Otolemur_garnettii Locus NUP54
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii NUP54
Otolemur_garnettii
NUP54
GeneScaffold_2500
SNORA19
5054..5161
27145
AAAACTGACAATGAGTTACAAATAATAATAAAACAGTTTTAGATTGGCTAGCATTCTAT
TATGTAAAGTTAGATATGGTTAAGCTTAATTTCATCTCTAGACTCCCCTAAAAATTTGTG
TGGAGTTGCTAAACTGGTACAGAGGCCTGTGGTGACTCTGCTCACCTTCCTGCCACTGCC
TCCACTTGTGTTTTTTTCCTTTATCTCTTCCTTCAAGAAACACATTCTTGTTGTATAAAG
GTAAATATATTGGTACGTTTCCTTTGAAAAGTTACTTAGTCTTGACACAGGCTAAGTAGA
AATGTAAGCTAATGTAAATATAAATTAATTTGTCAAATCCAAGGTTGCCAACTGGTGACA
AGTCTGCCAACATGATATATTTGGCATAGTATTTTTAAATCATTTGAATTAGTTGCAAAA
ATTTTTATATTTAATTTTAATATTTGACTTAGGGTTTAAAAACCAATAAATTATACAAAG
AAAATCCAGCATTGCTATTTCTCTTGGGGGGAAAAAACAGAAATATGTGACATTACTACA
CTACCACTCTTCCATAATTTAGGAAGTGCAGCTATTTTTTTTAAAAAAAAACTGCTTTCT
TTAAATACTTCCACCTGTCAGTAAACAGTATACTCACTAATGTTATCAGTCTAAATTTTG
TAGACAATTGAATTTGCAATCCCTAGTCTAAAAGTTAAGTTATTTTAGACTTAAGGCAAT
AGGCTTAACATGTTTTCTGGGCTGTTAATATTAATCACTGCTCTAGTAGAAGAAGATATA
TAGCTTTGTGATATTCCTATCTTTAATATTTAGTCACTTATTTCTTATAACTATTGACAT
CATGGTTAGTAGTATAGTTTTTTAAAAAAATTGATGTTGAAAATAGAGAAAGGAAAAATG
AGATAACTATATTTGTCTAATTACATATTATTTGAAAAAGAAAATGCCTTCATGTATACA
AAAAATTTTTCTTTTCCATTTATATCCTTTTTTAATTAGGCGGGTTTGGAGGATTTGGGA
CAACATCTACAACTGCAGGTTCTGCATTCAGCTTTTCTGCCCCAGCTAACACAGGCACTA
CTGGTAAGAAGCCATCTCAAGTCATTTGTAGAAGTAAATGAGGTAGAGGTTAGTTGGTGT
GTTTTTTTTGTTTTGTTTTGTTTTTTAACTTATACAATTCCAATTTTTCCTCCAAAGGAC
TCTTTGGTGGCACTCAGAACAAAGGGTTTGGATTTGGAACTGGGTTCGGCACAACAACAG
GAACTAGCACTGGCTTAGGTACTGGTTTGGGAACTGGACTGGGATTTGGAGGATTTAATA
CCCAGCAGCAACAGCAGCAAACTAGTAAGTATGATGTTTTCATCTTCAAGTATAAAACTG
TAGCAATAATAGCTAACATTGAGTGTATTGTTTGAAATACTTTACCTTTTTTTGGTTAGA
GTTATAAATATCATATTCCCAGTGATTTCATTAGCTTCTTCTCATGTGTTTGTATGATAG
CAGTGGGAGAGGAGACGAATGGTCCTGATTGGGATTGTAAGGTCTCTTTGTTTAGGATCA
TTCCCCTTAAATTTTTGTTAAAAATAACACAGAGAAAACTTTGCAAAGTACAGCTGAATG
AATTATTTACTTTTAACACCCTTGTAACCATTGCCCACATCAGGAGATGGACCCTGCCAC
TTTGAAGTCCACCACTATTCTCTTACCAAACACTTTCCTTTCAGCGGAACTACAGTGCTG
TGTTTTATGCTGATCATTTCCTTTTCTTTATAATTTTGTCACTCAGGTGTGTAGATATTA
TTCAGTTTTGCCTGTCCAGCTTCACTATAGATTCCCCTTTTATCTCTCTTAGTGATTTTT
TGGAGAAAGCAGATCATTTCTTCTATAGTGTGTTTCAGTCGAGACTACATTCCTATTGTG
TAGTTTAGCATATTCTTCTGTCCTCTGTATTTCTTAATAATTGGGTTTTATGTAGGGGCT
TATCACTATTGATAATTTGGTTTTTTGTTTGTTTGCAAAATTATTGTATAGGTATTGTGT
TCTTTATCAAGAAGCATATGCCTGTTTGCCTTTTGTGTGTGTGAGGTTAGCACCCGTTGG
TGATCATTACCTGCTGCTTCACTTCAGTTCCTATTCCATTTATTTGCTGGAATACTTCAA
TAAAGAGAAACTTCACCTCATCTGTTTAGTTGATTCTTTCCCTTTTTACTAGTTTTCAAA
ATAAAGAGTTGGTTGTCTAGCATTCTCCAAAGGTAATCAGGTTTTTTATGTCAGTACTCA
AGCATTTAAACTTTTTTTAAAAAATCCATTGCATTGTTTTTATTTATGCTTAAGTTATTC
TATCTCAGGCTAGTGTAAGCCTCTTCAGGTTGGCTCCTGAGTCTCTTTTGACCCAAGTCT
GGTATTAGTCTTTGATGACTTCCTTATTAGCTGGTATGGCTGTAGGTTCCAGGGCTGATG
TTGTATGGATTAACTTACTAATTCTCAGAAGAACTCTGTGAAATAGCACTGTTGCTGTGT
CCATTTTGTGGATGAAGAGAGGAAACTAAGAGATTGTAACTTATCCATATTCCTCTCAGG
AAGTATAGGGACGTGCATTCAGGTTCCTTGACTCCCTGTGTAGTGCTCTCCTCACTTTTC
CACAGTCTGGTACCTCTTAAAATCCCTTTCATTTATTTATTTGTTTGTTTTTAGGTAACT
TGATTGCTAAATTCCATCCTACTTAGTCATTGAAGATTAATAATGAAACATGAATTTCAA
GGATTACCTAATCAATAGGATAAAGAGAATAGAGTAGTAGTCTCAGAATTCTTTCTAGTG
TCCCAATCATTCTTTTTTTCCTATAATCTTGCAAAAATTACGAAGTTTAATGAAATGCCC
AAGTAACAAAGAGAGGAAAACAAAAGTGAATTGCTTTCCTTTGTTTCTTAAAATAAGGTC
TCTCCAACCATGAGCAGTTGTAGTTTCACTTTTGTAAAAAAAAAAAAAAAAGGAATTTGA
ATCTGGTGCTGTTACAGAAATGGAAGGGGCTCATTCAGTTATGTTGTAGCCATTTATGAG
ATATATATATAATATGTCAGGCATTGGGTCATACAAGGTTGAAAACCAGCATCCCTGATC
ATAGTCTACAAGGAGATTCCAGGGTATTCTAGGGATAACATTGACAGAGGCATGGATTCA
TGGCAGAGCATAAAGCATTTCGGACCTGCAGCTAGGTCAGTATAGTTTTAATGCATCAGT
GACCTTAGGGCCAGTGGTGAGAGCTAGATAAAGGAGATATGAACTAGCTTATAGGGGGCC
TTGAGTGTTTTTGTTTTGTTTTGTTTTTTGAGACAGAGTCTCACTATGTTGCCTTTGGTA
GAGTGCCGTGGTATCACAGTTCACAGCAACCTGTAACTCTTGGGCTTAAGCGATTCTCTT
GCTTCAGCCTCCCAAGTAGCTGGGACTACAGACACATGCCACAATGCCCGGCTATTTTTT
GGTTGTAGTTGTCATTGCTGTTTGGCAGGTCCAGGCTGGATTCGAACCTGCCAGCTCCAG
TGTATGTGGCTGTCGCCCTAGCCGCTGAGTGACAGGTGCTGAGCCGACCTTCCATGTTTT
AATAAGGAGCTGTCGTTTAAGCAGTTGTGAACCATTGTGGGATTTACGCTAGACAGGAAA
ATTGTCAGATTTTTAGAACTGTCTGAGAGAAATAGAAGGATAAATTAGAAATAGAAGGGT
AGGTGGGCTGGAATGGAGGCAGGGATACTAGTTCTGATGCTCTTGCCAAAGCAAGATATA
GTGAAGACCTGAGTTAGGCAGAGGCCGTCAACAGTAGAAACAAAGAACAGGAGATGGCGT
TGAGGGAGATGAGATGTAAGTTGCAGAATCAATAAAACTTAATGACTGGGTAAAGGTGTT
TGGGCTTTTGGATTGCATGACTGACTGAGCTCCTTGCTTTTCCCTACGACCCAGAATACC
AATGTAGGAACAGGTGTTTGTGGATAGATAATGAGTTTGAGCTGCCCCTCACTGTACTTT
TATGTGTGGGTAGGAGCTCGGGAGAGACTTGAATACCTTAAGAGTATTTAAAGCAGTCAA
CTTGAATGATGCCATTTAGGAGACTTGATTCCAGAGCAAGAGAGAGGAGAGCACTGGAAC
AAAACTCTTGGAAACGCAAACATTTAAATGAAGAAGCAGAGGAAAAGAGCCCATTTCTTG
CTACCATGCCCTATCTCCAAGCCAAGTAGGATATTAGCCCCCTCATATAGAGTGCCATGC
TTAGGACCATTGCCTGCCCACAACACGCACATCCATCCATGTGCATCTTGTAGCTCATTA
GCTCCCCTTTTACTCATCACAGTTATACACCTGTCTCAGTTGGCAACACCTGTGGGTCAA
AGAGGAAATGACATTCAGCTTTCCCTGCTACCACGAGACCTCCTTTCTAAGCCAAGGCTA
ATTATTCACAGTACTCCAAAGACTGTTGAGACACTTGGTGCGCTTTCCTGCCTTCATAGC
TCTGTCCTGCTCCCTTAGATTCATGGCTTCCATGTCAGTCACTCTTGCCAGCATGCTAAA
TTTCTGGGTTTTGTACTACATTGCCTGAAAAAAAACCCAAGTCTTTGTACACTCAACTGT
ATATTCAGGTATTGCGTGAGAAAGTCACACATTATGGAGAATGAACACACCTCTGTAAAT
TCTTCAACCTCAGGCCTGAACATTGCCTGGTAATCCTGTTAAGTCTCTGTTTTAAACTTA
CTCTCCTACTTTCTGTAACAGTTACTTTAAACCTTTAGTCTCTTTAAATCTCAAATATTT
CTGTTCTCACTTTTAGCAAATGGCCTCAACTCTGCTTCAAAGAGAAGATAGACTCCCTCA
TTGCAATTCCTTCAGATTCCCACTGTGAAATCTTTCCCTTCCTCCCTTCTAACCACCCTC
TTTTCACCTGTGCTCAGGAAATCATAACCTCCTACCTTCTTTGGACCCTTCTAGCTATCT
TTAGTTTCTCTCCTCAGTGGTCATTTTCACTTGCATTTAAACAACCTGAAATTTCTTTTT
TCTTAAAGTGGTAACAGCAAGAAAAAATGACCTTGTTATTTCTCATGTGCTATACAGATA
GTTGAAGGTTAATTAGCAGTATAACTATAAATAGTAATGCTGCCAGTCTCCTTCAGACAA
GAAACTTTATAGAAAGTGGTTAAATGTATTGGGTAAATAACAGGTCTTTATCTACAAAAG
ATGTGACCATTTAGGTTTTTTGTTTTGGGAAACTAAGATTTTAAAAGGTATGTTTGAGGG
ATGGTATAATCCATGTATTATGGTTTAGAGAAGTCTTTGGAGTTGATAGCCTGGAATTCT
AATTCCAGCTTCTGCAATGCTCTGATTCTCTGAGCTTCAGTTGTTTTCTTGAAATAAAAT
GGGCATGAATTCTGCTTGCCATGACTGTCATGACATTGCATATAAAAAGTGCTAAGTAAA
TAGTGGCTGTTACTAACCCTGTGTTTTCTATGAAAAAAAAAAAAAAAGAAAAAATGACCT
TAATCTAAGGTGACCAGATTTTAACATTGGTAAAGCGGGACACCATTGGCAGGGCGGGGC
CTGACAAAGATGCAAAATTTGATAAGCAGTTTTCGATAATCACTTCTCAACTATTATTTG
TTATTATTACAGTTTAACATTATAAAATTAACAAAAATAATATAAAACTCATATCCTGGC
GAAATAGCCAAATGGCATCCGAAAACCGTATATTCCCTTACTGTTCTCCCGCCTGTTCGT
GCATTCTTTCCAAAAATCGGGACTTTTTAAAAATGCTGCGGGACGCAGGACAAATTGTTT
AAAAAGCGGGATGTCTGGTCACCCTACCTTAATCTCACATTTCACTTTGACTATTACTCT
TCACAAACTACTTGAAATAGTTGCTACAGCAGAGTAGGGTCCCCTTCTTACGTCTCATGT
TACTTCTAGCCCATGCTAATCTGGTTTCTATTTTCTGTACTCTATCAGGTAGTTAAGGTC
ATTAATCATTTCATTAAATCTAGTGAATATTTGCTGTTCTTTAATTATGAAAAATTACAG
CAACAAAAAAAGAACAGGCTCGGTGCCTATGGTTCAAGTGGCTAAGGCGCCAGCCACATA
CACCTAAGGTGATGGGTTCAAATCCAGCCCAGGCCACCAAACAATGATGGCTGCAACCAA
AAAATAGCCAAGCGTTGTGGCCAGCACCTGTGGTCCCAGCTACTTGAGAGGCTGAGGCAG
GTGACTCACTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCTACAGCACTCTA
CAGGGTGACAGCTTGAGGCGCTGTCTGAAAAAAAAAAAAGTTTCCAAAAAAAGAACAGTG
AAATGAACACTATAATGTCCACCAGCTAGTTACCAAAACTCAGCGTTTGCCATCTTTGCT
ATTATCTACTTCCTCTTTCCCATTTTTTGATTGCTGGAATACATTAATAGCAAATCTCAA
GCAAGTCATTTTCCCCTTACTTTACTTCTTTCTTTAAAAACGTGTATATCACTCCAACCC
ACAATAATTCTTTGGTATTACCTAATACCCAGTCTAAAATCAGATTTACCCATGTGTCTC
AAAAATGTTTTCTTTTAGTTTGAATAATGATCCAAACAGGATCCACACATTGATTTTCTT
GCGATATTTCTTAAAGTTTATTTAGTATAGAAATTCCCCATTCTTTTTTTTTTCCATCAC
ACATTTCCCAGGTATCCTGTGAAATGTCTCCCATTCTGGATTTTTCCATTTGCTTCCTTA
TAGTAGTCCTTAACTGTATCCCTCATAATTCGGGTAAGTGAAGTTACCTTTAGGGATTTG
GTTAGATTCATGTTTGACTTTTTGGCAAGAATACTTTTCAGGTGGTGCTGTGTGCTTCAT
ACCACATCACAGTAAAAGGCTGTATCACTGTCAGTGAGGCTAAGAGTGATCATTGGGTTC
AGATGGTGACAGCAGAGCTCTCTTTTGTAAAGTTCTCCGTCAACCTTTAACTTAATGGTT
TCATTCTTGATGATCATTGCCTCAGTTATCAGGAGTTGCAAAATGGTGCTTTTCTAATTT
CTTCCTTTACACACTGAAATTCTTCTGTAAACGGAACTTTTTCTTTATCACTGCATGATC
ACCCCATTATGTAGTTTGTGTAAGAAAGGCAGGATAAATTCTTTTTAATTGACAATTTTG
TAAGAGAGAATGGCCTCATTATTTCTAATGGTATCCAAGAGTTAGCATAATTCTGATCTT
CACTATTTTTTTCCTTTGAACACATTTCACTCTTTCACCCTGGGGAGTTGCAGTGGAACA
ATCACTGTAAACTCAAACCCCTGCACTCAAGCAGTCCTCTTGCATCAGCCTCCCAAGTAG
TGGGGCTACAGGTGTGTGACACCATGCTAAGCTAATTTTTAAATTTTTAATTATTGTGTA
GAGATGGGGCTTGCTATGTTGCCCTGCCTGAACTTCTTGCCTCAAGTGATCCTCCTGCCT
TGGCCTCCCAGAGTGCTGGGGTGATAGATTGAGTCATTGAGCAAGACCTGATCTTTACTT
TCAAAAATTACCATTTGGAATGCATGGGCTTTAATAAATATGTCATTTAATTGCACTCAT
TATTCGTTTTGATGCTCACCCTGTCACATTTTTGGCCAGTGAGAGACCTCAACTGCCATG
ACGCCCTAGTCTGTTTTTTCTCCCTTGTGTAGTACTCCTTATCGCCAGCCCGTCTTTCCC
TGCACTTCACAGGGATTTTTCACATTCTGTTTATCTTCCCCATACGCCACGGCCAGGCTG
ACTACTGTCTTGTCTGAAGTTCTAACGGGAAGCTTTCTTTTGACCCCTCTCTCAGGCTTG
ATTAGTTCCCTTACTTAATCCTCTCACAGTCTCTGTGCTTTTCTAGGAACTTAGCACAGT
TAATATTTGTCTGATGCGTTTGGTTTGTTTAGTGAATCTTGTCTTGTACACCACTGTATC
CTTAGTATTTAGCTCTATGCCTGACATTTAGCAGGTACTCAGTAAATATTTATTGCATGA
ATGAAGGTGAATGAATGTTTTTATATACAATAGAACCTGTAGCTGCCTCCTCATACTCAC
CACCTCCTTAAGTTGACCTGATTTTCACAGACCAGATATGCACCACATAGACAAATCAGT
ACAGTAGTCCTCATTGACCACCTCTGTGTGCTGACTAGCTGGTTACAGTGCCTAGGGTGG
GCAACTTACAGAGGTTCTACTGTATATAAATAAAACCAAGAGAGACTTTATTGTCAGGAA
ATCTAAGGGAGAAGGGCTTTGCAAGGAGAATGTATATTCAACAGAAGTTGAGGATTTCTT
TTGGGGGCGAAGGAATAATCAACAGCCCAAGAACCCTAAGAATGTGGGTAGGTGCAAGAC
ATCTAATGCACTAAGCTGGAAAGAATCTGTGTTGAGTCTTGTAATGTGAGTTCATCGGTG
ACTTCCAGCTGGTGAACTTGGAGTGGATTAGTATGGTCATAATTCAGTGTGGAATTAAGT
AGAAAAGGGGAGGCTGAATATAAATGGTAGATTATAATTAATCATCTCATTTAAAAGTTG
AGGAAGATAGAGCCCAGGAATTTCTTAAACATCTAGTGCAGTGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGTTGCTTGATAGCTATAATTTCAT
GTACTGGGATACTTACTTTTAGTCACACTTTGGGAAATATTTTAGCTGCCCTAAGAACTT
TGCCCTCCTTTCCATTGGAGAAGTTTATTATAACCCAGGGCCGTTAAGTGACTTGCCCGA
AGTTACACAGCTATCTAAAGCTTTAGCCTAGAATGCTGAAAGTTAGTTCATTTGTTCTTT
TCATTATGTATTTTTTTATAATAGAAAAGTATAAGCTGGTTTTGATATAAGACTTTTTTT
ATTTTACATCTCCCAATTTATATTTACTGTACATATATAAGATCAATAAATGTTTTAAAA
AGACAAACTCCTACAGTTTCACAAACTTTACTTTTCTATGTTCATATGCATGCCTTTTTT
CTTCTTTTTTTTTTTGGAGTAAGTTAACATTTTGTATCTAATTTGTGTTCTGGAATTAAC
TGCATTAAGATAGCATCATTAGGAAAGCAAGTTTAATATTATAAGGTATATCCTAGTATA
TTAGGTTCATATTGCTACAAATTACCACAAATTTAGTGGCTTAAGACAGTAGCAATTTAT
TATTCTATAGTTTTTGGAGATCAGAAGTCCAGAATTGGGTTTCATGCAGCTAAAACAGAG
GTGTTGGTGGTACTTTGTCCTGGGGGCTTTAGGGAAGAATTCATCCTCTTGCCTTTTCCA
GCTTCTCGAGCCTCCCTGCGTTTCTTGGTTTGTGGCCCCCTCCATCTTTACAGAGAGCAG
GATGGCATCTTCAAACCTCATTTTGACTTGGAGTTCATTCTTCCACTTGTAATGACCTTG
TGATTATGTTGAGCTCACGTGATAATCAGGGTAACTGCCCCATCTCAGCATGCTTAATCA
TGTCTTCAGAGGCCCATTAGTGATGTAAGATTAACATATTTACAGGTCCTGTAGATTAGG
ATATGGACATTTGGGGTGCCATTATTCTGCCTACCTTGTCTATGATTTGAATTAAGTTTG
GGGTTTTTAAATACTAATTTTGGGTGCATTTTAGCATTAGGTGGTCTCTTCAGTCAACCT
ACACAAGCTCCTACCCAGTCCAACCAGCTGATAAATACTGCGAGTGCTCTTTCTGCTCCA
ACGCTATTGGGAGATGAGAGAGATGCTATTTTGGCAAAATGGAATCAACTGCAGGCCTTT
TGGGGAACAGGAAAAGGATATTTCAACAATAACATTCCACCAGTGGAATTCACACAGGAA
AATCCCTTTTGCCGATTTAAGGTAAAAAAGTGTGTGTAAGAATATGATATTTAGATTAAA
ATAATATCAAGGAAACAATTGCTTGGCTCTGTAGTACTCCTTGAACATAGTATGATTATA
CTTTTTAAAAAAACATGGAAATTATAAAATCAAAGTCTTTTTTTAATAAATGTGTGGTTG
AAAATAACTAGAAATTGACTGAAGAAAGGTGTGACTTAAAACTGAAGAGAAAACGTTAAC
AGAAGGGGAATGATCTGCTTGGCTCTGACACAGTGGAGATCTAAAACTAGAATTTAGAGG
TATTCGTTTACTGTTGCCCAAGAAAGCATACCCTACCCAGTGGACAGGAATCTTGGCATG
TATAATCTTTTACCACTATTAAAGCTGGGCCTAAAGTCATTAACACAGTATAGCCCATTT
TCTTTGGTCAAGTTCCTACTAAACAACCTTCTCATTTGATTTGACTCTTCAGAAAATCTA
TTCATCAGCTATTGAGGGTATTTAGGTCCATTTGGAGAGGGATTATTTTCATAATGAATT
AATGTATTGCCCTGTGTCAGTTGCCTTAAACCTAATCATTGTGTCTATAACCTATGTCTT
GTAGCTTCAGGGCCTGAGGAGTAGAGCCTTGAACAATGGCTAAACAAAAAGTGGTCAACC
TGTCTTGTTCAAAAATCATCTCTTTGTCCTATCACTCTGACAACACGAAAGTCTATCTTT
TAAAGGGATGTACTTGAATTTTAATAGTATTGATCAGCGCCTTAACCATGTCAAAAGCAG
TAGGACAGAGTTGCAAATGGTGATGCAAATGTTTTTATTTTTTAAAAACTCGGGTATAAC
AGGGATAGCGGAGAAGGCAAAAGGACCACTGACCAAATTTAAAACTTATTTTACAGTGCA
TATAAATGGTGACAAGGGATGAAAGGATTCTATATAAAACGAGCAGTTCTTTAGAAAGGT
ATAGTTGGACATAATGTGAAACGAATGAATGTATGAAACAAACCTGTTTCACACAATTTT
ATATTACCTGAAACCATAAAATGATACATTCTTTACAGTATTTCAGTATTATGTGTGAGC
CACTTCTTTATATATCTAACACCTAGTTTAAGATTCCATGGATCAGATATATGCATGCTT
CTTGATTTATAATGGGTTTATGTCCTGATAAACATAAATTGAAAATATTGTAAGTTGAAA
ATGCATTAAATATACCAGATCTATCTTAAATGTGCTCAGAACACTTACATTAGTTTACAG
TTGGGCAAAATCATCTAACACAAATCATCTATTTTATAATAATACAAATAATTCTGTAGT
TTAAAAAAGTAAACATCAAAATTCAAAATATGATTTCAACTGAAATGTATATTGCTTTCA
CATCATCATAAAGTAGTAGAATCATAAGTTGAGCCATCCTAAGTCAGAGCTTTCTATATA
GTGAAATAAATTATATTTAGTCTGTACTTTTTGTAGTCACAATGACATAGGCAGTGTTGA
TTTTCTTTCTCCCTTCTTGTTTTTCTTTTAGAGGTTGGGATCTTGCTCTGTCACCTAGGC
TGGAGTGCATTTATACTCTATAGCTCATTGCAGCCTCACTCCTGGCCTCAAGTGAAATAC
TTGGCCTCTCAAGTTGCTGGGATTATAGTCTCAGAGTTGTTTCAGCAGTTCAGAAACACT
TAGTAATAATGCCCATCAAAATTTTATAGAGGAGAAAGCTCTTTAGTTGCTCTCTTGGAA
AGGAAACCCCCCCCCGCCCCCCCCCCCCCGAGACAGAGCCTCACTTTGTCATCCAGGCTA
GAGTGCTGTGGTGTCAGCCTAGCTCACAGCAACCTCATTTGCTGGATTCCAGTGATTCTC
CTGCCTCAGTCTCCTGAATAGCTGAGACTACAGGTGCCCACCACTGTGCCTGGCTACTTT
TCTATGCTTAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAAAACATTGCCAGATGATCAGTAAGTATACATTAATATACTGTTTATTTCTG
TGCCCTAGTCCAAAGATAGGGATCAGCAGTGTTTTTGTTGCAGAAGCACAAATTAAATCT
CAGAGCAGAATTTTTTTCTCAGCTAGTGCTTATTCAGTACTTATAAAAACATGTATTCAA
AAGCTTTTTTAAAAAAATTGGATTTCTTACTAGATGCTAGTAATTTCTTACATTTTCATT
TACAACCTTGAAGAAAACATTTATCATGGCTGTGTGCAAATTGAGGGCCACAGAAAACAT
TATTGGGAAGTTTTAATAACTGATTAACATTCATGTTCATTCATGGATAAGTAGGATTGC
TTTGCTTCCCTTTTTCTATGTATAAGTCTGTCTGAGTGGCAAGACGTTTACTGTGGGGTA
CTTAGGGTTGGGAATACTTTATTAATGATATATAATGATGGAATCAGATTTTACTTCTTG
GACTTAATTGCAAAGGAGCAATCTCAGAGTTTTAAACGAATCTCCAAAGTACTTTTCAAC
TCTGGAAAATGTAATAAATAATATTTTTATATGACTTTGCAACTAAGCAAACTCTTTTAC
AAATGTTATTTACCTCCCTCATTTTAACTTTATCATTTGATTTATAAGTGAACATAACAT
TAAGTAAAGGTTTCTTATTTTCCAGTATTTACAGAGAAAATATTTTTATTCCCTTCTAAA
ACAGCCATTTTTTAATTCATCTTAAACCCTTCTAAGATCACATGCTGCTTTGAGATTTGT
GGCCAAGAGTTATGTGCTTCATATTTAATAAATTGGTTATCTTTCCTTTAGGACAGAAGT
TGTCATTTATGTTGTTGAGCGTTCTCCAAATGGTACTTCAAGAAGAGTTCCAGCTACAAC
TTTATATGCCCATTTTGAACAGGCTAATGTAAAAACACAATTGCAGCAACTTGGGGTGAC
CCTTTCTATGACTAGAACAGAACTTTCTCCTGCACAGATCAAACAGCTTTTACAGAACCC
TCCTGCTGGTATGTTTCAAGAGTCACAGAGTTCAGGAAATGAGAGATTTAGAACTAAATG
TTCCCTGGGAGATGGTGGTTTGTTAATGTGAATAAAACTAGTGTCAACTTTTTACATGCC
TACCTATTTAGGATAGTTTTGAATATTTGTATGAATTCAATTAGTTTTATTTATTCATTT
ATTTTACTATATAGCTAATATGTTTATTAGAAATTTTGAGAAATGATGAACTAAAGTGGT
CCGTAGTCTATAATCTATCTACCCAAAGGTAATTCACTAGTAATATCTTGATTTCTTTTT
TCTAGCTTATCTCTTGATTTAAATGGAAATTCAAATAAAACTTAGATGTGTCTGTATTGT
AAAAAAATTCTGGATGGCATATTTAGATTAAAATAAAGGGGATATGATAGATCCCCTTTA
CCTCCCTTCCTCAGAAGTAACTAAATAATTTATGGTGCTCTGTTAACCCTTTATCTATGG
TTTTAAATATAAGCATATTTCCATGTCCTTTAGCAAAGGGTTCTGCACTGTGCATTTACT
GCACTTTGCCTTTTTACTCATGTTATTTCTTAGTACTTTTCATGTTAGTACATGTAGATA
AATCGTAAGCTTTTACATAGTATTCCATGGATATACCTTCACTTCTCAATTATTTCTGTC
TTTTCACTATTATAAACTAACATTAATACAATTAACATTCTTGTAAATACGTTTTAGAAT
ACATGGGTAAGGGTATGTATTTCTTTAGAAGAGGTCTCTGGTAATGAAGTTTTTGAGTCA
ACATTAAAAGTACTGTCAAATTGTCTTTCAAAGAAAGTTGTACCATTTACATTCTTAACA
GGAAATATGTTCTTTTTCTTTTTTTTTTTTGGTCACTGATGGCAAAATAATGAGTACTTG
TTTTAATTTCCACATCCCTGATTATTACTAAAGTTGAACATCTTTTTCTGTGTTTATTAG
CTAATGTTTGTATTTTGTGTGAATTACCCATTGGTTTCCTTTGCTCGTTTTCTATTAGAT
CTTTTATCTTCCTTTCTGATTTATATTCTCTATCTTATAGGTTATTGATACTTCCTTTCG
ATCTGTGCTTTGAATTTTCTACAAAAATGTGTATTTTTATAGTGATCATATTTGACTATC
TTTTTTCTTACAGCTTCTGGGTTTTGAGTTAATTTAGGAAAGCCTTTTCTATACAGATTT
TATAAAAATAGACAATACATTTTTTCTTTATGGTAGGTGTGGATCCTATTATTTGGGAAC
AAGCCAAGGTGGATAACCCTGATTCTGAAAAGTAAGTATCTCTTCATCTTATTTTATATG
AGAACTAATACTTGCTACTAGGAAGCCAAACAGATGTGAATTATTAATTGTAATTCTTAC
ATCAGAGTGAGTTTGTTTTCATTTGCATTTCTGATAAGGCAGCATAGTATAGTGAGAACT
AAGAATATGGAAATCTGAGTGCCAGTCCCCTAATTACATTGCATTTAATAATGCAGGACT
TTTTGTGTTTTTATAACTTTATTTGCTGTATCGGACAATCACCAGTTCTCAACCACGTTG
ACTATTGATTTTTCAAAGTGGTAATAGGTACATAGTAACCAAAGTACAGAGCTTGTTTGG
TGAATCTTCATTTTCATTGTTTTCTGACAACTGCACACAGATACCGTATGGGACGTTCCA
GCCAGCTTTGTTGAGCCTGGTATCAGTGTGAACATCTAGAGCCCCCATCTGTTTCATGGC
AAATTTCTAGATCTCTTTGAGTGACCGAGAGACACATTTCCTGAAGCCCACTCCATGGAT
GGGCTTGTGAATGTTGATGGTGTATCGAGTTACCACTTCATTGATGGCAGAATGGGGTGG
TATCTCCCCCCCTCCCCTTCTTTGCAGGAGCCATTCTGCCAGGCCCAAATTGCGACCGAG
AAGAGATTGTAGGGATTCAATAATGCAGTTTTTTGACTAAACNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTTCTACTATGATGAGTATTCTGCTATTCTTGGGTAGAGTTTTCTATTAATGTC
AAGGAGATTTGAGATCCAGTGGTTGATAGTATATTTAGTTCTATATTCTTACTGATTTTC
TGTCTACTAGTTTCATTATTGAGAGAAGTATCCAGCTGTAGTTCTGGATTTATCTTTTTT
CCCCTTTCATTTCTATTTTTGCTTCATGCATCTTAAAGCTTTGTTGATAATTACATATTT
ATCAAGGATTATTACATTTTCTTGGCAGATTTACTTTTTATGTAATGTCCCTTTTTACTA
CTAGTTATTTAAAAAATTTTACCTGTCCAGGCACATGGCTTACACCTGTAATCCTAGCAC
TCTGGGAGGCCAAGGCAGGTGGATTGCTTGGAGAATCACAAGAATTGGAGACCAGCCTAA
GCAAGACTGAGACCCTGTCTCTACTAAAAATAGAAAAATTAGCTGGGCATAGTGGCCTTC
ACCTGTAGTCCCAGCTACTCAGGAGGCTGAAGCAAGAGGATCCTTTGAGCCCAAGAGTTT
GAGGTTGCTGTGAGCTATGATGCCATGGTACTCTACCCAGGGGACAGAGTGGGACTCTCC
CTCAAAAAAATAAAAACTAAATAAGTAAATGATACCTAATGGCTTTTATTGTTATTTTAA
TTGATACATAATAATTGTACATATTTATGTGGTATGGTGTGATAATTCAATATATGTATA
CAATGTGTGATGATCAAATCAGGGTAATTAGCATATCTATCATGTTTAACTTCATGTCTT
TGTGTTGGGACTCTTCAAGATCCACTCTTATAGCTACTTGAACATACACAATAAATTGTT
GTCACCCTGTGGTGCTCAGAACCCTAGACTTCACCTCTCCTATCCGGCTGTACTTCTGTG
TCCATTCAGCAATCTTTGGCTGTTCTCCCTCCCTGTACCCTTCCTTGCTTCTGCATGTGA
GTGAGAACATGTGGTATTTTTGTTTTTGTTGTTCCTGGCTTATTTCACTGAGCATAAAAT
CTTTTAAGCTTCCATGTTGGAACAAATGGCAGAATTGTGTGCCCTTTTTTTTCATAACTA
AATGGTATGCCGTTGTGTATATTTACCACATTTCCTTTATCCATTCTTCTGTTCCTAGAC
ACTATTCAGATACTTGCTCTGAGGTCTACTCTGACATTTACATTCCTTTCTTTTGATAAG
TGTTTTTGTAGTATATGCTTGTCTTTTTGCTTTCAATCTACTTGTATCATTATATTAGAA
GTATGCTTCTCTTTTTTGTCACCCTCGGTAGAGTGCTATAGCGTCACAGCTCACAGCAAC
CTAAAACTCTTGGGCTTAAGCGATTCTCTTGCCCCAGCCTCCCAAGTATCTGGGACTACA
GGCACCCAAGTATCTGGGACTGCAAGGCCCAGCTATTTAGCATTCCATTTTAATATATTA
TCATTTCAACTTTTAGTTTGCTTTTAGTGGTTGCTCTAAGTCAGTAGTTCTCAGTTGGAG
GTTGTGGTGATGGTGGTAGTGGTGGTTTTGTCCCCCAGAGCACCTTTGGCAATGTCTGGA
GACTCTTTTGGTTGGGGAGGGCCATGGCATCAAGCGTGTAGAGGCCTGCATGCTGGTATA
CATCCTGCAGCATACAGGACAGTTCTCGTGCAACAAAGAATTATCTGGCCCAAAATTAAT
GGTTCTGAAGTTGAGAAACCCTTCTCTAGATATTACAAGGTATCTCCTCCACTAGAACCA
GCAGGCTTCTCCTGGGGTGCTCTGTTAGCTTGTAAGCTCATGTCCAGGTCTAGAGCTGGA
CTGAAACCAGACCAAGGATGCCTGAAGGGAAAACTGATAAACTTCCCACCAGGTCAGTGG
TATTTTTAATTCACATCTTCTTCCCCGGTCATCCTGCCATGGTTTACTTTTCTGAGTCTT
CAGGTAGCCATTCAAGTTTTCTGGCTATATTTAGTGGGAGAGTGTGTGTGGCATGTGCTC
AGTCTATCTTGTCCAGAGCTGAAATCTTTCATATTTTTTGCCAATCTGTCTTTATATATA
TATAGTTTTTCCAGATTACTATGAGGGTACAAATGATTATGTTATACTGTTGGGGTTTGC
TAGGTAAAGTTCAATTGTGGTTGAGCCCTTCATCCAGGGGGTGTGCTGTATACCCTCGCC
TTGTGCCCATTAGGTGAGAACTCACGAATCCTCCTCTTTTCTCCCCTCTTCCCTTTCCAT
CCTCTCCCCACCCCCCTCACTTGAATTTAATTTTGTTTTTCACTCATGTGGGGATGTAGT
TTATCTATTGGTTTCATGTTAGTATTGAGTATCTTGGACACTTGGTTTTCCATTCTTGTG
ATACTTTACTAAGAAGAATGTCTTTCAACTCATCTAGGTAAATACAAAAGATGTAAAACC
TCCCTCTTTTTTATGGCTGAATAGTATCATGGTATATATACGCCACAGTTTATTAATCCA
TTTAGGGGCCCTAAATGGGTTGATGGGCATGATTTTTCTATCATGCTTCCTGTCTTTCTT
CATCAACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCTGATTGGAATGCTTTAAT
GAAATGGTGAGATTTTACCTATTCTATAAGATTTAGACCTCATAAGACAGAGCAGTGAGA
TTTTAGGCCAGGCAAAAAGCAAATCAGAGATGCAAAATTGTACTTGGCTGTATAATTAAT
ATCATTCCTTTCCATGTCCACTCTGCTTACTCTCTCGAAGTATTGGCAGTAGTTAGATTT
AGGACTAATTATCCACTAAGGCACCCTCTGGATGTTACCTTACAGATTTGAACTTTTTTT
CATTCAGGCCTAGTTGTTGGCTCTATTCTGTAACATTCCAATTCCTTAATTAATTCTGAA
GTGTATGTTTTATTTTTTCTATACATTGTCTCAACTTAAGCTTCGTGGAGCTTTAAAGAA
AACTTTGAGTTACACTTTTAAAATTTTGAGGTATATAAAAAGGGAAGAAATATAAAAGTA
GATTTAAGGAAAAGGGTTTATATTTTAAGGGATGAATCTCTGGCTTATCTGAAAATTAGA
CTGCATATAAGTGTACCTGCTAAATATCTATGATGTCTATAATTTATTTACCTGAAAAAT
TATTTTTCTTTAAAAAAACAGATCATATCTGAAGATATTAGTGAGCTACAGAAGAATCAA
ACTACAACTATGGCCAAAATTGCACAGTACAAGAGGAAACTCATGGATCTTTCCCACAGA
ACCTTACAGGTAGTGGTTTGGAATTTTTTCTTAAATATTTATAAGATTACACATACAAAG
TATATGCTAAATATAGATTATTAATACCTAGAAGTTGGAGGTCTCTTGGAGGTGGGTGAG
GAGAGTACAAATTTTTTAAGTTAATCTAATAGAGAATGAGGGATAGCAGTGAAGAAATAA
GGCCTATTGGTGTGAGAAAAAGCATGTATTGAGATCAGTGATAACCGGCTTTCATAAAAT
TGTAGAAAATCATTTTTTTTTTGAGTGCTAGAAAAATGAGTGTAACTATAATGGTTGAAA
AATAATATAATTTCCAAATTAATGAGGAAATCAAAGGATGAATAGCATCAAAAACAGAAA
TTATAAACTTATCATCAAAACAAATATTATATATGAGAACCAGTGGGACACAGAAAAAAC
TGTACTCAGAGGAGAATTTATAGCCAGTAAAACAAATCTTTGTTGTAAAAAGGCTATAGT
AGGGTGGTGCCTGTGGCTCAAGGGAGTAGGGCGCCAGCCCCATATGCCAGAGGTGGCGGG
TTCAAACCCAGCCCCAGCCAAAAAACTGCAAAATAATAATAATTATATCGGCTACCTAAA
AATTAGAAAAGTTTGTGTAGCAAAAGAAACCAGAAGCCATTTGTCAATAATCATGTGATA
AGAGTTCAGAGAAAGGAAATTCTGCAAACACCATGATTTTAGCTGTAGCGTTAATACTCA
TATTATATAAAAAGATGCTATAGTTTGACAAGAAAACCCAATTGAAGTGTGGGCCAAAGA
TGTGTAAAGGCAATTCACCAAAGAACAAGTGCAAGGTAGTTCCTTTGAGGGGTGGGCTTT
TTTTTTAAATTCATTTTTGAAAGAGAGTCTAGCTCTGACACCCAGGTTAGAGTGTAGTGT
TCTGATTATAGCTCACAGCAGCCTCAAACTCCAGGGCTCAAGCAGTCTCTCAGTTTAGGT
GCATAAATACTACCACACCCAGTGAATCTTTAAAAATTTTTATAGAAATAAGGTCGTTGC
CCAGCCTGGTCCTAAACTGGCCTCAAACCATCTCCATGTTGGCCTCCCAAAGTGCCTCAA
AGTAGTTTTTAACCATTAAAAAACGCTCCTTTAACATACTAGGAAACAGGGAATTGCAGA
TTAAAGGGAAAAAAAAAAAAGAAAGAGAGATCTTTTTAACTCACCAGGTTGGAAAACTTT
TAACCACCCCCTATTGCTGGGCCAACTGGTTGGAAAAGAGTATTCTCATATGGTGGCTTG
TGAATCTTAATTGTTCAGATTTTTTGGGAAAGCACCCTAACAGCTTTTATTAGAACTGAA
TACATTCACACATACTTTAGAACTTGGCTTCATTCTCAGGGATATATTCAAGTAAATAGA
TAGTGTATAAAAATGTTTATTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGATGTTTTTTGAACTATCAATACATTTCTTTTAGA
ATTAGTGGTTGTTAGCAGTTATAATTTGACTCAATCTTATTTTCAGGGCCGACTAAATGA
ACTGATGTCCCAAATCAGGATGCAGAACCATTTTGGAGCAGTCAAATCAGAAGAGAAATA
TTATATAGACGCAGATCTGTTACGAGAAATCAAGCAGGTGAGTTGTTGCATGAGGGCGCA
CTTGTAAACTGTGAGTTACCACTTCTCGTCTACTAGGATGACTTACCCCCCAAAAAAAAA
AAGTATTAGTGAGATGGTGAAGAAACTAGAACCTTGCACTGTCCTGCAACTGTAAGAAGG
TGAAGCCACAGTGGTTCCTCAGTAAATTAAAAATACAATTACCACATGATTTAATATTTC
CACTTCTGAATACCCGAGAAGGTTAGAAGCAGGGACTCAAAACAGATACTTGTACAAGTT
CATAACAGCACTATAAAAGCCAAAATGTGGACATAACCTGAGTCTGTCCAAGGAATGGAT
ATGGATAAACAAGGTGGTATAGACACACAATGGAGATAAGCCTTTAAAAAGAGGGAAGTT
CTGACACACACCTGCATTGCAGAGCCCTTGGAGATGTTATGCTAAGTAAAATAAGCCAGT
CATAAAGGGACAGATACTATTCAGTTCCACTCATACGAGGTAGAGTAGTCCACTGATGGA
GAGAGAGTAGATGGTGTTTTCTGCAGGGTAGGGAGGAGGGAATGGGTTGCATTGTTTAAT
GGATACAGAATTTCAGTTTGGGAAGATAAAAAGTTGTAAATGAAATGTATAGTGGTAATT
GTTTCACAATAGCATAAATGTACTTAACACTGCTAACCTGTACACTTAAAAATGGCTAAA
ATGGTCAATCTTTTGCCTACTTTACTGTAATGAAAAATGTTAATCATCCGCCTCTTCTAA
AAAAGACGTCTGTAGAGGTAGAAGAGGCACCGAGGTGTCCCAGACACTGCTACTCAGAGA
GGAGTCAGCAACAGCTGGGGAGGTCACCAGAAACAGAAGTTTAGTCTTCACTGCACTGCT
GCTCAATCTGCGTTTTTTCAAGATCATAGAGTGATTTTTGTATGCATGTGAAACTTTGAG
AAGCAGCTGTTCTAGATCAGACCTTTCCAACCCATGTACCACATATAAGTTATAAATATA
TATTGAGCTCCTTAGCCCTAGGGACCTAAGTGGAGGTTGGAGTGCCTAGAACCTCCCATC
ACTTATTTAAGGCTCACTTTGCATGAAAAAGTTGGGAAACACTGCTTTGGCTAATTTTCA
TTGGTATAGGAGATGACACCATTAAGTTTGTGAATTTATCCCAGAAAAAGTGCTACATTC
CTCATTGCTATTCATCATAATGGTCACCTTTGAGGTCCTCCCCTTAGGAAGCTATGAATT
GATGCCAGCACCTACCTTTCAAAGCAGTTTTTGCACTCTTTTTTCCAAATATTAAGTGTT
AAGTATTCCAAGTAGTAAGATGGTAACCTCTGTGGAACACATTAGGTAGGACTGTTGGCA
TGACCCTGAGGATTTTAGGTGGTTATAAATGTCATCAACAAACCCAAATTTGTTATGTAC
TGGGCAATAGAAATTACTGTTTTATGCAGCTAAAACCTAGTTTGGCCTCTGCATTCTTGG
AAAGTATACATATATTCAGTCATATTCCATTTTTAAGTATGTGCAGTAAAATTAACTGAG
AGATTTTGGCACATTATAATAAAGAGCTATATTTAAAAGGTTTGTGTATGCAATAAAACT
GGGAATAATATAAAATCACCTTTTTAAAACGATGAAAATCAGTATTTTATTTGGAATGAA
TCATAGCTCACCATCTATTTTATATCCTGGAGCAGGTTGCTTACCTGTGTCTCAGTTTCT
TTGACTTTAAGAGATGATGATGGTACCTCCCCCTAAAAAGGTGCTGGAAAGGATTTGAAA
TGACTTAATACCAATAAAGCTGTTACAATAGTGCCTCAATCTGTAAGAAGGACTCTTCAC
AATGTTAGCATCTGTACTCATCATCACCATTATCACCACCATACAATCTGTATCAAAAAC
AAAAGGCCAGGGGCTGGAGGAGCACAAGAAAAATTAGCCAGGTGTGGTGGCAGACATCTG
TGGTTCTGTCTCTTCATCAGGAGGTTGAGACAGGAGGATTGTGTGAGCCCAGGAGTTTGA
AGATGCGGTGGGATGTGATCATGCCACTGCACTCCAGCCTGGCAATAGAATGATACCCTG
TCTCTTTCAGAAAAAGAAAATTTTCAGTTTTCAAAATGATCATTTTACTAATCATCTAGA
TGTAATAGTAGTTTTTTTTTAATCAAAGGAATAGCCATCTAAAAAACATTGTTGAAGATA
CTGTTCATTTTATATTTGATTTTATTCTTTAGAGTATATCTTTTACTGTGTTGTACATTA
GCAAAAGATGTCACACAACTATTTAAATATGCACGGCTGCTACATTTAGAGCAGTTACTA
GCTGTTGTATTGCTAATAAAAGAGTACTTTTCTTGTGACTAGCTTACAGGTTAATAGAAT
AATACGTTAACTTATATATTTTTAAAATTATTTTTAGCATTTGAAACAACAACAGGAAGG
CCTCAGCCATTTGATTAGCATCATAAAAGATGACCTAGAAGATATAAAGTTGGTGGAACA
CGGATTGAACGAAACAATCCACATCAGAGGTGGTGCCTTTAGTTGACATTCACAGCCCTG
AGTTAGACGTTTGCGAACTGCTGCTGCTTCACTACATCAAGCCTTCCTTAAGATTGAAAC
TGACCACATGGAGGGGAAAAAAGGAAAAAAAAAAAGGAAACAGTTCTCTCCTGGCTTGGT
TTTTTGAGGAGGTTACTGACAAATTATTGTTCATCAACTCTGAAATAACATAGTCACCTT
ACAGCTCTCCAGAGAAAACCATTGAAAGATTTATATCTAAAAGCTGTACTTTAAAAAGTG
CATAGTTACCAAAAGTTTATGTACTATTGTACATTTTTACAATAGCATTTTTTTAAACAT
AATCAGTGTTTAATGATTATTTGTCCATTGAACCTGTACTCTGCTTTCAATAGCAAGTAA
ATATAAGACATCTACTTTGCATAAACTGTATAATTACTTGACTGTTGGAGATTTGTACAT
CAGAATATAAATGGACTTCAGTTTTTATATTTGTGAATTCATTTGTGGGAGGAGTAAAGA
AAATCCAAAAGTATTTAATGATTAATGTGGTTTTCTTTTTGTTCTATAAAGATTTGAAAA
TATATTTTTATATTATTTTACTTATTTAGAATTTACAGAACACACACCTAAGCAATTAGG
GTATAACAATCACCATTTTTGCTATTTTTTAAAAAAATCTTTATTTCTAAAAAAACCATA
TAAATAAATTCTTTATTTGTAGTTTTATATAATTCTGTCTGGTGCTTTATTTGGCTTTTG
GGGAACCACCATTTCTGTCCATGTAGTTACTAAATTTACAATTGCAATCACAAAACTCAG
GAATTTGTCTTCTTTTAGGCTTTTTTTTCCTCCTAAGGACTTTCATCAGTGCTCATATAT
TTTGACTATGGCAAATAAAACTTACTTCAGATATCATCTAGTATAAAGAATTCTCTACTG
TCTTTAGCATTCTAAAAACTAGAAAATCTAGTTAAACATCATAACATTAAAATAGTAATT
TCTTAAACAACCAGATCAAGTTAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1082, 1197..1343, 10174..10400, 12500..12687, 13491..13687, 14916..14970, 16177..16270, 21081..21188, 22945..23064, 23506..23616, 26017..26145
1001..1082, 1197..1343, 10174..10400, 12500..12687, 13491..13687, 14916..14970, 16177..16270, 21081..21188, 22945..23064, 23506..23616, 26017..26142
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved