Otolemur_garnettii Locus RPL4
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPL4
Otolemur_garnettii
RPL4
GeneScaffold_4037
SNORD18, SNORD16, SNORD18
2425..2496, 3440..3538, 3913..3984
6910
CATGCCACTATCATTACAAGGGTGGCTCAGAGAGTCACTGTCTTGACTAGACTAGAAAT
AACAGTATCTCACTTTTGGGAGACAGCAAGGCTTTAAACAGGTGTAGGGAGGAACATCTA
GTTTTCCACATCCTGAGAGATGCCTCTACTGATGACAAGCGTGTGCAACGGCAGACACCT
TCGGAACACTTGTCACCTTCCGCTGTGCCGGATAACGTACAGATATTGTCTCCTGAGACT
ACACAGGGGCTGGGAGAGACAGCCGGCCTTTCCCCAACTCCTGGGCGCCGGCAAAACGCT
AATCCCCAAATGCGGCAAAACACCCGCGGCGGAGATCGAGAATACTCAGATAAAGAAAGA
AATGCTGTCCCCGGACCCCAGGCAAGAGTAGGGATTATAACTCACTGCAGTAGGCGCGAG
TAAAACTCCTCGGCCGCTCGGTTCACTTTGTCCCACATACTGTCCCAATCTCAGAGAGAT
CCTGGAACCGCCAAACTGAACCGCGCGCCGGGCTAACGACGTCCGGGGTCATAACCCCGC
CTCGCCGGAACTACTTTTACCTCCAACCAGTCTCATTTGTCAGCAAATTTAAACTTTTGT
TTTAGACCACCCAGAAATATTCACAGTGCCAATAGTCTTCCAGCTGTAACAGAAAAAAAT
TAAATAAGTGTAGAAGCTGTTGAAGAGAGACACTTTGTCTCGCGAGTACTGGTCACACCC
CCTTACGGATCATTCCACGAAAAGGAGTCCCTCTTTTCTAAGAACTATTATTGGCTTTGG
GAGACAATAGATACGGTAATTTGACAGGCATAAAGAAGTGATACACTATTCTTTGTTTTT
GTAGTGTGGCAGAGAGATATTTGTGTCTGCGGTGGTTCTGAGGCGGGCAGAGTGGGAGGG
GAGGAGTTGAAGGTTACATATACAGCAAGAGTGATAAGCACTTCCTTTTCCTGTAGGAGC
CACCGGGTGGAGAGGAGCGTGGCCTTCTCCCTCTCCCCGACATGGTGAGTGCAGGGTCTC
TCGGGTGGACTTTCCGTTGGTCTTGGGGCCAGTAGGGAAGGGTTGGAGGTTCGGGACATA
TAGCCTGGAGGAGTTCAAGCGAGGAGGATGGAGATGAGGACCAAAGGCGTCTTTTTCTGG
TCGGGAACCGGGTTGTGCGGTGTTACGGCAGCCATCTTAGAAGCAACGTGGGAGTCCGGG
TCCACGGAGCTCCGGGAAGCAGCACTAGGCAACACTGGATCATTCGCAGATGCGGGAGAG
CCTGTACTAGAGCCTTCCCTGCACCCTACCAAATGTTCTGCTGAAATATTTGCAGTCCTT
TGGGGCTTAAGCGAATTGAAGAAAGGAATCAATTTGGGGCCTTGGTCTTCATGTGCTGTT
TAAAAATGTGTATGTCCGTCTTTCAAGAGAGGGATTTGTTAAGAGAAAATAAACACTTCC
CTTTCTACTTTTTCCTGAGTACTCAGCTATGTTCAGGTTAAAAATGATCTCTACGAAAGT
TACGTCTTTGCTAAAGTATTCTATTTGGTGTCATCTAGATCTTCAGCTAGCTAATGGTCA
TGGTATCACATACATTGCTTTGCCACAAGTAGCTATATTGTGTTTTGTGCCTGGGCAGAA
GAACGAACAAATCACAAAGTAACCCTTAAGATATTTGGATTGTAGTGAAGTTGGACTAAA
TGAATAGTAGCGTTCTGTGGTAATAATTGCTGTGGACAATCAAAAATTTGAGTGGTTTGA
CCTCAGAAAGTTTAGGAAGTGGCCTGAAGGTGAGGACTTGTGAGAAGAGAAGCTTTAAGG
TGAAAACCTGCCAACTCTTAGGCATGAGGGAACAAGGGAGTATGAAAGATGAAATCGAAG
AGGAGAGCAGATTTGTGTAGGTCATCGTTGGGAAGTCTTTTAGAGTTGACCAAAAAATAA
CCAGTGTTTTGAAACACGTTTAGAAGAGGGTAAGGACAGGGATGTAAGCTTGGATGCATA
CAGCCTTGGTAGAAAAGATGGGCAACTTTTATGACAAAGCATTCATTGAAAACAATGAAA
ATAGTGTGATAGCCTGAGAGTCTAGGTGTTCTTTGAGTGTAAGGTGTAAGTAAGTTGTCT
ACCCCATTATGCTAGTCTTTTCTATAACTGAGCATTTAATGGTATGGTTGGCAGATGGGA
GGAGTTTGCCTCTAATATTAAATATCCTTTTTTTCTTTCCCAAGGCTTGTGCCCGTCCAC
TGATAACAGTGTACTCTGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCTG
TCTTCAAGGCTCCCATTCGACCAGATATTGTGAACTTTGTTCACACCAACTTGCGTAAAA
ACAACAGACAGCCATATGCTGTCAGTGAATTAGCAGGTAAGGGTTTATGTCTTTGTACAA
GTTGATAGTTTCAGGGGCTGTTTTACAGTAGTGATGAAATTGCACTTCATTGGTCCGTGT
TTCTGAACCACATGATTTTCTTGGATGTTCTGATGCTGTTTACTGCTGTGTATAATTATC
ATAGGTTGGTATGATAAGTGAGCTAAAAGTCTTATTTCTTTACAATTTTAGGTCACCAGA
CCAGTGCTGAGTCATGGGGTACTGGCAGAGCTGTGGCAAGGATTCCCAGAGTTCGAGGTG
GTGGGACTCACCGTTCTGGCCAGGGTGCTTTTGGAAACGTATCCTTGTTTCCTGAGATTA
GTTGTCCCATGGAATTTAGCAAGCTAGTTTATCCATGTTAATATAGTTTATACTGAAAGT
GTCCCAGTTACGAGATTGGGAATCTGAATGATGTTTATTTTTTTAATCTTGAGGTTGTTC
TTATTTATTTATTTGTTTATTTTTGTTTTTGAGACAAAGAGTCTCACTGTGTTGCCCTCA
GCAGGGTGCCATGGTATCATAGCAACCTCCAACTCTTGGGCTTAAGCGATTCTCTTGCTT
TAGCCTCCCAAGTAGCTGGGACCACAGGCGCCCACCACAATGCCTGGCTATTTTTTGTTG
TTGAAGTTGTCATTGCTGTTTAGCTGGCCAGGCCCAGGCCAGGTTCAAACAACCCACCAG
CCTGGGTGTATGTGGCCGCCGTCCTATCTTGAACTTCCTCTTAAAGGCAGTCAGTTTTTT
TTTTGTTTTTTGTTTTTTTTTGAGACAGAACCTCAAGCTGTCCCCCTGAGTAGAGTGCCG
TGGCATTATAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGC
CTCCCAAGTAGCTGGGACCACAGGCACCCACCACAACGCCTGGCTATTTTTTGGTTGCAG
CCGTCATTGTTGTTTGGCGGGTCCAGGCTGGGGATTCGAACCCGCCACCTTAGTTGTACG
TGGCTGGCGCCCTAGCTGGTTGAGCTATAGGCGCCGAGCCGAGCCGGCAGTCAGCTTTTA
TTCACATGTGGATGTTTGCTTGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCACAGC
GACAGTTGCCTGCTGTCAGTAAGCTGGTACAGAAGGTTGACGAAAATTCTTACTGAGCAA
GACATAATCTTTTAATTCCTCAAATTTGAGTAATGTGATTCTTAACTGAGAAAATAGATG
TGTCGTGGAGGCCGCATGTTTGCACCAACAAAAACATGGCGTCGCTGGCACCGAAGAGTG
AACACAACCCAAAAGCGATACGCCATCTGCTCTGCCCTGGCCGCCTCAGCTTTACCAGCA
CTTGTCATGTCTAAAGGTTTGTAATATTTTGTGTCAGGAGTGGTATAAAACATCTTTTTT
CACCTGGCCCTTTTGGTTTGTAATTGGTACATTCTGCTTATCCTAGAGTGTCTGATAAAT
TTCCCATTATTAGGTAATGTAAATAGTGGTGCAGTATATAGCTAGAAAACTTTTTACTTA
AAATGCTCAATTGTCAAAATGATGAGATTCCACTTCATTGGTCCGTGTTTCTGAAACACA
TGATATTTGTGGAAATTCTGAATTGGCACATTGCGTACCATTTTGCTTTTGTGGATATAC
AAAATGTCTCTTTGCACAGGGTTTGGGGTAACCAGTTAGTTATTGATTTTGCTTTTTTAG
GTCATCGAATTGAGGAAGTTCCTGAACTTCCATTGGTGGTTGAAGATAAAGTTGAAGGCT
ACAAGAAGACCAAGGAGGCTGTTTTACTTCTTAAGAAACTTAAGGCCTGGAATGATATCA
AAAAGGTAGGTTTGATGGCAATCACCTGTATGGTTTGGTAGTCTTTGATCCATATAAATT
TTTGTTATTTTGAATCTTAAAACTGAAATATGAAGGACAGTATATATAGCCTTAGTGTAA
AAGATAGCAAGGACTTCAGAGCCAGATTAGATTGGTTTGAACCCTAAGTGCTTTTGTGGC
TGTGGCTCTGTGTAACCCTGGGCAAGTTATTTGTGCACCCCATCATCTGTAAAGTGGAAT
TTTTTTTTAAAACTGGACATCTATTGCAGAAATCTTAATGAGGGTACTAAACCTGCTTTT
ATAGGTCTATGCCTCTCAGCGAATGAGGGCTGGTAAGGGCAAAATGAGAAACCGTCGTCG
TATCCAGCGCAGGGGACCCTGCATCATCTATAATGAGGACAATGGTATCATCAAGGCTTT
CAGGAACATCCCTGGTAATTATAGTGTTTACATGTTAATTGCCTGTCCTGTGCAAGCTTA
GTCAGCTTTTATGATGAGTTTCCACTTCATGGTCCGTGTTTCTGAGACAGATGATTTTGT
GGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGATGAACTGTATGGCA
CTTGGCGTAAAGCTGCTTCCCTTAAGAGTAACTACAAGTGAGTATTTTTTTCATGTACTG
AAAATAGATGTTTATACACATTCAGGATTGGTTCTCATGTTTTGTAAATAGTATTTTTTT
TTTCTATTTCCCCTTATGTATAGATGGAACATAGTGATACTCTACCTCATTCTGAAGTGA
TAATGTGGAAATGATTGAATTCTGGAGAGTATAGATGGTTAAAAAAAGTAAAGCCTTTCT
GGAGGTTCACGTTCTTTAACCAAATATATGGGAATCTAGACATCCATTGTCAATTTTTTT
TCTTTCAGCCTTCCCATGCACAAGATGATGAACACAGACCTTAGCCGAATCTTGAAAAGC
CCAGAGATCCAAAGAGCTCTTCGTGCACCACGGTAAAGTTGATATTTACAGTGTAGCTCT
TGCCCTAACCATAATACCATTATTTCAAAAACGTGTGTGTGAAAATGTTAATACAGTGTC
TACTGTTCATGTATAGCAAAAAGATTCATCGCAGAGTCCTGAAGAAGAATCCACTGAAAA
ACCTGAGAATCATGTTGAAGCTAAACCCATATGCAAAGACCATGCGCCGGAATACCATTC
TTCGCCAGGCCAGGAATGTAAGAGATGATTTGTTTTTTACCAATATATTAAGTTCTTGGA
AAGACTTGATTGTTAAATGATTCTGCCTGATTTGTTACAGCACAAACTTCGGGTGGATAA
GGCAGCTGCAAGACTACAGGCCAAGTCAGATGAGAAGGGGGTTGCAGGCAAGAAGCCTGT
AGCAATGAAGAAGGGGAAAAAGCCTGTTGGTGTTAAAAAGCAGAAAAAGCCTCTGGTAGG
AAAAAAGGCTGCCTCTACCAAGAAACCAGCAGCTGAAAAGAAGCCAGCAGAAAAGAAACC
TACCACAGAAGAAAAGAAGCCTACTGCATAAACTTTTAATGTTTATTCCATAAACGTCAA
ATCATATTGGACAGTTTATTTTGAATAAAGACCTGAGCAAAGAGTCAGTGAGAAATATGG
CTTGGGGTGTGTTGTGTGAGTCCAGGTTAGAATTTAGTTTTTAGAGTGGCACCCATGGCT
TAGCAGGTTGGGTTCCAACCCCATATACGGAGGGTGGCGGGTTCAACCCAGCCCCAGCCA
GCTAAGACCACAGTGGCAACTGCAGCAAAAAAAAAAAAAAAAGGCCTTGGGTTCTGGTGG
GTGCCTATAGTCCCAGCTACTCAGGAGGCTAAGGCAAGAGAGTTGCTTAAATCTGAGAGT
TGGAGGTGACCTTTGTGAGCTGTGACACCATGATACTCTACCAACGGCAACAGAGTGAGT
CTTAAAAAAAAAGCATAAAACTCTACATTCTATAATCCAGATATATAATGGAGCCTTGGA
TTTATGATAAATCTATGCAGTGGAATGGAAGGGTTTTCTTTTTTTTGAAAGTCTCACTGT
GTCACCCATGGTAGAGTGCTGTAGTATAATAGCTCACAGCAACCTCAACTCTTAGGCTTA
AGTGATTCTCTCGCCTCAGCCTCCCAAGTAGCTGGGACTACAGACGTAAGCCTATTTTTT
GGTTGCAGTTTTTAGCAGGCTCGAGCAGGGCTTGAACCCACCTAACGTGTTACACAGCTA
TCGTGCTACTCACTTGCTTTTAAAAATTCGATAAGATCCATTCGGTAACTCAGTGTTTTA
AAAATCATGCAGGCTGTTAAAAATTGGCTTCCAGGCTCGGCGCCTATAGCTCAACCGGCT
AAGGCGCCAGCCACGTACACCTAAGGTGGCAGGTTCGAATCCCCAGCTTGGACCCGCCAA
ACAATGACGGCTGCAACCAAAAATTAGCCGGGCGTTGTGGTGGGCGCCTGTGGTCCCAGC
TACTTGGGAGGTGGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGC
TATAATGCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2204..2375, 2571..2677, 3597..3735, 4080..4204, 4504..4633, 4860..5016, 5288..5371, 5476..5596, 5680..5910
1001..1003, 2204..2375, 2571..2677, 3597..3735, 4080..4204, 4504..4633, 4860..5016, 5288..5371, 5476..5596, 5680..5907
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved