Otolemur_garnettii Locus GNL3
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii GNL3
Otolemur_garnettii
GNL3
GeneScaffold_95
SNORD19
5099..5175
11240
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCTGGGAGC
ACACAAAGCCCCGCACATATCGATGAGGACCGCCCCCCCTCCCGGACCCGCCATGACCAT
ACCTCGGCCCCGCAGTACGTTTCTGTCTTCGCCGACCTCTCGGATTTAGCTCCACGGCTG
CTCTTTAGCTTTACTGATCGCAGCCACTGCCGTCACTCTAGGCACCCGCCGCCCTCTCCG
CCGTCATCCCACCCGGGCCGCTGCAGAACCAGCCTCGAGGCCCCAAAGCGATGCTAGATC
CTCACGACATTGCGTGCGCGCGCACTGGGAAGAACAGCGGCTCACTCTACGGCAGCAGCG
TAATTGCAAGGTGCGTGCCTGTGGCCTCAGTTCTCACGTGGCGCTTGCTGAGGTATCTTG
CGGCTGTTGCTTTTCCGTCTGCTGTCGTTTCCACCGACAGCATGAAGAGACCAAGTGAGT
GGGGTCAAGAGGTGGGCAGAAATGGACGCCTGTCTTGTGTCTCCGAACCCACCAGGGCGC
TCTATCTACTGCTTGGTCTCTGCTGGGGTTGTGGTGGAAGTCTACGGGTAGGCCGCCGCC
TGTTCCCAGGAAGAACCGAGAGCTGGAAGACTTTAGGCCGATCCTTTTAGTCTGATTCTG
TTAACCTCGGGGCTCACTGTGCAGAAGGAAGGCTGGGATTGAGTAGGGAAAAACTAGGCG
GGTTCTTATGAGGAAACTGACTGAGCGGGGTTTCGTGCCCAACCGTGTCCTCTCGGCCGG
CACGTGCAAACCGGCTGAATGCGCCTCCTGCCTTGATTCGTAGCGCTTGTGATCCCATTG
TATTTAGTATGGAAAGAGTGAGTTCTTTGCTGGCCTATTGAATCTTTGGGATGTGCAAGT
GGCACATACGTTTGTATTAAACATCCTGCATGATTCCTTTTTTGTTTGAGGCAGTCTCAC
TCTGTCGCTCCTGGGTTGAGTGCCTTGGCATCGTAGCTCACAGCGTCCTGCAGCTCCTAG
ACTCTTTGCCTCAGTCTCCCAAGTAGTTGGGACTTAAGAACTCCGCTATAACGCCGGGCT
AGTTTTTCTATTTTTAGTAGAGATAGTGTCTAGCTCTTGCTCAGGTTGGTCTGGAACTCA
TCAGCTCAAGCAGTCCACCGCCTCAGCCTGTCAGAGTGCTGGGATTACAGGCGTGAGCCA
CCGTGCCTGGCCCGCACATGATTCTTGATGTTAAGTTTAACAGCCAATACACAGAAAAAC
ATGTGATTCCATAATGGCCTCCCCTAAAACTAAACAGACCAATTGTGTTAGTCCATTTGT
GATGTGTTTCTTTCTAGAGTTAAAGAAAGCAAGTAAACGCATGACCTGCCACAAGCGGAA
TAAAATCCAAAAAAAGGTAAGTGTTAAGGAGAGTTATACCAAATATATTGCTAAACTGAT
CTCTGCTCCACTCTCCTACAGAGGAAGTCTGGATTAATGTGATTTAGTCTTGGGAAATGG
GAGGGATTAGACAGACTATGGGCATAAGTTCTTGGGTATCAGGAGTGCAGCTGTGGGAAA
GTGAAGTAATTTGGTGACAAGATAAACTTCAGAGATTTTTCTAAAGATATTTTTTTTTCA
CTTTGTCCCCCTCAGTAGAGTACTATGGCATCATAGCTCACAGCAACATCAAACTTGGGG
GCTCAAACGATTCTCTTGCCTCAGATGCCCAAGTAGCTGGGACTATAGGCACCTGCCACA
ACTCCTGGCTGTTTTTAGAGACAGTGGTCTTGCTCTTTCTCAGGCTGGACTCAAACTCCT
AAGCTTAAGCTGTCCACCTACCTTGCCCTCCTAGAGTGCTAGGATTTCAGGCGTAAGCCA
CTGCACCTGGTGTTTTTGTTTGTTCGATTTAAAACTGGGTCTCCCTGTGTCACCCTGGCT
AGACAGTGATGTCATAGCTCACTGTGATCTCTAACTTTTGAGCTCAAGTTACCTTTTTGA
TGTAGCCTTGAAAGTATATGGGACTACAAATGCATGCCACCACATTTGGCTAATTTTTTT
ATTTTTGGTAGAGATGGGGTCTCGCACTTCCTGAGGGTCATCTTAAACCCTTGACCTGAG
GCAATCCTCCCTCAGCCTCCCAGAATGCTAGAATTAGGAGCATGTGTGCCCAAGACACTT
TGTTTTATACATATGTATAAATGTTCTTTGTGTGATTCCAATTAAAGCCCCATTTTCCTA
GGACATTTTAATGGCATAATCAAACTGCAGCCAGATTGGTTTCTTAAATTCTGCTTAAAT
AGAAATATTTTTATAAACTGATAACGTTTATTATACTAGGTTCGTGAGCACCATCGAAAA
TTGAGAAAGGAGGCTAAAAAACGAGGTCACAAAAAGCCTAGGAAAGACCCAGGAGTTCCA
AACAGTGCTCCCTTTAAGGAGGCACTTCTCCGGGAAGCTGAGCTAAGGAAACAGCGGGTG
AGTTATGTTAGCTAAAATTTTCAGTGAGTGGTATAGTGGGGGAAGGTGTTTTTTCAGGGT
AAGGTAACAGCACTAATCACTGACTTAAACCTGTTTATGTTACGGGTTGGATACAGCTTG
AAGAACTGAAACAGCAACAGAAACTTGACAGGCAAAAAGAGCAAGAAAAGAAAAGAAAAC
TTGAAAATAATTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTAAAAGTATAAAGTCCTCATTTTCTTATGGCTGAATAAGGGATGCAG
GGGGGGTTTTGTTTGTTTTTTTAACAGTTTCACTCTGTCCCCCGGGTAGAGTGCTCTGGC
ATCGTAGTTCATAGTGACCTCCAACTCATGTGCTCAAGTGATCCTTTTGCCTCAGTTTTT
TATTCTTAGTAGAGACAGGGTCTCATTCTTGCTTGGACTGGTTTCAAACTCAAGAGTTTA
AGCAATTTGCCTGCCTCTCAGAGTGCTAGGGTTACGGATATGAGACACCGTGCCTGGCAT
AAGGGATGCAGTTGTGTTTTTTTGTTTTTTTGTTTTTTTTTTTGAGACAGAGTCTCAAGC
TGTCACTCTGGATAGAGTGCTGTAGCATCATAGCTCATAGCAACTTCCAACTCTTGGGCT
CAAGCTATCCTCTTGCCTCAGTTTTTCTACTTTTTGTAGAGGCTGGATCTCGCTTTTTGC
TCAGACTGGTCTCAAACTCTTGAGCTCCTGCAATCCATTTGCCTTAGCCTCCCAGAGTGT
TAGGATTACAGGTGTGAGCCACTGTGCCCACCCAGGATGTACTTTTGATCATGTCTTCTT
GACAGGTGATTGAAATCTCAGATGTTGTGCTAGAGGTGTTGGATGCCAGAGATCCTCTTG
GTTGCAGGTGTCCTCAGGTGGAAGAGGCCATTGTTCAGAGTGGACAGAAAAAGCTGGTAC
TTGTATTAAATAAATCAGGTGAGCCAAGGGGATGCTCCTTGTTTTCCACATGCACTGGTG
AGGTATGAGGAAAACATCTGAATAGTCTGATTGTCATTGATGACTGATAAGATCCAACTC
TGACCTCAGCAAAGCCAGAGCATGTATACTCCAGTTGTGAAAAACTCTGCTGGGCAGTGG
GAAGAATGTGGGTTTTCAAGAGATTGGACTGGTTTCTACTCTTGCCACTTAGTACTTACC
ATTTTGGCTTATTTTAAGAGGGTAGGTAAGCTTCTATGCCCAATTTACTGTTAAGTATAT
TTCATCTAGGAAGTGGTGACAGTATGCCAAATTCCACACACCTACACAGTATTACGTATT
AACTCAAGAGTGAGATAAATTACAATGGATGTCGGCTCAGCACCTGTGGCTCAAGTGGCT
AAGGCGCCAGCCACATACACCCAAGGTGGCAGGTTCAAATCCAGCCAGGGCTTGCCAAAC
GACGACAGCTGCAACCAAAAAATAGCCGGTGGTTGTGGTGGGCGCCTGTGGTCCCAGCTA
CTTGGGAGGCTGAGGCAGGAGACTCTCTTGAGCTCAGGAGTTGGAAGTTGCTGTGAGCTG
TGATGCCACAGCACTCTACCCAGGGGAACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAA
AAAATTAGAATGGATATGACAAAATATTTAACTGAAATGAATAATTATGTATCAGAGTTA
GAGTGGCAGGAATAGTAACAACCTAAAACCAAGATATGTGAAGCAGGAAGTTTAACTGAC
ACCCCAAATTTTGGGGATTAGGAAACAAATGGTTGCAAGCTGAAAATAAATTCTGGAAAC
CTAAGTCTAGGATTAGCAGGTTTATAATCCAGATGTTGAGTCTGTCCTGAAAAGGTTAGC
AATGCAGGGGGTATTGAAGTACAGGAGTGTAGATACTGAGTTCTGTTAAGAAAAGGGCAG
CATGGTAGGAGAGTTAAATCCTTTTGAAAAATCTAGGAAGAGACAAAGCAGAGAAAAATC
AGTAGCTTACCACAGATTGCAAATTAATCTGTACAAAATGACCAAATTGGAATGTGTGTC
TTATTTCTAATTTCTATCAGATCTGGTACCAAAGGAAAATTTGGAAAGCTGGTTAAATTA
TTTGAAGAAAGAATTGCCAACAGTGGTGTTCAAAGCCTCAACAGATCTGAGGGACAAGGG
GAAGATAACCAAGGTAACCATTACTTTTAGTGGTGAGAAATGTAGTTCCTTTGGATTTTG
GATGGTTGAAATATGATGAGTTTACAAAAGCTTGATTTTAAAAAATGAAAAATTACAAGA
TCCAACTCTGATTTCATCTGGAGATCATCTGGAAGGCAACAGAATTATAGTGATTTTAAG
ACTGAGTACTGGAGCCACATTGTTGGGTTTTTACTGATTTATCACAATAATTATTTGGAA
TTTCAGTATGTGAAGGTAAAGAAGAAAGGTGCTCCATTTCAAAGTAAAGTCTGCTTTGGG
AAAGAGGTCCTTTGGAAACTTCTTGGAGGTTTTCAGGAAACTTACGGCAAAGCCATTCAG
GTTGGAGTAATTGGTGAGTTTCAGTTCATCACTTTTTACTTACATCTTAAGTGTTAAGAT
TCATATTAATGGTGTAAGAGATTGTCATATAAATGGTTTGTTCATATATTAGCTTTCTGC
TTACCTTACCAAAACATAACCAACCGTACACTTAAAGAAGAAACTTAATAATTGCTGCCA
GATTCAATTCTTTGTCAGGAATGAGCACTGAAGAAAGTTGGCTTCTAGAAACTCTGTTTG
AATTAATATTGTCTTTTCTGGCCCTTTCATTATTTGTGCAAGAAATGAAGAAGTTAAGGT
TGGTCTTAGTGTTGATGTGAGGACTGTCAGATCCAACTCTGATCTTGCACTAAACATCAG
GCTAATGTAAAATTAGGCAGTGAAAATTTTTTAACTACCAACAAATAATGGTTTTTGTAT
CTGCGTTCCCATTTATTTGTAGGCTTCCCAAATGTGGGCAAAAGCAGCATCATCAATAGT
TTAAAACAAGAACGGATATGTAATGTCGGCATATCCATGGGACTTACAAGGTATGTTGAG
CTCTTCCATAATTGGAATGTTTTGTTTGTTTATTTCTTTATTGAGACAGAGTCTCTTAAT
CACCTCAGTCACAGTATAGTGATATCATCGTAACTCAGTGCAACCTCACATTCCTGGGCT
CAGAAGTGTTCCTTCTGCCTCAGGCTCTGAATAGTTGGGACTATAGGCACATACTCAGAT
AACTTTTTCTTTCTTTCTTTTTTTTTTTTTGAGACAGAGTCTCAAGCTGTTACCCTTGGT
AGAGGACTGACATCACAGCTCACAGCAACCTCAAACTCTTGGGCTTATGCGATTCTCTTA
CCTCAGCCTCCCAAGTAGCTAGACAATAGCGCCCACCACAATGCCCAGCTATTTTTGTTG
TAGTTGTCACTGTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGACTGACTGTGCTGAGTTTGTTC
AATCCAACCCTGAGCTTCATGTTGTCTCGCACTCCAGATAAACCCATGCCCCATCAATTA
TTCCATCTCTTCTTTCAGGAGCATGCAGGTTGTTCCCTTGGACAAGCATATCACAATCGT
AGACAGCCCATGCTTCATTGCATCACCACTTAACTCCTCCACTGCACTTGCTCTGCGAAG
CCCAGCAAGTATTGAAGTGATAAAACCAATGGAGGCTGCCAGTGCCATCCTGTCCCAGGC
TGACACTCGACAGGTAAAAGAAATCTCTTCTCTTGAGCTCCTTGCCACCATTTTGTCCTT
TTTATCATAAACATTTTAAGAAGAAAATTTTGAATTTCTTTTTAAGATAGCATTATGAAA
AAAATTTTTTTTAGGCTCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCCACGTACAC
CTAAGGGGGCGGGTTCGAATCCCCAGCCCGGACCCGCCAAACAACAATGACGGCTGCACC
CAAAAAATAGCCAGGAGTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCAGAGG
CAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGCCACGGCACT
CTACCCAGGGGGAGAGCTTGAGGCTCTGTCTCACAAAAAAAAAAAAACGTTTTTTTAATC
TGTACACTAAGATCAGGTGAATGATAATTCTTGTTTTGAATTTTTTTAAGGTAGTACTGA
AATATACTGTCCCTGACTTTAAGAATCCGCTGGAATTTTTACTAAGTTTGCTCAAAGAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCATTCATTGACAGACCAGTCAAGGTCATATCTGTTTACATGGG
CTTTGTTCATTTCCTAGCTATCAGGGGCCCTCCTTTGGCCAATAGTATCCTTTTCCAATC
TTCGGGTATGACAAATGGAATAATAAAAGAAAAGGACATATGTGAAGAATTGCCAAAACA
TAAAGAGAAGAAGCAGGAGAAGAGAGAGAATGATGAAGACATGGACAGTGACCAGGAAAT
TGTTGATCAAGAATTATTTAAAGCTGAAGTAAGTTTTCTAGCATTATAATGTATAATGAA
TGGGAAGGGGCAGAAGGTAGAAATTAAATAATTTGTAATAAACTAAAAGAAGCCCCATAC
AATTTAATATTTGAGGCTTGTGATCATTAGCCTTACTTTTGCATATCCTGTTAACATACG
CCTTCAAAGACATGATTTTCCCAGATACATGATTACTTGGATTAATGAGTAGAGATAAGC
TATTAGCCGGCACTGTTTTTTGATCCCACAGGAAAAGACCTCAGATACATCCCCTGCAGA
AGAGACATGGGAAGAACTGCCTGAGGAGTCTATAGCAGGTGAGTCTAGAGCAAAGAGCTT
CTTCTAACAAAGAAGCATGGTTTAGGATCGCTCATACTTTTTGAAAATAAAATTTTATTT
TATTTTCCTGCAATATAGGTGAACAGTCTCCAAGATCTTTTATCTTTGATAAAGTGACTC
AAGAGGATGAAGCTTATGACTTCAGTACAGATTATGTGTAAAAATGTCCTTTTGTGAAAG
GTTATAACATTGTAAGTAGATCGTGAAACATGCATTTGTTACAGCGTGACATAAGCTATG
TAAATTTTGTGAGTGTTATAGTTATTAAATTAGAAATACCGATTCATCTCTGGGTGGAAA
TAGTTATCTGGAACAAAAAAAAGAATCGCATACCTGTTGAAAAATGTAGGTTTATTTACA
GATGGCCATACGTAGTAACAAAACCAAATAGCAGTTTTGAACTAGCTGTACCAACCTGAC
TGAACTACCTTTATCAACTCTTACCAGTCTTCTTTTGGTCATTCAGCATTGTGGTAAGAA
AACATTTGGTAAGGCAGATGGAGACATTTATAGTCTATCTGGAAGCCAGACAGGGCAATT
TGTCATTTTTTCCCAGCTGAAACATCTTTTTCCATGGGTTGTTGACAGATAAGCATTGAA
GGCTAGCAACTGTTATTTCTCACACATGCTGTCTTGCAGAATTTCCTGAGAAATGAGTAT
AGTTTAAATTCTATTTCATTTTATGTTTGAGATCTCCATGTATCTTCGAATTAGGCTGAA
TTTGCCTGTTGGGTCTGGAATATACCATTTTTCCCAAATATCCATATATGAAGCAGTCCT
CCCCCATGGCTTAAAGTGTCCATTCCAGTGGAGTAACTTGGCAGCCTTTATAAACTGGGG
TGAATATCGTTTTCCAGCACTGGAACCTTATAATTCAAAGAAAAAGAGCCAAATGATTGT
ACCAGTCAGACACAATATAGTGCTGTGCCAAATTTTGCAGAAAACTTACAAGGAAATGTT
TTCTGCTTACCAAGGTGGCGGACGTTCCACATAGGGTCAATAGTGGAATGCTGTTGATAA
AATACGATAAGTAGAGGAGGTGTCGTAATGCTGCCAGCCAGTGATCTGCTATACAATCCC
TCTCTTGGTGGGACAGATAACATATGTTAGTGAAGAATACTATCTCTTGTTCATCAAAAT
TCCCAGACTTGAAATACAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1877..1935, 2859..2996, 3116..3229, 3740..3823, 4925..5057, 6140..6252, 6486..6612, 7042..7129, 8358..8532, 8990..9034, 9037..9131, 9246..9382, 9557..9732, 9991..10057, 10158..10240
1001..1013, 1877..1935, 2859..2996, 3116..3229, 3740..3823, 4925..5057, 6140..6252, 6486..6612, 7042..7129, 8358..8532, 8990..9034, 9037..9131, 9246..9382, 9557..9732, 9991..10057, 10158..10237
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved