAAGCAGGGACTTACAGATATTTGCATACCAGTGTTTATAGCAGC
ATGGTACACAACACTCAAAGGAGAGAAACACCCAAATGTCTATCAGCAGATGAATGGATA
AACAAAATGTGGTATATACGTGCCGTGGAATGTTACTCGGTCTTAAAAAGGAAAGAAATT
ATCTTGCATGCTACAATGTGGATGAAACTTGAAAATGTTATGCCAAGTGAAAAAAGCCAG
ATGCAAAAGGCCAACTACTGTATGATTCCACTTATATGAGATAACCTGGAGTAGTCAGAT
TCATAGAGAAGTGCCTGGGGGAGGGAGGAGTGACAAGTTACTGTTGAATGGATATGGAGT
TTCAGTATGGGATGAGGAGAAAGTTGTAGAGATGGATGCTGGTGATGGCTGCATACCCAT
GTGAGTGTACTGACTGCCTTTGTACTACATTTGAAATGTTTAAAAGAGTAAAATTTATGT
CATGTATATTTCAGCACAATTAAAAGACAGTAATACAGGATAGTATGATTTCAGGTCTCC
CAAGTGTATGGAAACATCTTTGTCATTGGCTGTAGATCTGCAGTCATGAGGTAAAGCCTT
AGAAGTGATATACTTCAAAGATAACAATGAACTCCCAAAGTCTTTCACTGGCAAAAGGTA
GAGTTAAAATAAGATTTGAGAGTAGTGTTTGAGATGAAAAAAAATGGAGATAACAGTATT
TAGGTAAAAGGAAAAATACAAAATTTAGAGGTGATTGTTGGTAATTCATTCCAAGAAATT
AATAGAGTATATTTATTTTAAATTTGCTACATCTATAAACCATCACACAGTTTACATGCC
AACCAGTGGTATTTGGGAGTGCTTATTTCCCTACATCCTTGCCATTTTGATGGCTTACCT
TTTTGAGCTTTACAAATTTAAGGGATAAAAAACCATTAACTACTGTTATTTTTAATTCAT
ACTTCTTTTTTTACTATTGAGTCTGAGGAATTTTTGTGTTTATAGATTCTGTATAGTCAT
ATGAAACAGGTGGGTTTTCTTTGCCCGAATTTTCTTTTTTGGGTAGGGCATTGGTCTTTC
TCCAGTGGTTTGTAAGAGTGCTTCCTTGAGCACAGTTATGTGTTCTGTGTCTCCGTGTGT
ACGTACACAAAATAATACAGCATATTTAGGGTTTTGCCTAAGGTGTCTACTTTTTCCTGA
GGCTTACTTGTTTAAATCTGGAATGGCTGGTGAGTTACATCCCTTTTTGGCATACATAGA
GATACATATTTGTTTTTTTTCCCTTCTATTAGTATAATTCATTATATTTTAATATCCTTT
TTTTTTAAGACAGAGTCTCCCTTTGTTGCCCTCCCTAGAGTGTAGTGGCANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCCTCTATGTTCCAGAATTCGCTTTGTTTACTTTTGTATTCATAATAT
AAGATACTGTAATTTTCTTTTTGGGCATGCAATTCTTTGTCAGTACCATGTCATAATAGC
ATTGTAAAAATAGCTTTTTTTCTTTATGTTCTGGCACTATTGAAATAGCAGTAGGATTAT
CTGATTTTTGAAAGTTTGGCAGAATTTACTTATGAAACGTTCTGGTTTTGGTCCTTTTGG
GGGATATGTTTCTTCTAACGATTTCTTAAATTTTTCTTTGATAATTGTTCTGTTGAGAAC
ATTTCGTTCCCCCACCCACTTAGATTGGCTTATTTATTTTCCACATTAAATAAAATTGAA
CATTCTGTCATAAGTCTTGATTTTCCATGGATCTCATCCCCCATTCTTATTTTTAATAAT
GTATAGTTGTGTTTTATTCCTTTTTGTTAAGCTTGTCAGTGATTTTTATCAATGTTGCTT
TGTCCCACAGGACCAGTTGTTACATTTATTAATTTAAAGGTGTTTTGTTTAAAATTTGTT
AATATTATAGTTTTTATTCTTTTTAATATGTGGTGCTTTCCTTTGATAGACTTTTATTTT
TCCTAACTTTTTGAAAATGGAGTTAACTTTTTTATATTCGTTCTTATTTAGCAAGCTGTG
GGCTTTCTTAAAAGCACTACTTTAGCTCTCTCATATGATGTCATATATAATTTTTTTTTT
TTTATTTTGTAGCTATTCTACTATTTTAGTTTTGTTTTATAGTTTGATTCTAGTTAACTT
TCAGGAGGCAAGATTTTTGCTTTATTATTCTTAACATCTCATTGCATGCTGATTAGACAG
TATAATAATTCTATTTCTAGCATTTATTAAGATTTTCCTTTGTATCCTATTATACATCAA
TTGAGAAGTTTCATAGGGTCTTAAAAAGTAGTACAAAGAGAGAGCTCCAAAAATGTACAC
ACATTTTGTTTTATTTTTTTCTATTGTTGGGGAATCATTGAGAGTACAAAGAACCAGGTT
ATGCTTGCATTGTTAGGTAAAGTACCTCTTATAATTGTGTCCTGCCCCCAAGAGGTATGT
CACCCACCTGACCCCCCAACCCCCTCCCTCCTTTCCTCTCTTCACTCCCCCATTCTCCCA
TCCCGTACCATGTACTAGTATCAGTTGTCCTCATATCAGAATTGAGTACATTGGATTCTT
GCTTTTCCATTCTTATGATGCTTTACTAAGAAGAACCTTTTAAGTGCTGTTATCTATGTA
TTACTTTTCAAAGGTATACTAAAGGTGCTGTTACTGGTTAAGTATATCTATATGCTACAT
GTATTAATTTTACTGGCATTGCGTACACTTTGGGAATGGTCAATTTTACACATTTTTTTG
GCGCCCCTAGTATTATTTATTTTCAGACTACAGAATTCAACATATATCCATTAGATCTAT
TAATTATGTAATTTAGGTCACCTGTTAAAGGTCTGCTTTTAAGAATGGACAGGTGCTTTT
TGTTATTCTCAGCAGATGTGTCTCTAAAGTTACTTCTAGTCCTTAGGTTCTAATGGGCCA
CTGGTTATAACATTTTGTCAGTATAACTCACCCTTGAATGAAGCTTATCTATCCTAAATT
TTGTCCATATGGCATATCACAGCTTTATGCCTAGGATCACTAAACAGCATTCCAGAACTA
CGTTGGAGGACCATTTTAAACACCAAATTAATAAGCAAAAGGGAAAACAATGCTTGTAAG
ATGATAATACTGTATTTTTATTGTATGTTTTCTGTTTAGATATGCAAATACCATTGTGTT
CCAGTTGCCTACAGCAATATGCTGTCCAGCTTGTAGCCTAGAAGCAATAGGCCATGCCAC
TTAGCCTTGGAATGTAGTCGGCTATACCATCTAGGTTTGTTAAGTACATGCTAAGATATT
TCACAGGGACAAAATCACCTAATGACACATTTCTCAGAACATATTCCTGTCGTTAAGCGA
CACATGACTATTTCACAGCAGGGACACTTGTCTACAGTACAGGAGCTAAAACAAGGCAGA
GTGGCTCATTCTTTAACCTTCCCTGGGAAGTGTGTGTCAGGCAGCACACGATATATGTGA
GAAAGACCATAGAAGTATCACAAGTATTGAGTTACAAATGAATTCTGGTAATTAGATGAA
TTTGTAAATGTGGAATTTATGAATAATGAGGGCCTGTTCTTCCTTTTGGACAGGAAAGAT
GAATTGAAGTCTTTTCCTACTGTTGTCTCTTTTTATTTTTTGCTATATTCCCTGAATATA
GAAAAGGCCATGTCAAGCCCTTTATGCAGTAATTTGTTATTTCACCTCAACTGAGATCAT
CTTGAAGTTACATAACCTCCTACCCCTGACCCCTCACTTCACTCCTGTGCCCATCTTGCC
TGACTTGCTTATCTGCTCCTTCAGTTATCTTTCTCCTTTATGGTATCACAGAGCTTAAAA
ATGCTGTGGTCATTTATTCTTATTCCCAAAACTTGCCATCCCAAGCAAGAAAGACTGTGG
TCATGGCCTCTTGGGATATACACACCAATTTTGAGTACTCTACAATGCTTGAAATCCTTA
ACTTTCTCCTAAGCTAGGTTAAATATTCATTACAGACCAGGTGTGGTGGCTCACACCTAT
AATCCTAGTAGTCTGGGAGGCCTAGATGGGTGGGTAACTTGAGCTCAGGAGTTTGAGGCT
AGCCTGGTCAAGACCCTGTCTCTACTAAAAAAAAAAGAAAAACTAGCTGGGTGTTGTGGC
AGGAGCCTGTAGGTCCCAGCTACTTGGGAGGCTGGGGCAAGAAGGTTGCTTGAGCCCAAG
AGTTTGAGGTTGCCATGAGCTATGATGCCATGGTACTCTACCCAGGGCGACAGAGTGAAA
CTCTGTCGCAAAAAAAAAAAAAAAAAAAAATTCATTATACTCATTAATTCTTCCTCATAG
GTTGTGTGATTGTAATTTGAGCTATTTTCTAATATTTTTGAAAATATGTTGGCATTTTGT
TTTTATTCTTGTTACATTAGTTGAAGGGAAGAGAAGAGCAGAATTGCTATTATTTTTATC
AGAAATCTGTATTCATTCTGGAGTAGAATATTTGGTGAGTCTCAAACTTGTCANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATTCTAAAAAGTAGCTCAAATGATGACAGTCCCTTATAAATGA
TCTTCTGAATTAGGGGTGATTATTAATATTTCAGTTCTGCAAGTTTTGAGTCTGTGATAT
TTTTCCTGGTATACCTTTTCAAAAAGTGTGTTTTACAGGTAGCATTTTATTAATAAATTG
ATCTAACAGATAAGAAGCATCAAAAAGCATTAAATTTGGTGGGGAAGTTCTTTATATTTT
TATAGCATGATTGGTGAAAAATATAATGTAGACAGTTTGACAGTGTCAAGTGTTTATCTG
AAGGGCCACGTTAATGATTTGTAGGCTACTGCACTATCTACTTACGTGTGCTTTCTCCTT
ATCGTCCCTCTCAGGCTATGAATAGGGCCAGAGCTCTCAGGTCTCAGTCAGAGGACTCTG
CTTCTGCCTTTAGTGCCGATGACCTTATGAGTATAGATTTAGCAGAGCAGATGGCCGATG
ACTCTGATGATAGCATCTCAGCAGCAACCACCAAAGGAAGAGGCCGAGGAAGAGGCCAAC
GAGGAGGAAGAGGGCAGAACTCAGCATCGAGAGGAAGGTCTCAAAGAGGAAGAGGTTAGC
ACTGAGTACAGTCTTCACCACATGTTCAGTCTTGCCAGCTGAGTGGGAAATAGAGAATTT
TATCTTGTCAGAATTGAGTTATGAGTTTTTATTTCTAAAATGTAATTTAAAAAATACCTA
TTTTCATAATGCATGAAGATAGCCTTTAAAGCAGTTCTGACATGTACCTTTTACTTCAGT
GAATGGCCACATGCCCATGGGGTTTTAATTGTTCTTAACACATATTTTTTAAAAGTTTCA
CTGTGTTTCATACAGTACCTTATGAGTACATTTAATGTCTTATGTTCACACATCAAGGTA
ATAGGCAAGTATGAGTTGTTAAGGAAAACGGCCAGCTAATGACCATTGGCAACAGGAAGG
AAACTCCAGAGCCAAAAAAAGTATTTTTTTTGCTGTCGTAAGATACAAATGCCAAAGTGG
ACTTCATAAAATTTGTTTAGAAGGAAAAACTACTCCCATATAATTAAATTGTCATCATTG
TATTAATGTAACACTGTTGTCACTGAATGGTTCAAACAAACAGAAAGTGGTCATCTAGTA
ACTCACTGATGTATTATATAAATCCATCTCTAGGGATGTTTTAAAATCATTTTCATTAAA
TATTTATCCACAGGAATTTAAATTGGTAAAATGAATACTAATGTAGTTTAAAATTTCCAG
GAAGAGAAATTCCCATCTTCTAATGATGATTTTTATTATCCTTACATTTACATAAGTTTT
CCTTAAATTTTAATTGGACAAATGTGAACCAAATGTGGTCCAAAAGAACAGTTTCTGAGG
CTGGACATGGTGACTCACACCTGTAATCCTAGCACTCTGGGAGGCCAACACAGGTTGGAT
TACTTGAGCTCAGGAGTTTGAGATCAGCCTGAGCAAGAGTGATATCCCGTCTGTACTAAA
AACAGAAAAACTAGCCAGGTGTTGTGGCTGGCACCTGTAGTCCCAGCTGCTAGGGAGGCT
GAGGCAAGAAGATAGCTTGAACCCAAGAATTTGAGGTTGCTTTGAGCTATGATGATGTCA
TAGCATACTACCCAGGAATGAATCTGTCTCAAAAAAAAAAAAAAATTGGTTCTGAGAATT
GATTAGTTGGACTTTATATGTTTCTTTCTATATGCGTCTTCAGGCTTTTACAAACTTAAT
TAGCTTTTATTTTGGTATTGTGTTTAAAAAACAAAAAAACATAACTACTGATAGGATTAT
ATATTGACTGCTCATTATTTTAACAGCAGGCACTCGTCTGGAGATAACTACTACTCGTAG
CAGGAGTTCAAAGGCTACTGTGTCAACATCTAGAAATATGTCTATAGTAGATGGTAAGTG
TACACTGTAAGTTATCAATTCCAATTTAAAAGGAGCAAAGCAGTCTCCCTTAGGAACCTT
CATTTATCTGTGCTGTCATCAATGGGAAGCTTAAAAAGACAGTTTAGGATCACAGGGTAA
GGTATTTCTTAAAAGCTCTTTGTAGTACAGCAGAACTATTGAAATGGGTAAGCTTTAAAA
ATTATGTCTTATAATTCCTTACTTTTAACTATTTTATTATTATCTCCTATGACAAAGAGA
TCACAGCAGCATGGGAAAGTCAGGCAGTTAGTCGTCATACCAGCAGTGGTGGAGAGAGAA
GGGAACTAATTACTTCTTCACGTACTGTTACCTTGCGTTCTCTGTGCTGCTGCTGTCTAT
AGAGACGTGTCATGGGAGCTGCATTTACGAAAAATTATAGCTAAGTTCTTGGGGTTCATT
TGTGTGTGTGCTATGGCCTAAAAATTGACTTCAACTTCAGGGGATTTATAAACTGTTTTT
AATATTGTAGTTTATGAGATCAGCCTAAGTTGTTGATCAAGTATGTGTTAAGATAGGTGG
TGATATTTTTTCTACTTAGCATTTATTATAGAATATATTCATGTGTATTTTATTTATTAT
CTATTATTGAGGTTAATTGTGGTATCACTTTTTTAGCTATGATTTAACTTTTAACACACT
GGGGAGTTGAACTAATTCTCACAAGATGCAATTTATCAAGGGTAAATACAAACTGCATTT
ATGTTCAAAAGGACAGCTACACAAATAGAATTGTGAGGTGTGTGAGTTTAACAGCAACCC
AAGTGAAAAAGACTTAAGTCAGTAAGAGTTGCATAGGTCAGTCTAACTGTCCAAATCTGT
TGAGGTCTGAAGGAGTAGTGGCTCTACAGCATCTGCTGAATTGGATGTATCACGCCAAGA
ATCCTGTAGTCATCTTGGAACTGTATATCAAGAAAAATATCAACTATATATGATCTTTCA
GAAAAGAGACCAAATAATACGAAAAAATTGTTGAAGAAGCTTGGGATACCTAAACTGGGA
AAGATTTAGATCTTTACATGGATTATGTTCTATCATGTGAAAAGTGAAATAGATTTGATT
TGTTTAGTCCCAAAGGGAGTGGTTTTAAATCTCTTTGAGCTTATGGATTCTCAAAGAGAA
GCTATGTCTTCTTACCCTAAATGGTACTCACATGCAATTGCACTCAATTTCAAAGGGTTC
AGGGATGCACAAGAAGCCCATCTCCGTCCTCCAGATCAGAGTTTGTGGTCCAATGAGGAT
GGATGGGAAAAGCTAGAAACAAGCTTACTTAATGTTTATGATCTCATAGGATGGATCTGG
AAGACTTAAGAATAACTTTCTGCTCCCTCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCTGGTAAATTGAAACGATCTAGCTGAGTCA
CTCCTAGTTCAGCACACAATGCTTTGTGATTGAGACACTCACTCTCATAGTTACATATGA
GTTGGGAAAAATAACCTCTACTGTATTGGGTTATTTTGAAGATTAAATAAGCCAAACCTG
GCACACAGTAGGCATTTATGAAATGCTGTTGTTACTGGTGCTTACCATAGGCTGTGTTGT
GACTCTGATCATACAGAAAGAAGAAGCAGAGTAAACCTGCCCACGTACACCTCAGCCCTA
GCCCTGTGCCGGCATTGTGAATGGGGGGACATGGAGTGAGTGAGTGAGTGAGTGAATGAA
TGAATGCTACTGTTACTATTACAAAAAATGAAAAGACAGAAGAACATAGGAAAAGAGAGT
GAATAGAATATGACCACTTCCATATTAAACCACCAAACGTTGTATAGCGTACAGTTGCCA
GAGTCATAGATTACCTGCCTTTACTTTAGCCCAAGTTGCTTTTATTTTTGTCCCGGCTTA
ATTATTTTATATGAAGCATTCCTTGACACTGGTAGGTAGAATTAGTCACTTGAAGTGACT
CTTTGGGTTTCTATTATTAAGAAATCAGATATAAATTATACTTACTGCATTTTTTTAAAG
TAACCTATTTTTCCCTCAGCTTGCTGTCTTTGGTATTCTGCAATTTCACTATGATGAATT
GAAATTTCTTTGTTATTCTCCTTAGGATTTATTAGGCTTTATGAATCTGTGAATTGGTAT
CTTTCATCATTTCCAGAAAATTCTTAGCTATTATCTTTTCAAATGTTACCTTTATGCTAT
TCTTTTTGTCCTTTCTCTGGGTCTTCAATAAATAAACATAAGACTTTTTTGCTCTATCCT
CCTGTGACTCATGACCTGGTTTGTGTTTCTGTTACTTTCTTTTCCTGTGCTACATTCTGA
GTATTCTATTCAGTCCTCTACTTCACTCATGTATTTTTTAAACTGTCCTTTGAATTTTCA
ACTGTCCTTTTTGTGTGTGGGGGGGTGGTGGTGTAGAAATTCTATTTGGTTCTTTTTCTG
TGTGCTTTGTCATTTTTAATAGTTTTTTTGAGGTTCCCTGCACATACTTTTGGCTATGTC
TTTAATTTTTTGTGTGTGCATGATAAGGATATTTGTTTTGTATTTTGTGTCTAACAACCT
AGCATCTGACTGTTTTTGGCCTCTTTCTGTTGGTTCTCATTTATGATGACTTACTTCCAT
CCACGTTTTGTTGTCTGTTGTCTCTGGAAAATTATCAGTAGAAATAATTTGAGACCTCAG
GTGAAGCTGTCTTCATCCAGAGAGTATTTGTCTGTGTTTCTCCAAGTTTGTAGGGTACCA
CAAGTCGTAGACCACTTTGAACTGAATGTATAACCTGAGAGTTATTTGGATTGGTCAGGG
GATATGGTCATAGATGCTTATGAAATCCTGTTTACCTCTGTTTTCTCTTTAACCATTAGG
GTCCCACCTTAAGGTTAGGGGGAAATGCATCAGGCGTCTGCTTTAGGTAGGCTGGGCTTA
TAGTAGCTCTAACCATTATCCTACAGACTCTCACAACTAATGTTAACATTTTCCCAGATC
AAAAGATCTCAGGGAAAGGACTCTGTTGGCCTCTCTGAGTCTAGATTTCTTCACTTCCTC
ATGTGACCAGCTCTTCAGTGACACTGAGTTGTTTTTTTGTTTTGTTTTGTTTTGTTTTTA
ATTTTTTAGATTTTCAAGCTTTTTTTTGAGACAGTCTCACTGTGTTGCCCTTGGTAGAGT
GCTGTGGTGTCATAGCTCACAGCAACCTCCAACTCTTGGGCTTAAGCAATCTCTTGCCTC
AGTCTCCCAAGTAGCGGAGACTATAGGCACCCACCACAACGCCCGGCTATTTTTTTTATT
GTAGTTGTCATTGTTGTCCAGCTGGCCTGGGCCAACTTCAGACCCGCCAGCCTGGGTGCA
TGTGACTTGATACTGTGACCACTGTCCTAAGGGCGCCGAGCCAATTTTCAAGCATTTTTA
ACTGCTGGCAGAAGTGTCTGTCTGGATAACATAGCCTATGGTGAACAGATAACGGATTTT
TATCCTTGTTTTCTTTATTAAACACTGATGTGTGGCTGCCTTCTTTGCATCTAGGACTCT
GTCTGATGGGGGTTTTGTAAACTATTATTTTTCTTTTACTTTTACTTTTCCAGCATTAGT
GGTAGAACCACTATGCCAATGAGACTTTCAGAGATAATCTTCAGTGACTGATGCTCTTAT
CCATTAATAATGTAGAATAAAGCTTCTATTCATGTAGCAAGACTAAAGACCAATTATGGA
TTGCAGATTGGCCTAATTTTTTTAAAGTACTGTATTCATCTGCGGAAAGAAGCTATATCA
GTAAGCCAAATTAATACCGAACTTCAGATTTCATGAACTATGTTCATGAAGAGGCAAAAA
TCTGATTGTGGTTAAGAATCCAGGCTCTGGAGTCAGGCCTGACTTGGTTGGCTGGCTTGT
CACTTGCTGCTTGGCACCCTTGCACTGTAAGTGCCACGAGAACAAGGCAGCGCCATTCTT
ACTCACTGTATCCGTAATGCTTGGCATATAGGAGGTGCTCAATAGTTGAGAATGACTAAA
TAAAGGTTTCTCGGAGGGTGTATAGCATGAAGATTAAGAGCAAGGTTCTGAAGTCAGAAA
GATCTTGGTTTGAATCCTGATTCCTTGATGTACTACCTGTGTGTCCTTCAGCAGATTAGT
TAAGCTTTCCATCTTTAAGTTTCAGTGTTCTCATCATCAGGTTGAGTAATGATTGATTCT
GTCTACCTCATTGGGTTATTCTGAGGATAATGTGAAAATGCATACCCAGCACAGTGTCTA
TGCACATTAAGCCCTCACTGAGTATAACCCCTTAGCTATAAAACTGGGGATGCTGTACTG
ACTTCACAGAGTAGTTATATTAAATGAGCTTAAGTATATGTAGTACTGATCATAGGACCT
ATAAAATTCAGTAGATGATTACTGCTAATATCAGTGGCAGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTGGCTCCCTGGCACACACAGTGAGGTACTAGCAAGGCTTACCTTTAGTGTGTTTAA
GTTTCCACTTGTCCATGGGATCAGAGGTCTCTCCTCAACCTATTTTCCTATACATTATCT
TAGTCGGTTGGTTTTAAGGAACAAGCGCTTTCTTACTCATATTTGAATAAGCTGGGGAAG
TCATAAGACTGCAGCAAAGCATTGAGTTAATTTGAACATGTATTTTCCCTCTCCTTGGAT
TTTAAATAATATAAATGGCTTTATAATTAGTGGGTCGTGGGTTTTGCAGATAGGACTTAG
AAAATCTTCAGCTAAAGAAAATGTATAGTTCTTTTCTAAGTTATTTTAAGAATAATATAA
ATACATGTTTCATCTTTTCAATTATAGCCTTTAAATCTACAAGACAGCAACCCTCTCGAA
ATGTTGCTACCAAGAATTATTCAGAGGTAAGGAAAACAGTTTTGTATTTGTATTTTGCTA
ATGTACGTTCCCTACCTTATGAATTGTCAACTCTTTGATTTACAAAGTAAATTAAAGAAG
AAAAATTATGGAATTTTAAAGCTGGAGAAGCTTTACTAGTTATCTTTTCTGAGGGTTTCT
AGGATTTGGTTTTGTTTTAGGTTTTTTCTTTCATTCTTTTTAAAAATAATAGAGATTCAC
TTCATTAGTAGTCCATAATTGTTATATATACAGTAATATTTTTAAGGATAATAGTGTTGA
ACTAAAAGGGCCATGCGTGGAATACTAATATTGAAAGTGTTTCTCAGAGGGGCACAGTTT
ATTTATTTATTTTTTTTGAGACAAAGTCTATGTCACCCTGCATAGAGTACTGTGGCATCA
CAGCTCACAGCAACCTCCAACTCTCGGGGTTAAGTGATTCTCTTGCCGCAGTCTCCCAAG
TAGCTGGGACTACAGGCACCTGGCTATTTTTTGGTTGTAGTGTCGTTGTTTGGCAGACCC
AGGCAGGGTTCGAACCCACCATCTCCGGTGTGAGTGGCCGGCACCCTAGCCGCTGAGCTA
CAGTCGCCGAGCCAGAGGAGCACTATTGATATTGTGGATCAGGTAACTCTTTGTTGTGGG
GACTGTCCTACATTGTGAGATGTTTAGCAGCATCCTTGGCCCTGGTGCTGTTTGTTCAGT
ACTTTGTTCCTGGTTTCATCCTCATCTGCACTTTAGCTAGATGAAGACTTAGGAAATGTG
CTTATTAAGTATCATGATAATACAAAATGTGCAGAAGTAGTTAGTATTTTGAATGATAGA
ATTGAGACTCAGAAATCTTTATTGAATCTTAATAGTAACAAACGGTATTTAACAAGGATA
AATGTAACAGAAAGATACCTAGTACATTCTGTTACCTCATCTAAAGTTGGAGGTGGAACA
CTGATGGTCTGACATGCTGTCAAAACTCAAGAAGGAGATAGCAGGGCACAGTCTGTACGT
AAGCCTGGGTGAGTCATTCACCAGTCTAACTGTGTGTTCCTTTAGGTAGCCATGGTCCTG
GGATGGCCAGGAGAGAAGTGAGCTAAGACATGTAATAGAAAATAATATTTGTGAATGAAG
AGAGATACTGGAGGATGCTCAGGCTGAGCTTCAGTCGTAATAGTTGCTGCTAACTTGGTT
TCTACCTCCTTTTTGTGACTTTTTTGTATATTTAAAAAAAACACACACACTTTGAGATTC
AATTATTTAACTCATTTTTATTTGGATGTTCCATTCCCAGAAAAACTATTTGTTACTTTG
TGTCCCACCCCTCCCCCCAGGTGATTGAGGTGGATGAATCAGATGAGGAAGATGACATTT
TTCCTACCACTTCAAAGACAGATCAAAGGTAGGTGCAGTGACTTCCTACAAAAAGAATCA
TCTGAAAAAATTTAAAATTTTCCAGAATTTTACAGTTACATGTCTTTCTATGCTGGGTGC
CTCAAGAATGAGCCAGTGGCCCAGGGCACAGACATCACTTTGAAGGTGGTCAGGGAAGGC
TTCTGAGGAGGCTGTATTAGGTTGAAGTTATAAGAAGAGTGACTTGGCTTTGCAAGAAGC
ATGGGAAAAAGCACATGCTGAGTCTTCTTGAGAAAGAAATGAGCTTCATGTAATTTAGGA
GACAGTGATAAAAGCCTGGTGGAAAGGAGGTGGCCTGCGATGAAAATGGAGAGGAGAGGA
AGGGGTGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1020, 2995..3127, 13822..13982, 14536..14623, 25553..25694, 59540..59654, 64739..64924, 66106..66277, 68174..68254, 72125..72251, 76086..76189, 92016..92189, 96439..96501, 104534..104753, 105986..106072, 112407..112465, 113780..113845
1001..1020, 2995..3127, 13822..13982, 14536..14623, 25553..25694, 59540..59654, 64739..64924, 66106..66277, 68174..68254, 72125..72251, 76086..76189, 92016..92189, 96439..96501, 104534..104753, 105986..106072, 112407..112465, 113780..113845
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved