Otolemur_garnettii Locus ENSOGAG00000002703
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000002703
Otolemur_garnettii
ENSOGAG00000002703
GeneScaffold_2201
SNORA17
129970..130101
146427
GATACACTCAGAAACCTGGGGTTTGAGGAGCAGCACCTCCCCTAGACCCGGGTGACATG
GGTTCTGATGGGAGGGGGCCTTCATGGAGCCAGGAGGGTGCTGAAGGTGATGGCTCAGAG
AAGCTTCACGGTGGCCCGAGTGGCATAGCTCTTGGCCAGCGGAGACATTCTGGAAACTCC
CTGGGAGGGACGCAGCTCCCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGATAATGATGGGTCCTGAAGCAGAGCCAGTCCAGCCTAGCCGAGAGTCAGTCTCA
GAGTCTCAAGAGAGCCCTACTGTAGGCATTTGGGTCTTGAGGGTGAGAGGCAGGGCCAGG
TGGAACTGCTGGTCCTTACTGGACCTCCCTTAACTGGCTTATCATCTTTATAATTTTGGT
CACTGTCCCCACTCCTTCTTTGTGTCAGGTGCTAAATCCCTGTCTCCTTTAATTATCACA
ACAGCCTAATTAGGCAGGTGTTACTATCTCCATTGTACAGGTAGAGGGTGAGGTTTCCCA
AGGACATGCAGAGAGTGGCACAGTCAATCTTAAGTTGGTATGATTACAAAACACCTGGCC
CCTACCAGTCCTGCATGATCCCATGTGGCCTCCCTAGAGAGAATGGCCACAGTCTTTCAG
CCCCAAAGTGTTCCCCCAGGCCCTGCCTGTAGTGGGTAGGACCATCAGTGGCCCCCACGG
AATAGTCCCAGCCCTGAGCGTCCTTGTGTTGACCCCACAGGAGGAATGTCTGCGGGGGAC
AGTGCTGCCCGGGATGGACGACTGCAAACAGCACCAACCACTGTATCAAACGTGAGTGCC
TTCCACCTTAGCCCTCCCAGCCCTACCAGGTGGGCCAGGTTTAGGGATTCCAGAACCTGG
AGCAGAAGTGTCCTCATCCATTTGCCGCCCGAGGATGCAGTCCTTCTCGGGCATGAAGGT
GATGTGCTGTGGAAGGGCTGGGATTTTAGAATGCCTACAGATGGAAATAGCTTCTCAAAA
TCAAATCCCTGCTCGGGTTTTTAAAGCTCTCTGCATTCCCTCCTGCTGCTCCACTGTTGG
TGTAGGGTCTCAGGTGCCCGCATACCCTTGTGGTCTGCAGAACACACCTTGCCAGGGCCC
ATGCATGTGTGCACAGGAACCCACCTCTGCCCTGGACCCTGGCCCGAATGTCCTGGCCTC
TGTCAGATGAAAGCTGGTCAGATGAGGCTCTGACCCTGTGTTGGGAGCAGTCTTCTCTTG
GACTACTCTGAAGCCTGGCAGGCTGCCTCAAATGAGAGAAAAGAGAGAGAATAGTCATCT
TAGTCTCATGAAAACCAAGGAGTGAAACGGGAAGAGCCAGGGCCTCCTGGCCAGAGCCTT
CTACTGATGGCATCAGAGGCAGTAACAGCATTATTCTGGACAAGAGCAAGAATATTTAAC
ACTCCCTTTGTGGTAAGGCGTATTTGCAATACTCTCTGGGGCAGGTAGTACCCTATCCAT
TTGGCAGATGAGGAAACTGAGGCACAGACAGGTAACTTGCAAAAAGTCACATGGCTGGGA
AGTGCAGAGTTAACATTTAAACCCTGAGTTCAAATGAGTATCTATCCCCTACTTCCAGGT
GTCTTACCCTATCTTTCTGAGCTTCACTTTCTGTATCTGTGAACAGAGGATGCCAATGAA
CTGCTAACCCTACTACTACTAGTAACAACCATTTCCTGTGGCCCAAAACTATTTCCTATG
TTATCTTAGTTCCACCTCTCAATAATCTTATGAAGTGGGTATTTACTTATCATTTCTGCT
TACAGATAAGGAAACCGCAGCAGGGCTACACTGCTGCAGGTGCTAGAGCGGGGGCTGGCC
CCAGGCAGTCTGAATGCAGAACTTCAGGCTCTTATCTCTGGGGCTTTGGGGCTTTACACA
CCAACGGAGGCTGTGCATTCCAGAGTATGAAATCCCCACAGATGATAGCAGTTGAGGGAG
CCCCTTGGATCTTCCTCCTTCACACCCCAGGATCCCTCTTGGGTCCACATCAGCTCCTTA
GGAGCTCCGGCTGCCTGTCCCTCCTGTAGCGACCACGCCTTTGCCAAACCACAGCTGGCT
ACAGAGCCTTTCTCACCAGCTCCTCTTCCTTCCTCAAGGACCAGGCCCTTCTCAGCAGGA
GGGTTTCACAGCTAACAGTCCAGGTGTATGACAAAGCATATGGTGTTCCCAGCATGCTGG
GTTCCCTCCTCTGGGTCTTCTGACACCCCCAAGATGGGATGCCTCCATTTCTGCGGGGAT
GGAGCTCCTGGCTCACTAAGCTGAGGCCTCATGGCCCTGACAGCAGAATCGTGGGTCCCT
CTGAGGACCTCCAGAAAACCAAAATCTAAAACTCAAAAACAGACAGAGCAGATGTGCTTG
AACATCCGTTCCTTTTAGGGTAGCTGGATGAGTAGGTGCTCTCGGAGGACAGGCCCCATA
TGGCTGGGGGCAGGGCTAGGGGAGAACTGTTTTTCCCTTATCATTTTAAAGACGAAGAAA
GTGTACCTTGAAGAGGCAGTGGCTTGATCAAGGTCACACAGCTCATTGGAGGAAAATCTG
AGACTTGTAGTCAGCTCTAAGCAACTCCTCTGGGTAGAGAAGCCAGGGGTGAGGGTGACT
AGGTGACTCTATGCTAAGCAGCTGGTATTTTTCTTTTTAAGCATCCTGTGTGATTCTAGC
TGTGGCTGAAATCACTTAGCAGAGTTTAGGGTCAAGCATAGGAACATTTCCCTTGGGGGC
TTTACTCAAATTTGTTCCTACAAATCCTCTGAGGATCTTATTAAAGAGCAGGTTCTCATT
CAGCAGATTTGGGGCGGGGCTGGAGAGTCTGTGTTTCTGACAAGCTCCCAGGGGACGCTG
CTGCTGCTGGTCCAGGGACAGCATTTGAGTAGCAGTGATTTTGGGACTCTGGAGGTCGTC
TGGAAGGGATTTGGAGTTGGAGATGTGGAGGAGGGTTGGTATGTTCTACAGAGCTTGCCT
TTGCTGGGAGGAAGTGTTTGGCTGATGGAGAGTGTTGCTGTTTGAGCTGTAGCTGGAGCA
GGCAGGCTCCAGAGGGGGTGGGCTTCTCCCCTGCTGCCTGAGGGGTCTGGGCACAGGCTT
CACTTGGGCCCTCCAGCCCTAGAGGTTCTCAGTTGCCCAACTTGCTTGTGATTTCCCAAC
ATTAGTCTCTGCCAAACTGGAGTTTCAACCCTGGAAACTCGAGTTTGGGTGAGTCTGCAG
ATTGTCACAGTACCAGTACAAGTGTGGGCACCTCATGCCCCGGGTGATGCTGCTCCAGCA
TGCTGCCATGCCCACTGCCTCTTATTCTCTCCCCAGCCCTCTCACCCTAGTCACCCACCA
GATGCAGGCATGCAGGCTAGCAGCTCTCCTGAAGGGGATAGCACATCAGCCTTCCCCTCC
TGAATCGGCTTGCCCACTGGTCCCCACGCTGTGTGCCTGTTGCTGTTTTGCCTGCTAGGA
AGCCTAATGAGAACACGTGGGTGGTGGAGCGTTGGCCTTGAGTGGCTGGGTCCAGAGCTG
TGCAAAATGTGGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGTAATGTTA
GTTCCTGCCTTCTGGAGTTGTAAGGAACAAATGAGTCAGCTTAGGTCAAATGTTTAGTTC
AGGGCCTGGCACGTCCTATGTGCTCCATACATGTTTGGCCTTGATTTTGAGGGCAGGAAC
TGTGTCCCATCGCCCCCAGCATGCAGCACTCTGGGCACGAGGTAAAGCCTCAGTGAGGGT
GTACTGAATAATATAGGGCCTGTCCCAGGTCCATGCTGAGAGGTTCCTTTCTGCTGCCCA
AGTCCCATGAACCCTTCTAGAAGCTCCCCATGGTACTCAGGGGATCCTGGGGATAGAGAC
CCTGGCCTGGGCCTGGCTATCTGCTCCTGCCCTCATGGCTCAGAGCCTCTGCATGCATGG
TGGGCACTGGAACAGCCTTTCCTTCAGTCATGTCCTCATCTCAGTCCTGCAAGGACCTCA
TCCTTCCTGATCTGGGCTCTTCCTTGGCTTCCTTGAGGAGCTGGCTTGCCCTCACCCATG
CCAATTCTGTCATGACCCCATCTCAAAGTGTCAAGGTAGGTAAAAACCCCACCTTTGGAC
TCAGAATCCCTGAGTTCAAACTCTTCCTTCTTCACTTACTAGCAGGACGATCTTGGGCAA
GTCATTGACTGCTCTAAACCTCAGTTTCCCCATATGTCAGATGGGGATGAGACTCCTATA
AGAAGGAAGTGATTACATGAAGTGACCTTATTATGGTAAATTCTTTTTTCTTTTTTTTTT
TTGAGACAGAGTCTCACTTTGTCACCCTTGATAGAGTGCCGTGGCATAATAGCTCATAGC
AACCTCCAACTCCTGGGCTCAAGTGATTCTCTTACCTCAGTCTCCCAAGTAGCTGGGACT
ATAGCCACAATGCCCGGCTATTTTTAGAGATGGGCTCTCACTCTTGCTCAGGCTGGTCTG
GAACCTGTGAGCTCAGGACAATCCACCCACCTGGGCCTGCCAAAGTGCTAGAATTACAGG
CCTGAGTCACTGAGCCTGGCCTTTTATTATGGTAAATTTTTAACAAAGCTTAAAAAAAAG
GATCAGAGTTGTGGTGGGATTTTCCTGTTCTTCACTGACTAGTTAGCACCTACCAGAAAT
GGGAGGCTTGAGCCTGTGGGTAGCTCATCTCTGGGGGAACCATCTTAAGGGACTCAGGAG
TTGGCAGGGAGGAAGGAGGAAGGTAGTTAAGGGGAGTAATTACATGACCTCGTGGGGACT
CAACTCATGTGAAGTGTACAGTCTCCACTGTGGGGAGCATCTTAGACTCCCCTGGTCAGC
AAGTGTGTGTCCCCTGAGGCTCTTTGCCCAGCTGAGTATTTAGGAGATATCTCTGACAAG
GAGCTTGCTGAAACCATGTCCAGTGTGCTGTGGCCAGTTGACAGCAGCAGAATGCCAGCC
CCCTCTGCATAGCTGTGTGTCCTCTGCACGTGCTTGATACACATTTGTTAGAGGACTAAG
TGGGCAAAAGATCACATGGATGACCTGCCAGTTTCCTTCCTCATCCCCAGCTGCCTCTTC
TCGGCCTCCTCTGCTCCCTTCTCTAACCAGTGTCCTAATGATGGGCTTCCCTGGGAGCTG
TCCCCAGACCTTCCAAGTCCCCTGTTAACATCCATTATTGTGCCAGACAATTAACATGCA
ATAATAGTAATAATAATGTCCAGTGTTTACTCTGCCAGAGATGCACTAAATGCTTTAATC
TTCTTTTATCCCATATGTTATTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCTGAGCCAGCTGCCCCGCCAAGTCTCACCCACCCAGTTAACTGGCACCCCCATC
TACCTGACTGCTCGAGCCAGACAGGTGGGACCATCAGGGCCTCTTCCTGTCATTCAGATT
TTATCACCAAGCCCTGTTTGTTTTACTTTCAGAATCCCTTGCAGACCTGTCTGTCTGCTT
CCTTGCCACCTCTCTGTCCAGGGCCCCCATTGCAGTTCTTGTAGGTGATGGTGGCAGCCT
GCTGACTGCTCTTCCTGCTGCCCCTAACTGCTCCTGTTGCAGCATACTGGAAGCTTCTTG
GTGCTCACCCCGAGCTCACTGAGTCCAGCCTTGTGCACATGCTGCTGCCTCCCTTCATCA
TGTTATGCTGCTGGCCCCTAGTCTGTGGCATAACCCTGAGGGGGCTGCCCTGCCCTCCAC
CACGCCAGCCTTGTTATTCTGTATCTCAGCCCTTCCACTGTCTCCTCTGTATCTCACAGC
CTGATTTCTGTTCACCTCTTTCTCCACTCACTTGTTCTATGATGGTTCCTCCGACTAAAT
TGGACACTCTATGAAGACAAGGACTGTGTCTGTCCTGTTTATCGTGCTAGGCAAGTGCAG
GATTTGAATGAACGATCACTTTCTAGATAACAACAGAGGCTTGCAGAGCTCAGGTCACAC
AGGAAGAATTCAAACATGGGTTTCTGACCGCAATGCCTTGGCTGAGTAGAGTGTTCCACG
TGGTGTGATTGTCCTTCCTGGCTTTCCTGGGGCCTGGGTGTGGAGCTGGTGCCTGCAGCA
GAAGGGGTGGCTGGCTCCATGCCACCCAGAGACTGTCTTCCATGGAAAAGACTCATCCCC
AGGCTTATCCTTCATGATGGCCATCCCAGGGCTCTGTCCCATGCCCTCTCCTCTCCAGAG
GCCACCCTGGCTCTTAGACTTCCTTCTAGACATCCTGTGGGGATGGACAGGCAATTCTTC
TGTTTTGAGGCAGCAGCTGGAGACAAATCCAGGCCTCAGCCCTGGGCCATGAGCCGTGCC
CAGAGATCTCCCTCTTCATGCCTGCTAGAGCTGATGGGATTGGGGCTGCTCTATGCCCCA
GCCCCTGGCCCTCCAGCCCCCACCTGGCCAAGCATGGCAGCATTTGTTAATGTAATTAAC
AGGGCAGTCCATGCTGAAGGGCTGGGGGCCAAGGTCTGACTCACACCTCCCCTTCCTCCC
TCCAGCCGCCAAACGGTAGAGGCCCACTTGGCCTGCCAGACAGCGTCTGCAGAGAGTGCA
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGATTCTGAAGGTATGTTTGAGCCAGCCAGGGACTC
CTTGGGCTGGGGTATCTGTGACATCAGGGTCCCCTTCCTCTGGAACCAAAGGTCAAGGTT
GTGGAGAAACAGCTCAAGGCTATAGGTCGACCCTCTAATAAGCAAGAGAGAGGCTGAGGT
AGATAGGGTGCATGGGCTGGAAACTGCCCTGTCTACAGAGGCCTCTAGGTATGGAAGAGC
ACAAGGCCTTGGCCTGAGGAAGGGATTAGGTAGCCCAGTGGATAGGGTCTTAGTGTCCCA
TGACATAGATTTTGGGAAAAGGGAGGTTTAACCTGGGGACAGGCTGAGCTTAAGGTGTTG
AGGGGCTGGGCCCAGAGTCTGGTCTGGAGCTGAGATTCATCTGCACAAGAGGGGTGGTGT
TGGGAGCCACAGAGGAAGGGAGAGGTTTGAGGGACCCACCTTGAGTGGGTCATCTCAGTG
TATCATCTAAGGGATCACAGATGAAAGGAGAAGGTGTCCTGGGATCCAGAAGAAAACTGA
CAACAAAGGCCTTGCCTAGGGGTGGGATGGGGGAGGAGAAGTGTCCGGGCTATATTCAGC
ACCTGGAAAGCACCACAGTCCTTGGTTACTCACCTCAGTAATGGTGCTTGAGTTGACAAT
GCCTTTCCCTAGAGAAAGGGGTCATGCTTGAGAAGTTCAGAAGCCACCCTGCCTCTGGCA
ATGTGGTATCTTTGGCTTTTTCTTCCTTAAAAGTGTTGCAGGGAAAAAAAAAAAAGTGTT
GCAGAGCTGTCCACTAGAACTTTCTGTGATGATGGACATGCTCTATACTTTGCGGTCCAA
TATGGTAGCTGTGAGCCACATGTGGCTATTGAGCACTTGAAATGTAGCTAGTGAGAGTGA
CATGGAACTGAATTTTGAATTTCATTTCATTCTAATCAATTTAAGTTTCTAATCAATTTA
AATTTCATAACCACATACAGTAACTACAGTATGAGACTAGACTGAACAGCACAGCTTTAG
AGAATAGAAAGTACTTCTACTTCCAGGATTTCTACTGAGACTCACAATGACTCTTTTTTT
TTTGAGACAGAGTCTCACTCAGTTGCCCTGGGGCTTAGTGCCATGGCATCCCAGCTCACA
GCAACCTCAAACTCTCGGGCTCAAGTGATCTTCTTGTCTCAGTCTCCCGAGTAGCTGGGA
CTACAGGTGCCCACCCCAATGCCCCACTAGTTTTTTGTTTTGTTTTTCTATTTTTAGTAG
AGACAGGATTTTGCTTTGCTCAGTTAGTCTTGAGTTCCTGTGCTCAGGTGATACACCTGC
CTCAGCCTCTCGGAGTTCTAGGATTACAGGTGTGAGCTACCATGCCTTGCCTGTTTGTTT
TTGTGATACAGTCTCACTATGTTGCCCTGGCTAAAGTGCAGTGGTGTCCTTATGTTCACA
ACAACTCCTGGGCTCAAGCGATCCTCCTGCCTCAGCCTCCTGAGTAGCAGGACCTACAGA
TGTGTGCCACTGCACCTGGCTAATTTTTCTGTTTTTGTAGAGACTATATCTTGCTATGTT
GCTCAGGCTGGTCTTGAACTCCTGGCCTCAAATGATCCTCCTACCTTGGCCTCCCAGAGT
GCTAGAATTACAGGTGTGAGCCACTACACCCTGCCTTCACAACAACTCTTTGAGGCAGGA
ATTATCAGCCCCATTTGCCGATGAGGCAACTAAGGAGCCAGTTGCAGTATCTCAGTGTGT
AAAATACTTCTAAGGTTATGAATCTGAGATGTGGCTGGGCTAGAGTGAAACCAAATCCTC
TGATCTGCACTCCCATGTTCTTTCTGCCACCAAATGGCTTATCATTGGAGGCTCTTAGCA
GTGGGAGGGATCATCCTATACAGTAGTAGCTGTTTCTAGAATCTCCCCCAGGCCTGTCCA
TTCTGAGTTTGGTCTCCTCCCCAAAGTAGAGTTTTTGTGTGGAAAATCTGAGCAAACCTC
TCTTTTGAGGCAGACTGAAGATAGAATGGGCTCAGCCAGGAAAGTAGAGGAATTAGGGGA
ACAAGGCCTTTTATATCTTACTCTCACAGCAACTTTAGGTTTTTAAATTTCCCCAGTTTT
CACATTCCCCTAACTCCTCAGAGCTGAATGCCCAAAACTGAGACTTTCCCACATATTCGA
GAGTTCCAAAGGAACCCAAGTTATGAATGGCCAAAGACAGGCACTGGCCAGTGGGAGCAG
GGAGGCTGAATGACAGTGTCACGTTTCAGCTGTCCCAGCGTGCTATCCTACAGCAGGAAT
GGCTTTGTGTGTTATTCCTGGTAAAGATTGGCTTTCAGAGGGCTGAACATGATGACACTG
TGGCATCATGCTTGATAGCCCTCCACCAATAATCAGTTGATGGACATCCATTAGAGCCAC
AGGACCCATCCTAGGTTATTTTCTCAAGTATAAGGCATGATCTCTACTCTTGAGGAAAAA
TAGGAGGGATTAAGCTCCAGGGTCAAACCATGAAGATTTGCCCACCATGGTTGGAAGTTT
TTCTCTCTTAAAACTCCCACAGTACCACATAGAACTACCTCTCCTGGGGCCCTCAGCATT
TCCTCCTTTGCTTTAAGCAACAGCCCCTCCACCAGCAATTCTAAGATGGCTGGTTTCCTT
TTAGATATTTAAGTTCTGAAATCTGTGCTCATTTGACACAGGAGTGTTCTGTGTCCCTTA
AACAGAAGGACACACAGCCACTAATGCCTCTCCCTTTCAAAGGGTCATTGGATTTCGTGC
ACCAGTAAAATATCCCAAAATATCTTAAGTACCAACAGACAGTGGCCAGCTCTTCACTTT
TCCAAATGAGGATGTTAGGAAAAATCAAAAGGAAAAAATAAAGGCCGCCGTCATTTACTA
CCATCTTTAATTAAAAAGAATGTTTTAGCATCAAAAAGAAAGAAAGACATAATCTCAAAG
TGAAAGACACCCTTTACATGGGGAGAAATAACATCGCAAAAACCTCAGGAAACTGTATTT
ACTTTTCTTATTTTATGGCAGACCAGTAAAAACCGTCAGAATGTTCCCTTTCATAGGCAG
GCACTTGGAGACACCTCTGTGAGCTATTGCAGGTGATTTCGGGGGGAGTCGAGAGAGAAG
AGAGGAGTCTGGGCTTCTATCGAGTAATACACACGCTCGGCTCAGAACAAAATACTTCAA
CACTTCAGTGAGGACGTCAGGCGGTTCCTCACACCATGCTGAGATTTGTGAAAACAAAAC
AAGAGAAGATCCAAGTGGAGCTGGTGAGAGCTGGTTCAACACCTCCAAAAGCCTGAAACT
TATTGGAGGATCTGCCCCAGCAGACGGGGCCTCGGTGCAATCTCCTAAATGGTTGTTGCA
GACGGGTTATCTTCCCTTCCAGGATTTTTCCACCAACATATGTAGCTAGTTTAGAAGCCT
TTTAAAACTTTTATTTACTGTGATATTATACACATATATAAAATGCCATTTCCACAGTTT
TCCTCCTAACCACTCATTTCCCATACATGAGCTGTTCATTGTGCCAACCGAAGTTTGCCA
ACCCTGGTCCTCATTGAGGACCTAATTCCCTGCTTGGCAGGGCCTACATGGGTGTGTGAA
GAACACACCACCGGGCAGAGCTTCCTCTGTGCCAAGCCCCAACTTGTTCATCTTTGTGTC
CCCAGCACCCAGTTTGACCAAGGCAATGTTGCTCACTTAAATGTTTGCCTTATGAGTAAG
GTGAGTAAGAAGCAAGAATTAATGTGAAGCATGGTTACAGGACCAGGGCTCAGCTTTGCA
GGCGGCTGGGGGTCTTAGGGTTCTAGAGAGTGAAAGATCTTGTCTGTTTTTGTGTTTTAG
AGACAGAGTTTTACTTTGTCACCCTCGGTAGAGTGCTGTGGCGTCACAGCTCACAGCAAC
CTCCAACTCCTGGGCTTAGGTGATTCTCTTGCCTCAGCTTCCCAAGTAGCTGGGACTACA
GGCACTCACTATAACGCCAGGCTATTTTTTGTTGCAGTTTGGCAGGGGTGGGGTTCAAAC
CCACCACCCTTGGTATATGGGGCTGGCACCCTATTCACTGAGCCACAGGTGTCACCAAAA
GATCTTATTGTTAAGTCAAGGATGGATCATCCTTTGGGGCTCTTCAAGGGAAGATGGAAG
CCAGACTACTTTCTAAAGGTTGTCTTCAAAGCAGGGACCACCTACTCAGAGGGGACAGCT
GCTTCACCTTCCTCTCACCCAGGCCAGCAGAGGGCTCTTGTTCATCTTGGGCCACATGGG
AAACTACTCAGGCCTTTCCTCTCTACTTCCCCACTGAAAAAACCCAACAGGGCCAGGACC
TGCTTGGACACATTGGATTCCTCAGTGTTCACTGGCCCTGGCTTGGCTGCTGAGCTGGCC
CTAGCTGGCCATGCCTCTGGTGGTTGTGACAGGAAGCTGGCAGGTGGTGAGATGAGGGGT
ATGTCTGCTAGGGCAGATGGAGTGGTGGCCAGGCAATAGGCCAGAATCCTACCATTATAG
TGGCTTGTGTTTGAGGACATGCTCTGGGTCCCAATGCTCTGACATGGTCTCCTTTCCTAG
AACCTGCGGCCTGTCAGGAAGAAGAGCCCCAGCACCGAAGAAAATGTTCTGGCCTTTACA
CCTAGCTACATGGTTAGAGTACTGCAGTGAGACCTATTGTTTTTCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGGATGTATAGCTTACTGGCACAGGACTCCC
AAGGGCATATTTGGTGCTGACTTGAAGCCATCAGATCCTTTTTGTTTCATCTTCAGTGTT
GGGCCCAGGCGCAAAAAAAGCAGAGAGAAATGTGAGCCATACCCACCCTGCTGGGAGCTG
GGAGGGTGAAAAAAGCCTGGGCTTTTCAGCCAAACACATGTGGATTTGAATCCTAGCTCT
ACCATTAACTAGCTGGGTGACCTTGAGCACATCTCTTAACCTCTCTGAGCTTCAGAGGCA
TTATCTGTAAGGTAGGAACCATAATCACACCTGCCACATAGGATTGTTGTAAGGAGTAAA
TGAGGTAGTGCGTGCCAAGCACAGTGCCCGGCATATTGTCAGCAATCATTGGATAGTAGA
TGCCGGAATAGAAAAACAATAATGGTGTCATTGTTAGGCATATGTTAGGAGCTAAAGATA
CAAGAAGTGTAACGGACAATCACTACCCTCAAAGGGGCAGCTGTATACGTGGGGAAAACG
AGACACAAATCTAAGAAACTCCTGGTGGCACACAGGGCACGCCCAGTGATTGGTGTTTCT
CCTTGTTGTTCAGAAGAGGGAGCAGTTGCCCAGAGGTAGATCATCAGGCAAGCGTTGCTG
GGCCTTGAGGGAACAGTAAGAGGTAGGGAAGTGGGCTTGGCGCCCGTAGCTCAGTGGTTA
GGGCACCGGCCACATACACTGGGGCTGGAGGGTTCAAACCTGGTCTGGGCCTGCTAAACA
ACAATGAAAGCAACAACAAAATAGCCGGGTATTATGGTGGATGCCTGTATTCCCAGCTAC
TTGGGAGGCTGAGGCAAGAGAATTGCTTAAGCCCAAGAGTTTGAGGTTGCTGTGAGCTGT
GACACCACAGCACTCTACCAAGGGAGACATAGTTAGGTTCTGTCTCAAAAAAAAAAAAAA
AAAAAGAGGTAAGGAAGTGGAGAGGAAAGGGGAAGAATCCCAGGAAGGGGCCACAGCACC
TGCAAAGGCAGAGAGAAGAGCAGAGGCTACCTGGGGCAGTAGCCAGCAGACCAGTTTGGC
TGGAGCAGGTTAACGTAGATCAATGCTAGAGAGGGATTGTAGTGGAGGGTCTTCAGTGCT
ATGGACCTGTGAGACACCGGGAGCACTATAGTTCTCACAGGAGTGACATGAGCAGTCGAA
TTTGGAGCTATTTATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGGGGGGAAGGTGCCTGGGAGAGAGCTG
AGGAGGGCATATCCCTGGGATTAGGGTCTCTTGGTTGGAATCCTGGCTTTGCTACTTCCT
AGGTTGTGACCCTGGGCGAGTTACTTACAATGATAACACCTAGCTTATGGAATTCTTGTA
AGGATTCAATTAATTAATATAAGGAAAGTGCTTAGAACAGTGCCTGGTATAAGTAAGCAC
TTTTATAAATGGTCCTCCCCATCCCCTCCCCTTCAGTCCCTTCTCCTGCCCTTATTCCCC
AGCCCCACCCCCTCAGTCCCCCTTCTCCTCCCTCTGTGGCCTCTGTGATGTAGGAAGGAC
TCCTCTGCCAGAAGCAGCCCCTTCGGTTTACTCACCACCCAGCTTCAACCTCTCTCCTTA
GAGAGGAGATGGAGCCCTGGGGGAAGGGAGTAGAATAAAAAATGAACAAGGGGAGTGTTC
TTGGGCAGGATTCCCTGGCCTGCTTGCCAGCCAGCCTGGCTAGACTTCTTTCTAGCTCAG
GACAGGAAATCTGAACTTTATAAACTGGTCCATTTTTAGGGGGCTGTGTTTTCCTTTTAG
TTTTTCAGGTTAGTTTTTCCATTTGCTTCCTCCTTCAGAAGTTCTATCTGAAATATTGCA
ACTTTGTCTTGCTGAACCAAGGAGCAAAAAGGATTTGTCTTTTCAGAGGCCAGGAGAATC
AGGGAGAAGAGGCTGACCTTGAGGTTAGATCCCCGTTGGGAAAGGTCAAGGAGACGCTGG
TTGAGTGGGTGGAGAGAAAGGAAAGGATGTAGGGGTTGTCTAGCAACTCTGAAAGGGTGT
GCAGTCAGACAGACCAGGGACTTGGGAAGGTAGGTTCCAGAGCCCTGAGCACTCACGCAG
ATGGCTTCTGAGGGCGGCTAGGAGCAGGAAGAAAGAAAGGATGGGCTCAGCTTGAGGTCC
AGGGAGCTCCAGGTCAAGAGTAGAAAAGCCACACTCATCTACTAGTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCTACTAGTTTTTCTTATTTGGGTCA
GTTAGAAACAGTGCACTGGAGGGGTCCATGTGGACAGGGTCAGAGGAAAACAGCAAAGGA
CAGTATCCCAGGGGTAGCTACCCAGGAAAGCCTTCAGGTCTACATGGACAGAGTAGCTCC
ACCCATGTCAGAGGGCCTCCAAGAGGGCTGCAGCCCGCACTCACTGGACAGAGCTGGGAG
GATCCGTCCTCCACTCCCTCTCCTCTGGCCTCTGAGCTCCTACTGGGGTTCTGAATTAGC
TGGACTGGACTGGAAGGCAGAGGGTGAAGGTGGCATCCCAGGGCCCAGAGTGGAGTGGAG
AGGGGGCAGTGGAAGATCTTCAGCACATTTACCAGTCCTCACAATGACCTTGTGAGAAGG
ATATTCTCATTCCCCCTAATACACGATGAGGAAACCAAGGGCAAGGGTGATTCTAGCCTA
GCTCTGCTCCACTTTGGAACCTGTGCTTTCAAGCATTTTGCTAAACAGCTGGCAGAGCAG
GTGGGCACAGGCAGGTGCAGGAACATCCAGCTTGGCTTGGGGGCTGTAGAGGACAGGGTG
AGGCTGGGTTTCCAGCCTCCATTGAGAAAGCTACTGAAGTGGGTGAGAGCCTGGAGCAAC
CACCAGAGGGGAGGAAGGCAGCTTGTCATTCAATATCATTCAGATATTAATGTATGCAGT
TTCCAGCATTGGGCTTAAAAACGATAGCAAGGAGAAACATTTCAGGCTTGTAGCTGTACT
CACAGCACTTAACTGACTTAAGTTCTCTAGGATTTGTTTAAAGGTAAAGATCAGAGTGAT
GAAGCAAGGAGAGAATGGAAAGACAGTCAAAGCTCTTTTGTGGATGTCTAGAGGAGGTTC
TTCCCGTCTGGTTTCCCTTTCCAGTGCTGGCAGCTCAGCCAAGGTCACCCTATGGGTGTG
TGTGCGTGCATGTGTGAGACGGGGCGTGGGTGGAAGCTGTGGTGGGAACATGCCTCAAAT
GTCCTAATGGAGATTTTTCAGGCCCTGTGAATTCTCCTTTTGAGCTCAAGGTTTTCAAAT
ATATATCAGATTTCACCCCTTGTCCGGAACATAGAGGAAGTTTCTGATTTATGAGTTCAG
TAGTTTTTCCAGTTACTCCATCTTTAAATCTGCCATCAGTTAATTAATTTGCCACTGTCA
GAAAAGGCACTGTGAGCTTCCCAGGTGAAAATCAGTTTAGCGAAGTGAAGTGGTATTATG
ATAACAGTAATAAAAAAGGGGACTCTGAAATGTACACTTGTTTTCACTTGTGGAACTAAT
TGAATCAGTGTCTCAGGGTTCCTCCTCCTCCTCCTTCCTAAATCACAGCACACACACACT
CTCATAACCTTGCAGGATAATTTCCCAGAAAAGGATTAGAAAGGGAAAATGGATTAAATG
CAAAGTCATCTGATGACCATGTTGTAAGAGGTTGCTTAGGTCCCAGAGGGGTGCATTTGT
GTGTCTGTCTGTCTGTCTGTCTGCCTGTCTGCAGATGGCATAGTGAAGATTGCTAAATGA
TTCCCAATAATGAAATGTGAAAACACATAGTTCCTTTGCTAGCCACATAGCTGTGGTTTT
GCGTCCGTGATTCATTGTGGAAGTGAGTAGCTGCGACAGGCATTCTGTGGATTTTTTTTT
TTTCATCTTATTTCTCCTAAAAAAATATTTGTGCAAGGTCTAAAATTCAGGGAAGTCAAG
TACTTGTTGAAGAGAAAAATCCCTGTTCTTTGCAAAACAACAATTACAGATCGAAAGTTC
TGGAGCTACCACATTTCTGCTTCTAGCTGTCGCCTACGCTGCATTTTCCTCCTGGAGCCT
CAGTTCTGCCCACGACCGGACATGTCACCCACCTGTGCCCAGGGAGGAAAGGGGCTACAT
CAGAGGCCTCTTGGGGGAGTCTGGATCTGTGGGGGCAGGCGGTATCCTCTCAAGTCCCCA
GCCAGGCCACACCCTTCCGTGACCTCTTCCTTGGGGAGAAAATTGATTCCACATTTCTTT
CTTCCCTGACGTTCCTGGGGCAGGGTCAGAGGCCTTACAGAATGCTGTAGCATGTGAGGA
TGGAATCCTGAAATAAATTTTGTCTTATAGTTGGATAAGCCTGGGTTTTAATATGTTTTC
TGAGCCCCTACAGATCCAGACTCTCCTAAGAGACCTCTGATGCAAGCACCTTCCCCTCCC
TGGGCACAGGTGGGTGACATGTCCAGGGCATGGGGCAGGAGCTGAAGCTCTGGGGTTTTA
TCTCCGCCCTAACACCTTAAAAGCCAAGCTGCTTAGAGAACCGANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGCCAACAGACTGAGCTTAGAATCCTGCTCTTAGACATTCACTGTTAGAAAGAGGCC
ATACAAGATCGAGCTCTTTTCCCTTCTTCATGCCCCAAATTTCTCCTAAGTCATACCAGG
ATAGTGACACCTACTTCTCAGGTTGTTGTTGGGAGACCTTCCTGGCTATGTCTATTGACA
TACTAATTGGGTTTGTGCCCAAGTGTGTTAACTCCAACCAAAGCTCTAAGGTTTTAGTGA
CTCAGTGGCAATTATATATATTATATTCACAGTTTGCAGAGAGGGCTTTATTCACCATCG
ATTCTGTATCCCACACTTAGCAACACACAGACAGTAACAAGAGTGGGGTAACAAACCAGG
GATGGCGAGGGAGACCAGTGTGCCAAGAGAGGAGTTGAGTGGGTCCTTCAGGGGGTTCTG
TCAGAGCTTTTGGTGATAGCTGGTAAATGCAGAGAAGCCCTCAGTGTTCAAATAGGCCAG
GCCTTCAAAGGTGTCTTAAACAAGGCCAGGTCCTGGCTACTTTTGTGATCCTCCCAAATA
GGACTGTTTTCATTATCTCAGTCACCTTTTTCCTTTCTATCCATTTGTTTCAGGTCTTGG
GTGGTACCAGATGATAACAGGTACTATCCTATCACCTCAATCCATTGCATATATGTTCAT
CACTTTGAGAGAGGGGTAAATGTGGTCACTTAATGTCACTTAACATGAGTGGGCTTAATG
TCACTTAACGTGAGTGACTCCATTTCAAGAGATTAAAACCACACGTTATTATGTTAAGGA
CCTTTATCAGGTGGCATGTGTTTGGTGCCTGATGCTCAGTCCGTGTTAGTGAGTGTGGCA
GTTATTTGATGGAGGTGCGTTGTGTGGACTTGGGAGGAATAGCTCCCCTTCAGCACGAGC
TGACATCCCATTCCAGTAGCCGGGGAATGCTTGACCTGAGCTGCAGCAGCATGTCTGCAC
ACACCTGTTGTCCTTCAGCTCCACATCCCCAGATGTCTGCCCACACAGCAGTCTGTGCTA
AGAGAGGGCCCCTATAGCTGTGCCTTCTAGGAAACATTCCAAGTAATAAGCCACGAATAG
ATAACATACTCCTGTGTAAATCCTGCCCTCCCTGTAATGCCTCTGCCATTCACTTTATGT
GTGCCCTGGATGGTTTTGTCAGGCCAGCTGGGAGAAAGGACGTTCAAAAGAAGGATCATC
TCTGAGTCAGGCAACTGACTGGCTCAGCCAGCTTGCCTGCCTGCTTGCCTGCCTGCCCTC
TTTCCTTCCTTCCTTCCTTCCTTCTTTCCTTCCTTCCTCCCCGCCTTCCTTCCTCCCTCC
CTCCCTTCATTTCTCTTTCCCACCCTCCCTTCCTCCTTTTCTCCCTCCCTCCCTCTCTCC
CTCCCTTTCTCCGAGGCACAAGGAATACTAGATGACTTGGACCGACTTTGCCTCTAAAAG
CTCAAATCCAGACATTTGACATGCACAAGTAGTGAAGGCACATTCAGCCCTTGGCAAGGC
ATTCATGAACTCTCTCATAAAAGCTTTCAAGAGGAGACTGGAAGGTGAGCAACCCGGGAC
AGGTAGGGGACCTCCAGGGAGGAATCTTCCATGACCATCTGCTTAAGAGACCATGCTTAA
CCTTGTTACTTCCTGGTGAAAAATACCTTCTTCAAGGCTTCCCTTTCATGCCCGAGGTTC
ATAGGATGAGGCCCGGGCCATAGGTTCTTGGCCCTCTATAGCTCATTGCCAAAGTACAGC
TCTCAAATAGCAAGACTGTAGAGGTTTATAGTACAGAATCTGCAGCCAGAATATCTGTAG
GATCCCTGTTTTGATTCCTGGCTTTGTTAGTCATTGGCTGTGTGACTTTACACAAGTTAC
CTACCTTCTCTGGGCCTCATCCATAAAATAGGAATAATGATAATACCTACTTTCTAATTT
TAATTGTGACTAAATGAATTAATATATGTAAAGTGCTGAGCACACTGCCTGGCACATAAT
AAGCACTATGGAGCTATTTGCTATTAGTATTTTCATCCTCGACCCCTCCTGTTTTCCCTT
TAACCAGATGGACCTGGTTACCCACTGAACACCATGTCGGTACATTCCTAAATGTGTCCT
TTGTGCTCGTGGTTCTTTCTGTCCTCCCCTTCCCTTCCTCTAGCTCATGTCTCCTGCCCT
CTGGAAAGCCTTCCCCAGAGACCCAGCCCCATGGCCATGCCTGCTTAGAGAGACTTCGAA
CATTCTAGATGGACTGTTTACCTGGCCTTGAGACTCCTGGCTCCTGCTGCTCTCCTGCTT
TTCTGCTCTTGGATTGTTATGAAACGCTCACATGCAGGCTCTTGTCCCGGGCCTGCTGTG
TGTGAGTGTGCATGCTGCACCCTGTGCAAAGGTGTAAATCAGTGGTTGGTTGAACCCTGG
AGCTAAAATCTTTCCAGTGTGTATTCTGCTTACCCAGTCCCTGCACCCTGCTATGATAGG
AAGTGGAGGCAACTTCTGTAAACTGGCTATCCAGAGGAGCCCCCTTTTCTAATATGTACA
AAAGCACCAGGTGTCCTAGACCTCTTCTTACCCCTGACACACACATACACCCCCGCCACC
AGCCTGGGCTGTAAGCTCTCCTTGGGCAAGATGCCCTTCCCACAGTGCCTAATGGGACTG
CGCACCTTGGCAGTGGGAGAACGATGAATTCATGAAATCCAGGTTCCCTGTGTGGTGACA
AGTCTTCCAGAGGAAGTTGGAGCCAAAGGCCTCAGACTGCCCACTGGCCCTGGCTAGCTG
CAGAATGGGGCCCAGCCAGGGCTGGCGAGACAGCTCCAGTGAAGCAGGGGAGCTGGACGA
AGACATGGAGAAGTTCAAAGTTCAGTGTAACGAGTATTTGAACTCAGCAGCTGTGTGTGC
AGTGCTGTGATGACTCCACGGAGGATGGAAAGAAGGGAGGACCCAGTCACGTCCCCTCTG
GGGCTCTGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TCAGCATGCCAGGCCATAGAGAGTGCAGGGTCCCATCCATGTGCCATTTCTCTGGTATGC
TGTCCCCACTTGTGTCACTGTCTTAGGTCCCCGAGGGTTTGGCAGCCAAGGTCTGTCTGA
CTGCCCTGTGTGTGAGGTCTGCCTGGCTAGCCAGGAGGAGAGGGGAACAGATCTCTGCCA
GGAGCTCACCCCCTAAGCAACTTGGGAGAGGCCAGGGCACGTTGCCCAGCTGAGTGCACC
CACAGCCATAGGAGGAGCAGCCTCCTTTTGCCAGCCACAGAGGGACGTTCTGGGAACACC
CTCTGGTCCTGCTGCTTTCTCCTTGGTCCCCTCCGGCTCTCCAGCCACTCCCTCCCAGGT
GCCTTCTTCACAGCCTCTTCCTCCATTTGCCCTTAAGCCTTTGTGTCCCCAGATCCCCTC
TTCCCTTCTTTGTTCTCTCTTTACTCTTTTATTTCTCAAACGATTTAGGTGGGAGAGCAC
CTGGAAGTCATAAGGAATGCTGCAAACTATCAATATCCAATTCCATGATTGGAGCTGGGA
ACAGTTTTATTAGCAGAAACTATGACGATCGTCTGTATGTGCAAAAGGAAAAAAAGAAAC
CCAGCTATAGGCACACGCATGTGTCCGTGAAGAGAGCAAACTGTGGAATGAAGCGTGGTG
GGCTGCTGCCACGTTTTTCCATTAATATTAATTTATGGCTTGATCATTTGTTTAATCATG
TGCTAGCAGACAAGTGGTAGCAGGCGCCAAAGCTTGGAGAAGAATTTATAGGAGCAAAAT
TTAAAACTGAGACCATGCTGTTCATTAACACATTTTCCTCTTTTAGGTTGGGAAGTGTTA
GCAGAGTTAACGCCTCAATCCAGCAGTGGACTCTGAAATGGGGTTTGTTTTGCAAACACT
CTCCGAGTGAGATCATCCCTCCCCGTTAACTCTGCACCCACCACCTCTATATCTACTATC
TCTCTCCACCCTGACTGTATGTACAGCCCCAGAATTCTCTCGTGAGTTCTGCCTCCTGGG
TGTTTCCATCCTGAGATCCTTCCTGAGGTTCCAAACACTCAACATGTCAAGCCCATCACC
CACTTGGGTCTCTCACGTTGAGATCTTAGCTCCCTGAAGCCCCTCTCCCCTTGTCCAGGC
CAACGTTGGGAATTATTTATGTTTCTACATCTTAAATATTTCTTGAATCCGTATCTTCTT
CCTGGCCCCCTCCTGGGCCTCTGCCAGCCTAGATCACAGCCAAACCTTCCAGCTGGCCTC
TAGCCCTCCCATTTCTGGCCCATTCTCTACCAGATAATCTTTCACCAGAATAATTGTCAT
TTAAGAGGGCCTACTCCCTCATGTCCTGGACCTGTTTGAAAACCAGGAATGTCTCAAGGC
TAGCATGTGTCACCCCCTCATCTTTGCAGGGGTGCTGGTCCCTTTGTCCAACCCTCATTG
GGGCTGAGAGGGTAAAAGAATCTTCCATCATTGGGCTCCAGAGCCCAGCATGGGGCACTT
AGCACATGCTTCTTCAGTGGATGAAAAAGAGTGGCTGTTCCTTGGACCATGTCATTTTCC
TGCTCCCAAATCTTCCAGCCACTCCCCCTTTCCCTTTCACTACAGCCCACATACCTGCCC
AATATTTTAGAGGTTCCACCATAGAGACCCAACCTATTCTTCTTTAATACCCCAAAGCCT
CAATATCCTCATCTGTAACATGACAATAAAGACACGACCCATGGTGGGTGGATTTAGGAT
GAAGTTACCGGGTTCTGGTAACATGGCTTCTGTACGTAGGAGTTCTGAAGCCTTCAGCAA
GGTATATAGAACCTCCAGACTCTCAAATGGGCAGAATGAGCATCTCACTCTTAGGGTGCA
GAGAAGCTACGTGAGAGAATGCATGTGACATGGATCACTAGCACAGAGACTGGCACAGAG
TAAACATTCATTAAATTATAGCACTAGTTTATTTCCCACCCCATACTTCCCACTCCCTGT
CCCCACACCCTGCCATGCACACATAGGTAACCACTGTTTTTAATTTTCCAGATCATCCTT
CCAAGGTTGCTTTATGAATATGCAAATAACTGCAACATGCAGCCTTATTTTCCATATTTT
ACACAAACATTTACATGCCCTACACCAGGAGTCAGCAAATGTCTTCCATAAAAGGAGGCC
GGATAGTAAATATTTTAGGCTTTCTATGACACATGGTACCTGCAACTACTCAACTCTGCT
GTCAGAGAGAAAAAACAGTCACAGACAATGAGCATGGCTGTATTCCAGTTCAACTTTAAG
AACACTTAAATTTGAATTTCATATCATTTTCTCATGTCATGAGAAAGTATATATCCTCAC
TGATATAAAAGAGCTGCTGCTTTCTGTTTCCAGAATGTATTACTCCATTCTGCGGACAGG
TCCTGATTTGTTCAGCCAATCCTCTACTGAAGGACACTTAAATTGTTTCTATTCTGTACA
AAACATTTTGCTATTACAAAATAGTGTAGCTATGAATAATGTTCATACATCATTTTAGAC
ATTTATTTGCTCATGTTTTAGGTCTCCTGGAGGTAGGATTCAGGGATGTGTGATTTACTG
GAGGAGTGCTAAGGGAGAGAAGGAAGCAGCGTGGGAAAGGCAGAGAGACAAGCAAGGACG
TGGGCCTGGGTGAATCAGGCTTTGTCCTGATGGAGGATAGAGCTTCCAAAGTTGTGCCAC
CTTGAGGCGAGAGGGCCAAGGGTCTTGAACTTCCCTTGCAGGCAGTCATAGTTTTGTGCT
TTGTCTCAGGTGGTTCCCATGGGCTAAGAGCATGAGTCAGAGGTCCCAGATGTAAGCTTT
TAGCCACCACACCTGCAGCAGCTGGGAAGGGGACCCAGGCAGGTGGCAGCACCTACCACA
GCAGGTCTGCAGGAGGGTCTTAGAGGTGGAACTGCAGTGTTGAAGCATAGATGCATTGTT
ATGTGAATAGACATTGCCAAGTTGCTTTCTGTAAGGGTTGCTCTAATATTCCTGCCAGCA
ACATCTAAGAGTGCCCGTTTCTGTATAATCTTGCCAAATGAGTGTGTTATTCAGCTTCTG
GATTTTTCCTAATCTGATGGATTAAAAAATGCTGTCTCAGGGTAGTTTCCATTTGCACAT
CTCTCATAAGGAGAACGGGTGAGCATATGTTTCTGTGTTTAAGAAACATTTTTGTATTTT
TTCTGTGAACTGTACATATCCTTTGCTGATTCTCCTAGGTCTACTAGTCTCTGTCCTTTC
TGTTCTAGGAACTCTTTAGATGAAGATTCATCTTTTGTCTGTGATATGAGTTGCATATAC
TTTCCCCATTACAGAGTGGTTTTGGCCATGCAGAGTTGTTTGGATAAGTAAACGCATTTA
GCATGATGCCTGCACCTGACCGGCACCCGATGGATATTGTTTCTGTTCCTTGCCCTACTC
CCCGTTCTGTGCTTTTTCCAAACTGGGCTCACTCTTCCTTAATGGTGGCTCATGCTTCCT
ACTTTCCTGCATATCTTTTGTTATTTTTCTAACCTGGAGTATCTTTTTGAGCTGTTAAAA
TCCTTCCCATCTCTTAAGTCCCATCTCAAATGATCCTTCCTCCCTGAAACCTTCTAGAGT
TTCTACTACATATTGTCTGTATTATATCTGAACTTCTGTACCTGTCAGCTATCACAGTCA
CGATGGGTCTAGTTATTTGCACACATTTACTTGGGCTTTTTCTGAGCTTCTGTTCCGTCT
CTATAAAATGCAGCTCTGGCAGGAATAAAGAGTTATTTTGATTGCAAAACAATGCATGTT
TATCCTGCATGATCATATTTCTTGTTAAAAGGCTTAAAAATGTAGGAATATATAATGTTT
TAAATGGTAGTTACATATCCACAGGCGTTCTCATTCCCAAGGACTAGGCACTATTTCCAG
ATCTTCCAGACCTTTCCTACACCTGTGTGTTTATTTGTGGGGAAGAAAGTGAGAAGTTTT
TCTTCAAATACAAAACCAGAAGCATGCTCTCCATGTTATTCTGCAAATAGCTTTTTCATT
CACTAATATGACATAAATAAAATAATATTTATGAGGTACCTAGCTCAGTACTCAATAAAT
GATAGCTATAACTATGCTGCACCTTATAGTGATATTTTTAAACTTTCTTTTTAGCAGTAA
GACCTTTTTGAAACAAAATAGTATAGTTGTACCTTAGGACAGTGAGCTATGCTTGGGACC
CCTGTAGATACCAAAATCTATGGATGCTCAAGTCCCTTATGTAAAACAACATACAGGGTG
GTCATAAAGTTCGCATGCAATTGAAAATAGTGTGTAATTTTAAATTACACATGAACTTTG
TAACCATCAGTATTATTTGCATATAACCTATGCACATCCTCCTGTATACTTTAAATCTTC
TAGTTACTTGTAATACCTAATACGATATAAATGCTATGCATATAGTTGTTATACCGTAAT
GGTTTTTAATTTTGCTTTTTTTTTACTGTTGTCATTTTTTCCCCCTAATATTTAGGATCG
GCAGTTGGTTAAACCTGTTACGTAGAATCCATGGATACAAAGAGCCAACTGTATTTAGAA
GCCCATTTTGTAGAGTGGGGCCTCCAGGCTGGAGTGAAGTTGGAGGTGGGGTAAAGGGCA
CAGAACCCCTCCCCCACGTGTCTCCCCATTGCTTGGTGCCTCAGGCAGGAAGTGGACGCA
TCCTACACATTTAATTTAGTGGCACCTTCATGAACACAAACTTCCCAGGAAGTTTTCACA
TAGGTCTGAAGATCCCAGCCAGCTGGGATGGGAATTCTTTCTCCCCAATTTTGTTGAAAG
AGCCCCAGAGTGCTCAGGTGAGAGCAGAAGTTGGGAGATCCAGTGGCTGCCTCTTGGCTT
GGTGCTGGTTAGTGATGGAGTTTCCATGGTCCATAATGAAATGAAGAGAATAAGGTCAAT
GTTGTGAGATTTCCACAAAGTTAAGCTGTTCCAATGTTTCTTTTTGGCATTGAAATGTCT
TTTCTTTCATGACATAATGGTAACAATGTTGGTAGTTGTGTATGTGTATTTTAATATCTT
CCCTACCTATATAAAAAGTTAGCAATTTTATATTATGCCCCCCCATTTCTTTTTTCTTTC
TTTCCTTCTTTTTTTTTTTTAGAGGCAGAGTTTTATTTTATCGCCCTCAGTAGAGTGCTG
CGGCATCACAGCTCACAGCAACCTCCAGTTCTTCGGCTTAGGTGATTCTCTTACCTCAGC
CTCCCGAGTAGTTGGGACTATAGGTGCCCACCAAAAAGCCCAGTATTTCTTGTTGCAGTT
AGGTGAGGCTGGGTTCGAACCCGCCACCCTTGGTATATGGGGCCAGCTCCCTACTCTCTG
AGCCACAGGTGCTGTTCCTCCCCCCACCACCATTTCTTTCAAAATTTTACTGATCCACAA
AATCTTGAAGTTTAGAGATGGCTATTTTGGTCCACTGTGGCAGCTTGGCCAGGACTTCCC
TGGAACAGTCCCAGAGATAATCAGTTCTGTTCTTGTGCCAGGTAAGTTTGGCAACTGCTG
TCCTTTGATGAAATTGCAGCAGCTCTTCCAAGACTGATAGTAGATGGAGCCTCTCCCAGG
GTCTGTGTTTGAGGAAGTCACCTTTTCACTGAGGTTCTCATTTGCCCTTCTTGCCACCAC
ACTGTTGTCCTTAAGGGGAGTGCTGCTTGTTTGGACCACCTGGGCCAAACATGACGCTAG
ACCTTTCTCTTGTTGTCCCACAACCAAACTCAGACTAGGATGGGGCATGTAGCCAGGACT
TGGCTAAGGGTTTGTGATTATTTTTAAGAGCAATGAGCACAAAGGTCAGATGATTGGGCT
TACAAACCCCACAGCCCACTATCTCCACCCCACCCTAGCTGCCTATGCCCTACTAAATGG
TGAGGGCAGTGGCAACCAGCTGGAGATTACCCAGGAGCCAGAGATAAGCCAAGAGCCTGC
ATCCCTGCCCACCTCTGAGGACTAAGCTAGGGCTTATGAAGGGAGAAAGCAGTCTCCTTC
TATGGGTCCTTTCTGTATAAGACAGAGGATTTATCAAAGAACTGGGGCTTCCTTCTTTAC
TTTGCTTTGAGCTTCTTAAAAGGCAAGGATTTTTAATTTCGGTCATTTAATCCCAGATCT
CCATCATAGCAGTAGATGACAGTGAACAGGGCTCAGAACACTCTGGTTATTAGAAGTGTG
TTGACACCAGATTGGAGATTGGTACTTGACTCTTCATATATAAGGACACTTGAATAACAA
TAACAAGTGGTTTGGGGGAGTCTTTTTATCTCCCTTAGATGAAGAAGAATTTTAAGTGAC
TTAGTCACATTTGCTTATTTACTTGGGGGAAAGTATTTAGTATGAACTGTAACCCAGAAC
TGTTCCCCTTCACCCATGTGATTTTAAAATTCTGGCATATATTTCAATGTGGGACCACTG
ACTTATATTTGCAAAATAATCTCATGGTCTCACTGTTCTCTTAGCCCTCATGACAGCCCA
GTGAGGTAGGGATTGCTGTTCTCGTTTGCTGATGAGGAGTCTGCAGCTTAGGGGAGCTGA
GTGACTTGCTCAAACCCATTCTGCTAATAAGAGACAGAACTGCATCTTTCTGGCCCAAAT
CCCAACCTCTAGCCTCTGTACTGCCCCGGCCAAGTCTACAAATAAGGAATGCATTGTTTA
TTTATTTGGCTTTCTTCTCCACAAAGCTACCCAATTGACCCTTAAGGGATCTGAACTCTG
GAATCTTGATGCCATTAGCACTGATTGCCAATTAGAGAAACAAGTGACAGCAATGTAACA
ATGAATAAATAACATAACAATGACAGTAAGACACCAAGAAAGAACCCAGAGTTTCCATCT
TGTGCAGGTTGTAATGCTTTATTTCAAGGTCAAGTTCAAACGTGGCAAGTGGTCTGGGCA
GAACATGAGCTACCCTTTTCATTTCTCTAGAATGCTTTGTGGTGTTGGCTCTAATCTGAG
CATAGCACCAGCCTGGTATCCCAGGGGAAGACTCCCAGTGACCCACCAGCTCACCCACCT
TTCTCTTGGGCACTCTCTTAGGAGCCCTTGGCAGGGGCAACACCTGTGGCTTAGTGGGTA
GGGCGCCGGCCCCATATACTGAGGGTGGTGTGTTTGAATTCAGCCACAGCCACAGCCAAA
CTGCAACAACAAAAAAAGTAGCCAGGTGTTGTGGTGGGTGCCTATAGTCCCAGCTACTTG
GGAGCTGAGGCAAGAGAATTGCTTAAGCCCAAGAGTTGGAGGTTGCTGTGAGCTGTGATG
GGTGAGGGTGATAAAGTGAGACTCTCTCTTTAAAAAAAAAAAAAAAAAAAGCCCTTGGCA
GGACTGGGTTTCTGGGACATCCAAAATGATGCCTAAGGTTTGGGTTCCTATTCTGGCCCA
TGACAGCTCTCAGAGCTTCTGGGGTGGCTAACTGGACCTCTTTCTCACTCTATCCTCCAA
ATTCGAGAAGTAGGGTGAGATCTGACTGCGGCCTGTCAGGGTAAGGGTCTGTGGCCTTGG
AAGTAGTACTGGGAAGAACAGTAGCATTACTATTCACAGGAGTTCAGTTCTGAGCCAAGG
GCACTGGGGAAGGTCTGGGTAGGTGCTGAGGTGGTTCGAGTGGCTCTGACATCTCTCCTT
GTTTGGCTTCTGCTAGGAAAGAATAAGAAGGAGCTTGCTCATGGCCTGAGCATCCAGAGC
TAACAGAACTAGGGCAGGAATGGAGGAAGAAACGTGTCCCAGGACCTTTTAGAGCAGCCT
ACCCAATAACAAACAACTATGTGTTCAAATCTATGAGGCAACTTAGTTAAGACATCAAAG
GATGTGAGCAGACAATTTCCACAAGTGGTAAATAGATACCTGAGAAAAATTCAACCTTAG
AACTAAAATTAAAAAGGTAGATAGAGGTGAAAGCAACCTTGAAGTACCACTTTATGCTTA
TTCATAATCAGCAAAGTATAAAAATTAATAATATGCTATGCTGGCAAGGTTGTGCTGTAA
GTGGTCTATTTATACATTTTGGTGCAATTCTTTTAGAAATCAATGTGCTAGTGTAAAGCT
GGAGCCAGAAATGTTCATAACCTTTGATATAATCATTCTAGTCATCCTAAGGTAGTAAAC
TTTTCAAAACCTTTCTTATAAAAATTTTCAAGCATATAGAACAAAATAGAACACTACAAT
GAATTCCCATATACTAAAGGAATATGGGTAAGGATGTCCACAGTTAAAAATTAAAAAGAA
ATCAAAGTATGTAAAAGCAGAATATGTGACGAAGTTGTGCTTTATCTTCAGCTAGACTAT
CAAAGCAAAGGACATGGCAAGTATGAAAATGGAATTGTATAAAGTATGATCCAAGGCTAA
GTGAAAAATGAGAAATTAAACTGTATTTATAAGAGATGAGGATAGTGTAAACTTATATAT
GTGAGCAAAGGTTAAAGGAAATAGGCAAAAAATAATTTGGTGTGTTGGAGTGGGAGATGA
TGAATTCATGTTTTTCTCTTTGATATTGTTGTTGTAATATTCTTACAATAAAAACAAATA
GGCTCATGGCTATAATCCCAGTACTTTGAGAGGATTGCTTGAGGACCAGGAGTTCAAGAC
CAGCCTGGGGCAACATAGCAATACCTATCTCTGAAATAAATTAATTAAGTAAGTAAGTAA
TAAGAGTGGGCGATTCTAGACACCGCCCCTGAATCAATCTGTGAGTGTGTATTTGTCGGG
CAAGTATTCCACGGGTTATTCATGTTAAGAGCTGTGGTAAGCAGGGACAGGGGGATAGGC
ACAGGACTGGATTAGAGGGCAGGGCCTCTCAAAGACTCAGAATGTTGGAGATACATGGAA
ACAATCTAACACCTTCATTTTACCGTCAAGAGCCCTAAGTCTCAGGGAGGCTAAGTAACT
TGCCCAGAATAACCCTGCAAAAGCCTGGCTATTCTACATCAAGGCAGGCATTTCTGCACA
GTTAACCAGCCAGCCTTAGATCAGTCCTCCTGTCTTGGGGCACCTCTATATCCAGAAGTC
AGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCCCCCGCCCTCCAGGACCAGTTCCTGAGCAAGAGGAGATG
GCACCCCAGCAGGGTCTGGACCCCTCCTCATCTCCCTGGGGTAAAGGATGCTGTTTTCAT
GTCCTAGAAGAGCAGGGCATCTAAAATCTCTGCTTCCCCCCTCCGCTCTCACAGAGAGAC
TGAGTTGTCACTTTGTGACCTCGTTTTCCCAACCAGTCAACAAACACTCATTGGGCACCT
GCTTTGTGGTAGCTTCAGGGGCCCATACAAGGTGATCTGCTTTGCCCTTATCGCAACCCT
TGACTGTCCTATTTCTGCCCAATCTGTCCTCCCCTCTTGTCTTTGCTCCCTTCATATCTA
GCCATGAACCTCAATTCCCTAGCCCCAGGCCTTCCGCCTCATCCTTCCTGCAAACCCCAC
ACCTCCTAGATCAACTCAACCCAACCAATTGTTTCCTTAGCGTCTATAGCTGGGCCACTG
CTTTCCACAGAAGAAACTGAGTAAAAACCTCTGGACTCACACCACAATACACTCTGTTGT
TGCCCAGAAACCCCTCCCTGTGTGGAGGGACATTTTCTCCCTCCATTCCTCAGCTTCTGG
GTCTCCCCAGCTCTCCTGAGTTCCCTTCCATCAGCCCATGGCTCCTCAACCTATGAACAC
CATTCCCTTAGCTGAGTCTTTACCTGAGCATTTAAAAAATTGAGGTGAAATTCACATAAC
ACAAAATTAACCCTTTTAAAGTGTACACTTCATGGCTTGGTGCCTGTAGCTCAGCGGTTA
GGGCACCAGCCGCATACACCGGGGCTGGCAGATTGGAACCCAGCCCGCACCTACTAAACA
ATGACAACAACAACAACAGAAATGGTCGGGCATTGTGGTGGGCATCTGTAGTCCCAGCTA
CTTGGGAAGCAGACAAGAGAATCGCTCAATTAAGCCCAAGAGTTTGAGGTTGCTACTATG
ACATCGCTGCATTCTACTGAGGGTGACAAATGAGACTCCGTCTCAAAAAAAAAAAAAAAG
AAAGAAAGAAAATAAAGCGTACACTTCAGTGGTTTGAAAATGGTATATTCACAATTTTGT
GCAACCATCACCACTATTTGATTCCACAAGATTTTCATCACTCCAAAAAGAAACCCTATA
TGCATTCACCAGTCACTGCCAAGTACCCCCGCCCTGCCCAGCCCCTGGCAACCACTGGTC
TCCTTCCAGCCTCTGTGGAGTTGCATATCCTGGACATTCATAGAAGTGAAATATGACATG
TCTATTGTGTCTGGATTCTTTCACTTAGCGTGTTTTTGAGGTTTATCTGTGTGGTAGCAT
GATTAGTCTTTTGTTTTTTCCTCTGGTTGATGACCCCCTTTTGTGCCTTTTTGAAGGGGA
GATGTCCGTCTTGTCTAAGGCATACGCCTCCCTTCTTTCTTGTTTCTTTTGGAATGCTAG
GCATCGCCGCCCTTCTGTGTCTCTGACCTGTTCCTCTCAGCCCTCCGCCTTTAGCATCTG
CACTTGCCTCAGCTCTGCCAGTCTCTCTCTCTCTCTCTCTCATCTCATTTCTCTGCTTCC
CCCGGCCTCCTCTCTATCTTCTCCCTTCACAGTCAAGCTTCTGGAGCACAAGGTCTTCAT
ATACTTTTTCCGCTTCCTCCTCGCTCCTTCCTTCCTCAACCCTCTGCCTTCTAGCTTCCC
TCACCACTCTCCCCCTACTGGATTAATACCTTTCCTTTGCAATTCCACTGCTACCATCCT
GATTAAATGAAGGGAACTCAGCTCATGCTGCTGCCATGACCTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGA
TGGACACTAGTCCCATGGACCTTTCTAACCAGGCTCTGGTGGTCATGGCTGTGCCTCTCA
GCCCTGCCCCCTGGACCCAAGCCCTCTCTCTGCAGGGCTGAACCTCACAGAGAAAATCAA
GAAGATCAAGATCGTCTTCACTCCCACCATCTGCAAGCAGACCTGTGCCCACGGGCACTG
TGCCAATAACTGTGAACGGGGAGACACCACCACCCTGTACAGCCAGGGTGGCCATGGGCA
TGATCCCAAGTCTGGCTTCCGCATATGTGAGTCCCTTGCCCCTGAGGTGGTTTCCGGTAG
CCCTAGGGGGTGGGAGGCCAGAGGACCTGGACTGTCCAGGACTCAAGCCCACAGCTCTTA
TGCTGTGGCCCCATGAGTTGTCCCAAATCACATGGAGAGCTGAGTCCTCACCCACCTCTG
TTGCAGCCTTGCTGTGCGACTCTGGGGGCTCCCTAACCTCTCTGAACTCAAGTCTCCTCA
ACAGAGGAGTGGGGGAGTTCATCCTAATGCCACTGCCCTGTCTCCCGGGGTGCAAGGGAG
GGCATGAAAGGGCTTTTTAGAAAGGCAGGAGCTAGTTATTATCTCCCCTTCTTCACTCCT
GGGTTTTGTGAACAGTCCTTGCATTTGGGGTTTTGGGCTACAGAAGCCATCCAGATTTGG
GGTCCTGCTGCCCCTGTTTGTCTGTGTCACTGGCTGACACAGGGTGAGTACTGCTGTTTT
CCCACCATTGGTTACCGTGAGGGTCGATGTTGCAGATTTCTGCCAGATCCCCTGCCTGAA
CGGAGGCCGCTGCATCGGCAGGGATGAATGCCAGTGCCCCACCAACTCCACGGGGAAGTT
CTGCCACCTGCCTGTCCCGCAGCTAGACAGGGAGTCTCCAGGGAGGGGCTCCCACCGTGG
GATCCTGCTGGAAGCCCCCCTGAAGCAGTCCACCTTCACATTGCCTCTCTCCAACCAACT
CGGTGAGTGCTGGTGCAGCCAGGACTGGGCAGAGCACCAGGCTCATGGATGTGGTCAACG
GTCACTGTTGCTGTGCTGGGTACAGGGCAGCTGTCTCCAGCCTGCCTTTACAATCAAGCC
TCCCTGTCTCCGCTTACCCTCAGCATCCAGTTTCATTCCTTAACTTCTCTTTCCACTCCC
CTCTGAATTCACCCACATGTTTTTGCCGTTGTCCAGTGCTGGGGACCCTGGGGAACAAAT
AGCAGGAAGCCACAGCCCCAGACAATAAAGGGAGGATGGATAGGAAAGAGAATATCAGAA
TAAAACATTTCATTTTCCCTGCCTTCCACAATTAGGTGCCAAATTAAGAAGACAAAGATT
CAGATTTCTCTCAGTGGTCAGGGGATAGAGAGGCCCCTGAGCCCAGAGCTCTGGGGAGGC
TGGGGAGGGTAAGGACTGCAGTCAGGTCCTAAACAATGGGTAGTCTGTGGGTGAGCAGAG
GGTCTGGTGTGGCAAAGGCAAGGAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCAGGTGAGAAAATAGCTCCTGCCTCAGCCCTGGAGGCTTCTACAACA
GCCATTGCCCCCACTATGCCCTTCTCCTCCTCTCTCTCCTCCTTGTTCCTATGGAATATG
AGTGTCTGCGGTCTCCCGTCCCCAGGTGGGAAAACCCAGGGCATAACATTGCCTGATTAG
GAAGAGACTGGGCCTCCTACTAGGCATGTGAAGAGAACCCAGGGAAGATCCCCTCTGGGG
GAGCTATCAGCAGCATCCTCGCTGAAGACAGCCTAGAGTTTGGTCCTAGTTTTTTCTGGA
CTCTCGGAGAGTTATGCCTAGACTCTCCCAGCGCATAGACATTAGGGCCATTAGGATCTG
GCAAGAAGGAGCCTGGTATCCAGTTGAGACTGAGGTCAAGAGAAATGGATTTAACAGATG
GAAGTTATACCCCAAAGCCCTAGTGGTACAAAGATGAGAGGCTCTCCAAGCCCCCAAAGG
CATCTGCAGTCCACATGGGAAGCCGAGTGAGCTGCTGTGAGGCCAGGCACCCAAGAATGG
GGGTTAGACCAGACCTAGCATGATTTTTCTTGGGGGATACAGTTTGGTGTTTTCAGGGAA
ACTGGAAGAGGTGTGGTAGCTAAGGAATAAGGACCCTCAAGTTCCCAGATTCTCCCTGGG
CTCTCAGCCTGTGGTGTCCCTGAGCTGAGGCTCTGCACACATAGAGGGCCCACACTGGAG
GTGACCTTGGAGTCCCACAGAAGAAGCCTGTCCTCGGGGACCCTCTGCCTGTAGGCTGGG
TCTGTGGAGGCTGGTGGATTGCAGACTAGCACAGTGCGGCTCTTTGAGTCTGGGGTGGTT
CCCCTGCAAACACAAGGTCGAGTCAGGTAGAGTGGGCTGTAGATTTCTCTGCTCCTTCTG
GGACATTGGCTGACTCCCTTCCCTCCTTGGGTGGGGCATCCTCTGGAAGAATGTGGGGAA
TGAGCTCAGTGTCCCAGGCTTTCCTGGGTCATCTGTGTACAGTAGGGAAGAAGAGGGAGG
GTCACAGGCAGTCATGGCCTCTTTTCCAGTGTGCCAACCCTCTGCTTGAGCTGACTGCCC
AAGAGGACTGCTGTGGCAGTGTGGGAGCCTTCTGGGGGGTGACATCATGTGTCCCATGCC
CACCTAGACCAGGTGAGTGTTGAGTGATCTAGGGGGAAGCTCTTCTTCTGCCACCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCCCCAGGC
CTCCTCTACCTCTTCACCTCCTGTCTGGCCTCTCTGTCTTTGAATCAGGGTTGAGTGTCT
GTCCCAGAATGTCTTTAGCCTTGGGGTGTGGGAACCCCAGTTTCTTACCCTCTTTTGGAT
GGTGAGGAAAAAGTAACATACATTAATTCACTCTTTCATTCATTCAGCAAATACTCAGCA
TGTGTGCCAAGCACTGAGGATTCAGGAGTGAGCAAAATGCCCATTCATGCTGTTCTCATA
GGTCTCGTTCTTGAGGTTGGGAGGGGGGTGACCAGGTGCTTGTGCCTGAGCATGGCTCTA
CTGGCTCAGTCTGGATTCCCCTCCACGCCTCATTCCTGGCCTGGGCCTGGTGTGTATTTC
CCTTGCCTGACAATAGTCAGCTTGATGAGTTGGCTTTGATAGTGGTGGTGGTGGGGAGCT
GGACAGGAGCCCCAAGGTGGGCAGGGCAGGGCTATTCTCAATATCAGACTCAGCTATGGG
GCAGTGATGATATTTTCCAAAATACAAATAAGTGTAGATGATTTCACAGTGTGATAGGAG
TTTTGGTGAAACAGCCAAGGGTAGTAATCAGCTTCCAGGCCTGAGTGGCCAGCACATACC
AAGTACCAGTCCCAGTTCTGCCTCTGTCTCCCGACCTATGAAGTGAGGACCATGATAGTG
TCAGCCTCAAAGGGCTGCTGTGGAGACCAAATGAGACAATGCGTGCACTTAGCATTAGTT
CGGCCAACTGTAGCTGTGACCATTATCATCACTGTTATTATTAGAAAGTCCCCCTGAAGA
AAGGGAAAAGCGAACGCCCCCCCGGAGAAGTGCATTGAACTTCTCAGTCTCCCCTGCGGG
CCAGAGATGTTTTCGCTGCTTTCCTTCCTTCCCTGTTTCCTTTCTCCGTCCTGTCAGGCC
GACCCTTGAGATATCTGTATCCCACATTCGATTCAGTCAACAAATATTTACATTGGCCAA
GCCCCCAGCTGAAGTGCCCATAGTGTGCAGGCCCTGGACAGACAATGGAGAATGAGGTAA
AAACAGTGCCTCCCCTCTCCAAGCTTACAGTCTACTGGGGGCCCACAGACAGCCGGTGGG
CCTCCGAATAGAGAGGTTAGCAGAGTGACGTGTTAAGTGTTGAGTACTGTGGGAACAGGG
ACAGCAGAACCCGGGCCACTTATAAGTCCAGTAGCACCTTTGTGAAAACTGCAAAAGCTG
CCCCTTCCATTTGTTCAGAACCCTCTTCATAAATATGCAAACGTAGAATGCCAATGATTT
CTTTCCATGTGGTACTTTTGTCAGCGCACGCGTACGCAGCAGGGGACAGGGGCCCTAGCT
CAAGCTGGTGGATCAGAGAAAGATCCTTAGGGAAGGTGACATCTCGAATGAGACTTGAAG
AATCATTAGGGGTAAGACAGTCAAAGAGGTGGAAAGTTTAACAATTCAAGAAATTACACA
TGGAGTGAGACCAAGAGAGTGAACCCCATTCTCTGGAGCCCTGGCTCTCCTGCAGGAAAG
CAGGCATGTCAAAGTGTTAGGTGGAGTCAGGGCTTCCAAGCCCGTCTGGGCAGGTTCTGG
TTCCCAAGAGCTGCCTCATTTAGGTAGGTGGGTGGGGTCTCTCTCCTTTCCCATCAGCCC
TCTGAGAGGCATCTAATACCTGGTGCTGCTGACCCAAGTGCTGACCTTCCTGGTGACTTC
CTGACCCAGTAGGGCTGTCCTGGGAGGGAGCTGACTTCTCTGGGTAGGAGCAGCAAGGTT
TCATCCATGTGGCAATTCAAAAGTAGCCTTAGAATTTTCTCCTCCTTGTCTTGAGGCCCA
GAAGCCGTCATAGTGTTGCCTCTGAAGTCTGAGAAACAATGAAAGGGAAGAATTAGCTCA
GCTGCCAACAGCTGTGGGTGGCAAAGGAACGGAGTGGAGCAATGCCGCTGAGAAAGGGCT
CGGCAAGGGGCCTCCCTAGGCTCCTGCTTCATTGCTGGGTTCAACTTCCTGTCTTCCTCA
CACCTGAGGTCTGGGCCTCTCTTAGAACCTTCCCTCTGGAAAAGCCTTCAGGGTCTAAGG
GGTCTGAGGTTCAGCCACTAAGCATGATCCTGAGCCCTGAGATGCAGCCTCTGGATGTGG
GGGACAGCATTAGGGTCCTGCAGGGTCCTTGGAGTCAGCACCTCCTCTTCAGTTCAATAG
GTCAACTTGACAGTCATGTTAGTGGCCAGAGACCTATCAGGTGGGAATGAAAATGAAGCC
ACTCTAGGTTCTTTATTTAAATGTCACATCCAGTACTTACAGGATTTAAGCAGAGAATGG
GAGCACAGGACCCTGCCTGTCCAGGGCACCAAAGCCCATCAGAGATGCAGAGATACAGGC
TATAAGGTCCATGCCAGGGATGGCTGCTGTCAGTGGAGGATCCTGGGCCCATCCCCCTCA
GCCAGGGCTGACATGCACTGCAGCCATGAACCCAGATCTCAATCAGTTTGGGGTATGGAG
AGCCCTCACTCAGAATGGAGGGAACAAGAGAAAGGGCCAGAGTCTGTACTTCAGGGCTGC
CTGCGCACCCACTCCTGGTCCCACCTGTGTGCCAGCCTTGATAGCTCAGCCTACATGACA
CCCAAGGACCCTGTTCCCCACAGGGCCCAGAGCCCAGTGGTGGTGGATATGGTAGCAGAT
CTCCATGGGTCAGGTGGCCCCACATGCACACGTGGGTGTAGAACACCAACTATACCCTTG
CACACACATATCCATGGCTCAGCCCTTGTCTCCACTCCTCCCCCAACCTGCTCAGCACAT
CTCAGCAACTGGGCATCAGGGTACAGACCCAGATGTCAAGCATGCCAGGCACCGAGCAAG
AAATACAAAGACCAGGGCACATAAACATTTAAAACACATGAAGTGCAGCTGGGCACTGTA
TAGAGAAAGGGCAAGACACTGCACCTTGTTTGTGTTGACAGGGTGCCAGGCACCCCACAC
GCTGGGGCCTTGGGCGAGGGTGGGGTGCCTCTCGGAGTAAGCGGGACAAGCAAGCACCTG
CACGGGAGACAGGAGGAAAAGGCTTGGGCTTAGGGGTGGCTGGCAGGACAGGCAGCACTT
CTGGCTTCTAGAACACCCTCTCCTGCCCTGGCTTTGCCTCTCTGAGCCCCTGTTTATCCT
CTGATAATAAAATAGGGTTATGCCTCTTGGGGAAGGCTCTGTCTTCCCCAACAAGGTGAT
GGGAGTGACAGAGTGAATTGCCTGTGAGCATGTGACTACATGGCTTTCTTTCTCTTAATC
ACCTTTTGGCTTTTGAGGCTCTGTGTTGGACTGTTAAAGAATGAAGAATGCTGCATAAAG
TCTCAGTTGCATGGCTCAGACAAATACCTTTTCTTCCAGAAGATTCTACAGAGCCCCCTT
CCATAGAGAGGTGGCTCAGAGAGTCAGCCTAGACTCTGGGTCCCCTCTCCTCCCTTCACT
CTGAATGAAGGACACAGTTATGTGCCCTGCTGACCTGCCAGGACTTAGCCTGAGCCATGT
CTTCCTGACCCCTTGGGATTTAGCAAAGGTTGTAGCTCAGAGCCTCTTCAGTTCCCCTGC
CAGAATCTGGAGAACACACAGCTTCAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGT
TTCGAGTAAGCACACTCACTTGAAACTGAGCACAAAGGACCACTTATTAAAACTGCAGAT
GCCCAGCAATAAAATGGAGAATGCCTAGAAGTGCTGGGCTCCCAGTCACAAGGAGTGTGC
CTACCAAGAACAGGGTTTTCAAAGGATGTGGGGAAGGAAATTAGTTTTTGAGGGAACAGA
GGTTTATATATAAATGTTGGAAAATTTATTTGAAACCCTCAACAGAAAGAAAGATTTGCC
CTGATTTGTCCTGAGCTTGGCCATAAGACGTGTTACAGGTACAGATCTGTGGTGCCAGCC
CCCAGGGAGGGTGTGGACATGAGGGATGTTTGGAGCAGAGAGCCTTAGATTAGGTCACAG
CGGCAATGTCATTATTAACAGTGTCGTTGTCATTAGCAACCAGTTATTCAGAGCACTCAC
AAGTGTCAGGCACCACGCTTGATCCTCCTCTCGTTGCATCCTAACAATATTTCTCGGCGT
TGGGTGCTGTTATCTCTATTTTACAAAGAGTTAAGTCAGCCTGAAACCCCAGGTCTACCT
GACTGCAGACCCCCATTTCTGCTGCCCTGTAATTTGCCTTCCTGCACTGCTTCTTGTGAA
CTTGGCTCAGGCATTTGCTAAGCCAGAGGACCCCGGCTTGGGGAACAGCTGTGCTGGGGT
GGGGCTCCTGTTCTCTGGACTCTTGGGGAGACGCCCAGTCCCCTACCCTAAAGAAATGCA
ATTTTCAGAATTCCAGTTGTCAGCCTGAAAGGGCAGTGTCTCTTTGGCTCAAAGATGTTC
TGAGAGCTTCTTCCAAGGGACTTGGAGCCTCCTGGGGATTGTGCCACAGGCTTAAGTTAG
CAGCCTCCCTACCCCAACTCCAACTGACACGTGGCACCTGCAGGGCTCAGGAAGTGCTGG
GGTGGAGGTGGCTGAGTGGCACTGTCTGAGCCACAGGTCTAAGCAGAGCCCTCTCTACCT
CACAGTTTATAGTGGCTTTAATTCTATCCTGCTCTGGGGCAGCAGTCAGATGCCCTCTTT
GGGTGAAATGTCCATTATCACTGAGGAACCCACCGGCACATCACACACTAGGAAAATGAG
AATAACGGACCTTGTGACAATCACCCCAACTCTGCAAGTCGCATNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTTCTACATAGCATATAATTTACTTATTATGTGCGT
TTAGCATCTGCTCTTTTACACCAGTTGCTATGTGAGCTCCTCAGTGGCAAGGATTTTTGT
TTTGTTCACTGACATAGTCCAAGCTCCTAGGACAGTGCCTCATCTATAGTAGGCCCTCAG
TACACAAATACCTACTGAATAACTGTAGAATAACTGAAAATGCCTGTCCTAATGCATTTT
CTGTTACTGCCCCTGGAACAAAGAGATGGTCTTGGGCCTATTCCCTTCTGGTGCTCGGCT
CATCCCCTCGCATGTCACTGATGAAGGAGGGGCTCTCTTAACCCTCCTAACAGGTGGTGC
TTGCCCATCCTATGCCCCTTGGTCTTAGGGATCTGAAGTCAGAGCAAGGTGAGGGTGACT
TATCTCCTGAGGGTGGCCAGAGCTTCACAAACCCTTAGGCAGGGGTCCTCAAACTTTTTA
AACAGGGGGCCAGTTCACTGTCCCTCAGACCATTGGAGGGCTGGACTGCAGGCCCCGGGA
CGAGTCGGCTGCTAAGCAGGACAGGCAGCAGCGGCAAAAACACCTGGCAGGCTGGATAAA
TGTCCTCAGTGGGCCACATGTGGCCCCCTGCGGGCCATAGTTTAAGGACACCTGCTTAGG
TGTGCCAGGAGTCAGGTGGGGAGGCTGTAGCAGTTATAAATGGATCTCCTCCCAGTTCCT
CCCATGTCTTGGTCCTTAGAAGAGCCCTGTGAACCCCCTTCCCTGGGGCTGTGGGTTTGA
AAGATGGATACTCACTGTAGGCCTCCACCCAGATCAAATGAAAAGGTTTTATTTTTCCCA
AGTTCAAAGTTGCAGAAGCCCTACTACTCCTCAAGGGGAGTAGAGAAAAGACCATCTCAG
CTGAGGACTTCCTTCCCCACCCATGCTCCCTCTCCCTGCTATTGCAGAGGGTGGGTTCTG
GAAGTGCAGATGGACCACATAAGTTTTGTGGAGGGTCCCTTGGCACTCAATCCCTGCCAG
CCCCAGTCCATCCCTACACAGCAGAGACCGCTTGGCATAGCTGGATGGGTCTGAAGCACT
CTGCTCCAGCCAGGTCTAGGAGGGAGGCAGGCTGTTCTACACTGGAACTTTTAGTTGCTG
GACACAACACTAGGGGTGGTTCTTCATACTACAGTCTCTGTGATAGATAACCCAAGATTT
GTGCAGTGCACAGCTTGAGCAGCTGTATGTCGTGACTCTAGACACAGCTTCTTTCTGGGA
GAGAGAGATGTCTCTCATTCTCCCACAAAGCTTGTTACTTCTGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCACAGCTCACTGGCTACTGAGTCCTCACCCCGAGCCACATGACCACCTACATT
TGCTGCGTTTCTTTCTCCCAAGGAGACTGAAGCTGACTTTTCTGGATTGGACACTGCACT
TGCTCTTACAGAAGCTGGGATCTAGCTCTAATAGGGCACTGGGGGGCCTGATTTGGGGTG
GGGGTGGGGTGTTCACAAAAATGAGAGCTTCATCTGAGATAGTGGCTTGGCATTTCCTGC
CTTCACATTCAAGCCAGCTAGAGGACAGAGTCCCCTTACCAAGAGGGAAACCACTTCATA
GAAAAAGTCTATATGTGTTTCCAGACTAACGAATGAACCCAAGTCCTCTCAGCTCAACAC
ACTCTGGAGTTCTCAGTTTCCTGCAGGTCCCAGCAGGTGCAGGGTCCACCCTGACTCCTG
TTCTAATCCAAACTCTCAGCCACTTTTCTCCCGATCATTAAAGAGACGAGGACTTTTTGC
CTAACTTCTCCCTCTTGAAATTTGGAGAGGCAATGCTGCCCTGGTCTGTTTCTCTGTGAC
ACATTGTCTCTACTCTCTGTCGCTCTCCTCTCTCTCTTTCTCTCTCTCTCTCTCAGCAGT
GAAGAGTATTGGGGAAGGATATGGCCTTCAAGGTCAGAGGCCTGGGATTCAACCCTGATT
CGACTCCAACCAACTTTCTCACCTGGGCAAGTTATTTAACCTCTTTGAAGCCTTGCTTTC
CTGAACCGCCCTTACGAAGTTATTGTGAGAAACAGAGGGGACAATGTGCACCCATGGCCT
TCCATAAGCGTCATATTAACGTTAACTTGGCATTATTTCTCAGCCTTCTGGCAAGAGCCT
TGCAATACCCTTTCCCACCTGCTGCTCTTCATAATGTTCACAGGCTGCATTAATCAGCTT
GCTATCTGCGTTTCTCCAGACAACTCCCTCTCTTTCTTCCCTCCTCTCGCTCCTCAGTTC
ATACCACCAGGCCCCATGCCAGGGACATGCACATTTTCCAGCCTCACTCTCATCTTTCTG
TTGCAACTTCAGCATTTGCAGAATCCACATGTTTCTCTATAAAAGTGGTCTTCTAGGCTA
GAGCCTAGTCCCCATGGTGGGATACGAGGGCTCAGAGCAAGACAGGAAAAAATATTAGAA
CTTCAATTTACATTTTTCAATCCTAAAAAAATAACAACTAAGTGTTACCCATTATGTCGT
CCCTTGGTCTACCCATATGTCAGACCATCGAGTGTCATGTTTGGCATAGGGTGTGTCCTC
AGGGAAGAGTGGGGATTCCAAGAAAATGTGACACCTCCTTATGTCTGTCTTCGGCGTATT
ACGACATAGCGCGGTTCATGGTGCTCAGTTTACGGGACTTTTCAGTTATGATGTCTAGTC
CTCTAAACCAACCCTCGCAAAATGAAGAGATGTCTCTAAAAAACTCCTGCAAAGAAGCTG
TGGACTCAAAATAATGTGAATAACTTATTTGTATACAGTCATTAAAAAAGGCAGCACGGA
CACTTCTCAGAAGGCCTCTAACATGTCATTAGTCATTACAAGGTGAAAAGAATGATGACC
TATGAGATGTGACCCAAATGTACCTCAGGGTCCAAATGTATAAGGAGAAAATGTGAAATA
TAGAGTTAAATGTGCTGTCATTAATAACAATCCTTGTCTTAAGTGTATAATGTGCCCGCA
GGTAGCAGTTAATGATGAAATAAAAGTTATCTTTATTAGGAAAAATTTTAAAACACCAAG
ACACTCAGATTTTGGTGTACCATTGGACAGAAGTATAGATATTTCTAACACGTCTCTCGG
TATTTGCAAGAATCCGTTTCAACAAGCAAATGTATGAAGAACTATATTTTTATAAGCCAC
CTAAAGAATAAACCAGTGAATATATATTCTCTTTTTTTAATTATGGAAGAATGTTTCCTT
TTGTTTTTAAATTTCAGATAAATATATGGGGATAAACCATTAGGTTCCGTTGTTTGTGTT
TGTTAGGTAAAAATCCAAGTTGTCAGTGAACATATATTCTCAATAGTAAATGACCTTTTG
GATGAAAATAATCTTTACAACCTGCTCTGTAAGTGTGGCCACTGATGCTACATCTATAGT
AAGAAGGAATTGGGATAAGTTCACAATGATGGAGAGTGCTGTATACGCAGTGTACGGAGA
CAAGCTATTGTCACAAAGAAATCAAAGCCAGAGAAGATAGATTGCACAATGGCTCGACGC
CTGGGGCTCAAGCAGCTAAGACACCAGCCACATACACCTGAGCTGGTGGATCTGAAACCA
TCCCGGGCCCGCCAACACATGACAGCTGCAACCAAAAAATAGCCAGGCATTGTGCCGGGC
GCTGTTGTCCAGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTTTTTCTGTGCCAGCGTATTACACTC
AGTATCATTTTTAATAAAAGCAAAGTGGGCTGAGAGGAGACTGGTGACAGCTGGGAGATG
CAGCTGCCCAGGGCAATGACTTGGGGGGCCAGGCTCTCAGCTGCAGGGTGGGCTGAATGT
CCAGATTGCACACCACCTCCCAGCATGGGTGACAGAAGAGCTCAAGGGCCATCCAGTGAG
ACCTGTCTGTGTCTTCACTCTGCAGCCTCCCCAGTGATTGAAAATGGCCAGCTGGAGTGT
CCCCAGGGGTATAAGAGACTGAATCTCACTCACTGCCAAGGTAGGATGTCTGGGGCTGGG
CTTGGGAAGGGGAAATGATGAGGCCTATTACTGATGTATGGGGATGCCCACACCCCTAGG
CAGGAGGAGGATTTCACGCCACTGGAGTGGTCTCCACTGGGCACTTCTAAGCTCCAGCTT
AAGGGAGAAATGGGGGCTGCTGGTTCTGGGGGGTCTAGGGAAGTCAGAGACTTGCTTGAG
AGTAACAGAGGGAGTCCTTCCCTCCCCCATCTACACTCACTGCCACCTAGAACATGGGCC
AAGTGCCTCTTTAGGTGCTTTGTCTAAAGGTGCTACCCTGATCCTACATATCAGGTGTCA
TCCTGAGCTGGTGACACCTTAAGCTGCTTAGGCCTCCCTCCGACTGCCTCAACGCACAGC
CAGAAAGGGAAAGAAGACTCCCTTCCTGGGGTTCCAGATTGGGTGAGCTGTCAGAAGGGG
AAGTCACTGGGGACAGTTTAGATAAGAAATGCCCTGTTGTGGCCATCAAGGGCCAAAATA
CAGATTTCTTCCAATATCCACTGTCCACTAGGCTCAGACCATTGTTCCTATGGGAGCCTG
GCCCCAACTAGGCTGGGCCAGAGGCTCACTCTTTTGCCTCTTTCAAGCACCTTTCCTTAT
CCATGGGCTGGAGATCACTTCTGCATCCTGGCGCCCCACAGGTAGGCAGTCCGGCCACTC
AGGGCTTCCTCAGACTCCTCTCTCCTGAAGAAATCTGGAGGAGGGGTACTGGGAGGCACA
GTCTCTGTTTTTGCTGAAGACAGACAGCTAAACAATTTTATGCAATGAGTGAAGTATTCT
AGATAGAAGGATGGACTCACTGAGTGCTCTGGGATCTCATGCTTGGAGCCCCTTCCCAGA
ATGGGAGAATCAGGGAAGCCTTCCTGGAAGAAGCAGTACCTAAGCCAATACTCTTTAGAA
AATGAGTACAGGTTGGCTGGCTATAGGGATGCAAGCTCTCTAGGCAGAGGGAATGGCATA
AGGAAAGCAATAGTTTGGGGGTGCCTTGAGTGTCTGAGAGGGCACTATATGCATGGCCTC
TATGTTAATACAGGAGATGCCACAAGCATGCCAGTGTCTCCTCAGAGTCACCTGCTTGCC
CCATGGGCTTTGGGAAAATGGTGGATGGCGTCAGATACCATGTATAGGGGCTCCTTGTAG
GAGGTGATGGGGAGTCCAGAAGCTTCTCACGTAGAGAGAGACAAGTCACATTTGTGTTTA
GAGGCATCACTCTGGCCACAGTTTGGAGGCCTTGGTGCCCCCTCCTAGCTCTCCACAGAA
GCTCCCAGGCACCCCAATGGGGCTTCCTGCCAAGGAGTAGCTCCCCTTGGTGCCCAAGCT
CAGTGCAAGTTTCCCCAAACCCTGTGGGTGTGCTGATGATTCTGATGACACTGGGCTACC
TGTGCTATCTCCTGGAGCTGCATAAGGGTGCCCTTTGCAAACCTTTCACGCTCATCGTCT
CTGCTGCCGTCATGATTAGCAGTGGAGGCGCCATCACCAGGATGCCTTCTTGAAGCTTAG
AATATGAGGGCTGGGATTTCTCCTCCGCGGGAGGAAGTTTGCAGCATGAAAATTTTTGAG
ATTGCAGAGGGAGCTAACTTGGCTCCCTTGTCTGAAGAGCAGCATGAACATCCACTAGTC
TTGGGGGCATGTGTGTGGCTTGGGGTGTTCACCAGGACCTGGAGGCACGGCCCCTAACCT
CTGCCTCTGCCTACCTTTGCTATGGCACCTGCTCCCCTCTTCCCTAGACCCTTCAGTACC
TCCCTTCAATCTCTGGCCTCCTCCTTGCCAGGGGCCTTTTAGTTCAAAGCAGACATGTCC
CCAGGGTCTTGGGCCCTGCCACAGTGCTTGAGGGGCCTCTGGAGGATGGTTGGACGGAAG
GAATGTGGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTACTACTTCACTTTTTGCATTAGGCA
TTTCTTCTGGGGCTCTATAGTTTGGGGGTAATATTTTCTATTTCTTCTAGTTTTTTGTGT
AATCATTTCTGCTCCGTGTGTTGCCTCATTTATGCTGGAGGAATGATACTACTCTCGGCT
TTGGTGTCTAGCTGAGCCATAGCTGCCCCTTGGTTGCCAAGTGACCTTTATTAAAGGACT
GCCTGGAGTATTAATTATGCGTTTGCCTAACCCCAGGCCTAGTTCATGGTGGAGCAGGGA
TTTGAACTTAGTCTTCTGAGTCTTGGTCCTGACTGGGACTTCTCCAGGATGATTCATTCC
TCAGCTTACCCGGTGTCCTCTTCACCCCACCCCTCATCCCCTTAAAGTCCAGTCTCTTCC
AACCTGGCATGGCCTCCTCATCTAATACACAACAGACTGTTCTTTAATATCTTCTATCAA
AGTACAAGAAAGGGGACAGAGGTGGTGGCATTGCTATGACCTAAGCCAAAGCATAGCTCA
AAGTCACTCCGATCCACAGTATTTTGATTCATTGATTCACTGTTCAATTGATTCATTAAT
CAACCTGCACTGAGCATCTGTGCACACCAGACACCGTGGGGGGTGCTGGGTGACAAATAT
GACCAAGAGGAGGTCCCTGCCCTCAAAGCTCCCCATCAGGCCTTTGGCTCTCACCTCATC
CCACCTTCTCAGGAAGGCCATGGTGCTCAGAGCACTCTGCTTCCCACTCAGCCCCAGCAC
ACACAGGCTTGCAGCAGAAATATACTGGAGACAAGCAGCTGCCCTCATTTCCTGCTCTCA
GGTTCTCCACGTGTAAGTGTGGAGTCCAGGGTCTCATCCAACAGTGACTTGAACAGTTGC
CGAAACACTCCTCCTAAAGTTTTTGAGAACGTTTGCAGGGTCCCAAACTTCCAGCAGGAG
ACATGGGCCAGACCTATCTAAATGCATGTGGCCACCACACCTCCGCCCCCTGCCCTCTCT
CTGTTCCCTTCCCTCCCACTGACCGCTCACCCACGCATGTGTGCCATGTCTGTTGCAGCG
GACAAGGCCATCTCCATGCTGCAGGGGCTGTGCTATCGGTCCCTGGGGCCTGGCACCTGT
GCCCTGCCGTTGGCCCAGCGGATCACCAAGCAGATTTGCTGCTGCAGCCGTGTGGGCAAA
GCATGGGGCAGCAAGTGTGAGAAATGCCCCCTGCCTGGCACAGGTAACCCTCTGCCTCTA
TCCCAGCTCTGACCACTAAGGGGCCTCCTCAGAACCAGTGGCCATATTCCCTGGCCTGGG
TAGACCTCCCTGAAGCCAGAAAACTCTTGGTCTTCCTTCCCCGTTCATGTGCTTATCCCA
ATCTGGGGCTCCCTCCCTCCCTGCTGCCACAGTTGTCTCCCAAGGGGAGGGAAAGGAGGC
CCTGGCTTCCGGCAGGAGTTGCTCTCTCAGAGTGTCCTCTTGCTGTCGGCTTTGCAGAGG
CCTTCAAGGAGATCTGCCCTGCTGGCCATGGCTACACCTACTCGAGCTCAGACATCCGCC
TGTCCATGAGGAAAGCTGAGGAGGAGGAGCTGGCCAGACCCTTGAAGGAGCAAGGGCAAA
AGACCAGTGGGACGCTGCCTAGGCCAGCAGAGAGACAGCCACTCCGGGCAGCCACGGACA
CCTGGCTTGAGGCTGGGACCACCCCTGATGAGGGTATCCAAGCTGGGGAGATGCATGAGG
GATTCCCTTTCCCCCTAAACTTATAGCACCTTAAAGAGGCACAAGCATTTATCCTGGGTC
CCTGAGAGTCCCATCTCTGGATCATAAGGAAAGGGAGATCAGAGCAGCAGCACTCAGCCC
TGGGAATCTTCTGTCATGACCTGGCATGGAAGGAAGGCCTAACTCACCTCCTCTCCCACT
TGGGGTCAAGATGGGAGCTGCTTGTAGAGGAGGGAGAGGGCAGCAGCAGTGTCCACCCTG
CTGATTGGGCCTTTCCATGCTTTGTCCCGGACCACGCAGTTACTGGGACTAGTGCTCTCT
GTAGGCCTGAAGAGCTGGCAGGTGGACCTGGGGAGGCTGTATGCTTTAGATCTTAGGCAT
GGCTCCCCTGCGTGGACCAAGGAGGCCCAGGGCTAGAGAGAGACTGTAGCAGAGACTGAG
GCTCTCCAGAAAGGTGCCTTGGAAAACTGTGGCAAAGTCATGACCAGGTAATACTGAGTG
CAGGAGCCCCCTGGCATATTAGAGCCAGGAGAACTATGTGATTTCTAAAGTTGCTCCAGG
AATCTGGAATAGACAGGAAGTGAGGATAGATCTCCAGTTTCATGTGCATTGGACACTGGC
CAAGCCAGAAGCATCTTCAACCCTTCCTGGAACTATTCTCATGGCCCAACCCTGGGCAAG
AGTCTGAGGGACCAACCCAGTGTGGCTGGGAGGCATTGGGGGAGGTTGGCTGCAGGGTCA
ACTGGGGAACTAGCCTAAGAGAAGGGGGACTCCAGTCACTGCAGGCCTTAAATGAAAGCA
GGGGCTTCTTCTCAGGTCCTCCAGACTGGGATTCTGGGATGATCCTGTAGTGGCCAGTCC
CCACCAGGATGGGGGCAGGGGCGGGCACAGAGGCAGGTAGGAACGGTCATGCTCTCACTG
CTGCTGACCCTGCTGGGGACACAGTAAGGGTGCAATAGAGGAGAGAAGGCAGCCAGACCC
TTCTCCTGGAGCTCACCCTCTCACCTTTCCCTTCCCAGGTGACTCTCAGGCTGGACAGGT
AAGTGAGCCTTCCCATTAGGGAGGTGGGTGGCACAGAGTGAGAACTGGTAGCACCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTT
CTCCAGGCCAAAATGCTAAACCTTGTCTTACAGACCAACAAACCTAGATGACTATCTCTC
CTCTTTACTACTCCATCCACGACTATGTTGAGGGACACCAGGTACCGGAATGGTGTACGG
GCTTTGCCACACTGGCCCTATGGCCCTGGCACTCTAATCAACTTCTGGGAGCTTTGGCTA
CTCTGTCTGAGCCATGGGATTGCATCATTGATACCATAAGTGCTGATTTTCTACCATATG
CCTAGCCCTGAGCTGGCATAGTGCATGCAGGGGCTTATTTAATCATTTTAGCCTACTATT
GTGAGCTAACTGAGAAGGTTAATTAAGACAGTAGATACAAATACCAGGCATAGAGTAAGG
ACTCACCAATACTTGGAAATGAATGAAAAAGCCAATGAGTGAGTTGGACAGGAAGCCCAG
AGGTGGGGGTGAGTGTGGTTGAAGGAAATACATCATGGGGGTGACAGAGGAGCCAACAGA
GACCTCCTGTTTCTGTGCAGGTCACCCCCAGTGTCACCCGTGTACCTGCCTGGGTCCCAG
GTGAGTCCCTCCTCCTAGCAGCTCCCAGGGAAAAGAAGAGGGAGGGAGAATGGCCTGAAT
CCAGTCGTGGTGTTGCTACACATGAGCTGGCCCATGGGCTCAAATCAGAGGAGGTCATGA
ACAGTATGGCACATGAGCACTAACAAAGAGTTTCCTAGCCACAGAAGTCTTTCTGAATTT
TGTGGTACCCCTGACCACATAAAACAGACCAAAGGGGAAGCACTTGCTGAAACTTTCAAG
AGACTAGGAAGCACTGGGGGTGACCCAGCCTAGGCTCCACCCCTTGTTCTTGGGAGTCTG
AACAGCAGAGGGACAGAAGGGTCACCTCTTCCCCTCTCCCCTCCACAGGGGATGCCGAGG
GAAGACCAACGCCACCACTACCTGAACAGGGAACTCCAGGGATCCAGGAAGAAGAGCGAG
TGACCCCTTCTACCAATGTGCTAATGACTCTGGGCCCCCCAGGTAGCTGTAGCCAGGCCT
TTGGGGCTCTCTGAACTCTACCCTGTGAGGTGTGGCTGCCCAGCCCTGACTCCAGGGCGG
GGCATGAGTGACATCCCTCCCCACCTCTTCAACCAGATGCACAGTCTCCAGGTCTGCGGC
CCTAGTCTCCTATTATGAAGAGCACCAGGTCCCCCTAGTGAAAACAGGAACCCTGTCTGG
AGCACTGCTCAAGCCCGTGTATGGGGAAGAGAAGAAAGCTATGAGGAGGGTCTTACTCAG
AGGTCTTGGGGAAGCCAGGGATCTTCCAGGCCAACATGCAAAAGGGAAGGGGGGCTCTGT
CCAGGATGGGGAGCACGTGGAATGAGAGCCTCAGAGGCTGGCCCTTCCAGGCTGTTTACC
CTGAGTCAGCGGAGTACTCTGGCAGCAGGCAGCCTGCTGCCCACGGGAAGGGCTGACTTT
CGGGAAGGAACACGGTTCTATTTCTCAAGGTTGTTTAACTGAGCCTGCATTCCTCTCTCC
CTCTGGTCAGCTGCAGTGATGGGGCGGAGGGAGCAGGCATGGGGGAGATCCCTGGCACAT
CCACCTGGCTCTGGAATGTACCCTCCTTAAAGGCTTATTGTCTGGGGACTCTGTTCAAGG
GAAGCAAGGCTGGTGCTGTTGCTGTCGCTGCCTGTGCACATGTGTGCCCTCTCTGGGAGC
TCACTGCTCTCTTACCCTCACCACTGAGATCTGGAGATCCAAGTCACCTTGAGTGGGAAG
GGTGTGGGCGAGAGGTGCTGACACAAACTTGGAGCCAGGCCAGGGCAGAGTGTGACCTTG
CAAACAGGCCCATGTGCACCTTCAGGTCAGTCCAATCTAGTACATGCTCTTAGCCCCACT
GCGCTACCAGCTGCTCTTCCTTTGGGTCTTCAGTGTCCTCTGAGCTGCAGGGAGTCCTGG
TATGTGGGCTTCAGGCTAAGACCTCAGGGCAGACACAGAGGCTGAAAGCATTTTTCTTTT
ATTCTTTCATTCAACAGGTTCTAAGTGTCAGGTAATTTTCTAGCATTAGGGGTACAGTTC
AAAAAGCTAGAGTCTCTGTTGTCTAATGGCCTCAGCTGAGTTCTGGTCAGCCTGCCTCCA
AACTGTTTCTCACTTTTCACCCTTACCACCACCTAAGTCAGACCTTCATTACATTATTTC
AACAGGTTCTGGGCCCCCTTTGCCCCCCATATGGTTTATCTGCTGTCTTGGTGCCTGGGT
GGCCTTCCTAAGATGGCTCCAGTCTACCCCCAGCGCCTGACAGGCCAGTCTCTATGTGGA
ATTTAAGGCCCTGCTCAGTAGGCTCCAGCCCTACCCCTCATTTTCCCAGGGTGGTTTTCC
CTTGCATCCTAATCACCAGCTCTTCTGTCTGTCCCAGGGAACAGGGCAGGAGTTGCAGGC
AGGGGGCACTGGGCACAGGGTGGGTGCCAGGTCTGTGTTCAGAGTGAGGCCTGGCTGGAG
TCTCAGGAGGGAGGCTATGTACTGCATATTCCGTTCCTAGAGCCTACTGGATCTTGGTTG
GGGGGTGTACTCCTGTGAGCCCCGTTTCTGGGCGGGACTCAGGGCTCCCAGTGGACATCT
GTGAAGTCTCTTCTGAAGCCATGTTGTCCATAGATAAAGGAAGGCCTGGCTAAATCTGAC
CTCCTGAGACCCCTGTACCCTGGAGTCCACACTCCCTACCTCACTCACCTGCATTTGTCT
ACCCCCACCCAGCATGACTCTGCTTTGCTCTGTCTCCTATAGGCATTGATAGATGTGCTG
CTGAAGCCGCCAACATCTGTGGCCCTGGAACCTGCGTGAACCTTCCAGACGGATACAGAT
GTGTCTGCAGCCCTGGCTACCAGCTGCACCCCAGCCAGAACTACTGCATAGGTTTTAATG
TGGGCGTCCTGGGCTTACTTGGTGGCTGGGGCAGATGCAGGCAGGAGCTGGGGAACTGAG
TCAAGGGTCCCAGACAGTACAAGATTCAAGTAGTCCTGGGTGGTTGGTAAGTTTAAGAGG
AGCATGACTGGGCAGTGCCTGTGGCTCAAAGGAGTAGGGTGCTGGCCCCATATGCCGGAG
ATGGCGGGTTCAAACCCAGCTCTGGCCAAAAACTGCAAAAAGAAGAAGAAGAAGAAGAAG
GAGGAGGAGGAGGAAGAGGAGGAGGAAGAGGAGGAGGAGGAAGAAGAGGAAGAGGAGGAG
GAGGAGGAGGAGGAAGAGGAAGAAGAAGACGACTCAGAGAGCCTGTGGCTCAAGCAGCTA
AGGCCCAAGCCACATACACCTAAGGGGGCAGGTTCAAATCCAGCCCGGACCCGCCAAACA
ACAATGACAGCTGCAACCAAAAAATAGCCGAGCATTGTGGCGGGCGCCTGTAGTCCCAGC
TACCTGGGAGGCAGAGGCAGGAGACTTGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGC
TGTAATGCCACGGCACTCTACCCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAA
AAAGAAAAGAAAAATCCATTCTTTGCTTCTTCCAGCCTCTGGCAGCATTCCTTGGATTTT
GACCACAACTCTTCAATCCCTGGCTCCATAATCACATTGCTGTCTCCTTTTCTGGGGTGG
TCAAACCATCTTCTTATAAGGATTCATATGATTAGCCAGGGGTTGTGATGGTCGCCTGTA
GTCCCAGCTCCTTGGGAGGCTGAGGCAAGATGATTGCTTGAACCTAAGAGTCTGAGATTG
CTGTGAGCTATAATGCCACAGCTCTCTACCCAAGGTGACAGAGTGAGACTCTGTCTCCAA
AAAAAAATAAAGATTCATATGATTGCATTTAAAGGCCACACTGATAATCTGGGATAATCT
CTCCATCTCAAAATGCTTTATCAAATCCACCAAATCATTACCATATAAATTAACATTTAT
AGCTTCCAGGGATTAAGACTGATATCTTTTTTGTTTGTTTGCTTGTTTGATTTTGAGACA
CACTCTATTGCCTGTGCTAGAGTGCAGTGGCATCATCATAGCTCATAGCAACCTCAAACT
CCTGGGCTCAAGTGATCCTTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCATGGTCAGGCTGGGGAGTGGGTGTGCCTTTGAGAGAAGCGCACTT
GGCCCCAGCAGCTCAGAGACACCAGCAAGGCTCTGAACTTCCCTGGAAAGGCCTGCCCCA
CTGCTAAGGGACTCCTAATAAACATGCTTCCAACACAAGCCCTTTAATAATACTGAGCAC
TCTACATACATTTTTATGAGTGAGTTTACAAAGTGCAAAGCAGCACTTTCCAAGCAGATT
CATAACCCAGTTGGAATCCTTCTCCTCAAGAATGGCCCTGGCTGTCCTCACGGCTCACGT
TGCTGGTTCTGGCCAGCACAGCCCAGCAGTCATTCACAGACCCCTCCCAAGGAGATGAGG
AGAGCTCTGTATCCTCCCACTGCCAGGGTCCCCTTGGGTTCTAATCCCCCAAAGATCTGG
TCTGCTGAAACCAAAGCCATTCAGGTCCTCACTCAATTATGGGAGGGCGAGAAGTAGGGG
AGACAGGCTACCAACTTAACAGCAGAGTGGGAGAATCGTGCACATCATTCACCGGGGACT
CAAGAGTTGAGTACCTATGTCCCAGACACTGTGCCAAGCTCTGCGGGTGCTGAGATGAAT
GAAGTAAGAGCCACAATACTGTAGGATCTAGATGAGGAAGCAACTGGTTCTGTGCGAGAG
AATCTGGGAGGGTTTCCCTGAGGGTGGTGCTTAAGCTGTGGCTGAATAATAACTGCTACC
ATTTAATGAGCACTTATTATATATCAGCCCTGTCCTGAGCATATTACTATGTGAAGTTCA
TCATCCCAACTCCATGCAGTAGAAATGCTTATTTCCATTTTATGGTTGAGTATATTGGAG
CTCAGAGAGATGAAGTGAAATACCCAGAGACTCACACCTTGTGGTGGCAGAGCTGGAGAG
AGAATCACATCACTCCAAAGTACGGTTTGCTTCCAACAACACGTTTCCTTCCCATGGGAT
GTTAGGACTAGGAATGGAAGGCACAGGTGAGGGCAGGGGTGTTCCAGGGAACGAGATCCA
TTTCTGCAGAGACCTGAGTGGTGAACAGCCCTGGCATGCTCTGGGAATAATGACAGATTC
CGTGTGCCTGGAGCAGGGGGACTTGGAGAAAGCAGCAGGATTTGAGGCCAGTTTGTGAAG
TGTCTCTAGTGCCAGACTGAAGTGCTTGGATGCTGTCCCACACGCAGTGGCTGCCAGTAG
AGGTTTGTGAGCAGAAGGGTGGTGATTCGGTCAGCTGGCTTTCAGGAGGTGACTCAGGCA
GCAGTGCTCTGAGCAGGCAGGAAGGGTGGGAGAGAAGCTGGGGGCAAGGGACTTCTCCAG
AGTCCAATTGACCCCGCCTGGGGAACTGGACCAGGACGCACAGTGGCTGCTGCAGGGAAC
CGTGTCTCCAGGACTGGCCTAGACAAGGGGTTCCACCATGTGCTGGCCTCGGTGACCAGG
ATGTCTCTGCCAGCTCCAACAGCTTGAGGTCAGCTGTCAAGTGCTTCTCCCCATAGGACT
TGGCTGCCCCTTAAAGAGGGTTTATCTGAGATAACACCCACTTCCTAAAGTTTGCCGGTC
TCATATGTGGTATCTTGTTATTTCAAGGATTCAATATTTGTTTTCAAGTTATTTAAATAA
TTATATAATTAATATAAATTATTAGTTTATACCATATAAATGAATTTAAATATAGTTTAC
ATACTAAATATCTAAGTAAATGTTCACTAGTAAGTGTAAGTGTCTGTTGTACATTATCCC
ATGGTTTCCTCATCAGTGAATTTCTTGTTCCTGTCTGTTGCTCAGTTTCCCAATGGAGGT
TGCTGTTTTCTCGTGTGGCTTCTTCAGAGTCCCTTACATACATATTCTAGGTATTAGGGT
GGTTTAGTGATTACACCTTTCCCATTTTGTTCTCTGTCCATTAACCTCACCCACATATCC
TTCTTTGTACAGCAATCCTTAATTTTAACGTATTGAATTTCACCTTTTGACCTTATTTTT
TATGTTTTAGGGGCTTTATTTAAGAAGTCTCTCCCTACCCTTAAATCACAAAGATATTCC
CCTATACTTTCTTTCTTTAAGGTTATAGTTTTGACTTTTATGGTATATTTTAATCCATCT
GGAGTCCATCTTTGCATGGATGTTAAGTACCTTTATTTTTTCCATTTTTCTCCACAGAAT
GAGTCAGTTTTCCTAGCACCATCTATCAGGCAGTCATCCTGGCCCCACGGGTTAATGGAT
TGGGGTCTTCGTCAAGTTCCTATCAAGAGATTAGATTTTTTTTTTAGACAGAGTCTCACT
CTGTCACACTGGGTAGAATGTCACAGAAACCTTAAACTCTTGGGCTCAAACGATCCTCTT
GCCTCAGCCTCCCAATTATCTGGGACTACAAGCACCCACCATCATGCCGGGCTAGTTTTT
CTATTTTTAGTAGATACAAGGTCTCACTCTTGCTCAGGCTGGTCTCAAACTCCTGAGCTC
AGCATCCCAGAGTACTAGGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCTAGGCCAGCTTAA
AACAATAATGACAACTGCAACAAAAATATCTGAGCATTGTGGCAGGTGCCTGTAGTCCAA
GCACTTGGGAGACTAAGGCAAGAGAATCACTTCCAGGGGTCCTCAAACTTTTTAAACAGG
AGGCCAGTTCACTGTCCCTCAGACCTTTGGAGAGCTAGATTGTGGACCCCAGAATGAGTC
GGCTGCTAAGCAGGATAGGCAGCAGTGGCAAAAACACCTGGCGGGCCGGATAAGTGTCCT
AGGCAGGCTGTATGTGGCCCACAGGCCATAGTTTGAGGACCCCAAGAGTTGGAGGTTGCT
GTGAGCTGTGACGCCACAGCACTCTACTAAGGGTGACATGGTGAAACTCTGTCTCAACAA
CAACAACAAAAGAATTCTAGGAGCAAGGCCAAGTAGGGACTTCGCTGGTCTCCTCATGTC
AGTTGCCTCAAAGTGGAGGTTTTTCCAAGGTCTTGGTGATCACCAAGGAAAGAATTTCAG
GAAGCACTGCATAAGCTAGGCAAGCAGCAGCTTTCTATTGTAAGTGAAAGTACACTCTTG
GAAGGAAGTGAAAGCAGCTGCCTGGGGAGGGAGAGGGGTTTTGGTCTTTTGATGTCTTCC
TAATTAAGGGGATTAATATTCAAGAACAAGCGTTGGGTTTTACTAAGAATTTGAGTAGTA
ATTCCTAGAATTACGTTCCTTCCTATTTTCATACTTTATATAGTTTATCTCAGAACTGTC
AAGGGCAGAGAAATTTTAAAACCATAATGTAAATGATATTGTAATTAACCAAAGTTCTTC
TCAGGTGACAGAGATAGCTGGTTCTTGCAGTCATCAGCTCTTCTAATTAGCTTCTGCTTG
GAGGTTGTTTGCTTTAATACCTGCCCCCTCTGTAAGCCCCTGCCTCTGGGTCTCGGCCCT
GCCTCCTGGTCTCCTCCTCTAACACTCATAATCATGCCATGTGGACTGCCACCTGACCTC
AAGACCAGCCCTCACATCAGCGTGAGGATACATTGAGAAGACTCCCCTGGGCCTCAGAGT
TGCCTCCTCCCAGGGAGGGGCCTGAGCTAGATGGTCTCAGGCTTGACTCAGAGCCCATCC
AGCCAATATGGCTACAGCAAGGATGCCTTCCCCTCTCGGGCCTCAACACTGATGCCCTTG
TCCTTGGACTCTGAAGTGATGCCCCAGGACCCCCTCCAGGCCAGCTGTGACTCAGGACTT
TTCTGTCTGTTCATAGATGTAGATGAGTGTGAGCAGCCAGGAGTGTGCGCTGGGGGGCAG
TGCACCAACACGGAGGGCTCATACCACTGCGAGTGTGATCAGGGCTACATCATGGTCAGA
AAAGGACACTGCCAAGGTAAGGAATGGAAAGAAGGGAGGTGGACTGCACCCCACCATCCC
TTGGGCCCTGCCTATACACTGCTTCTTGCCACTTCCCCTTCAAGCCCGCCCCTATGGCAG
AGACGTGTATCCAAATTCCAGACCTTCCCATCCCCTCAGTGAAATTTTGGTATCCTGTCT
GCCCCCCTGCAGTAGGGGAGCCCAAGGCCATCATCTATGTGACACCTTGGGAACATCTCT
ATGTACTTCTGCCCCCTTGCCTGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGCTG
AGGTCGGTGGATACTCAAGCCTAGGAGTTTAGAGGTTGCAGTGAGTAATGATGCCATTGC
ACTCTAGCCCAGGCAATAGAGTAAGACCCTGTCCCAAAACAAAGATGAAACCAAACCAAA
CAAAAAATCATTTCTTGTGATGATGGGGTAGATGATTTTTCTTCTTTTAGTTGTCTATCC
CATACAGTACTAGGATCCCAGTATTTCAAGGTCTGTAGCCTATTTAAGTGCCATACCTAA
ACTTTAACTCATTGGAATTTGTGGTTTAAGAAAAAAGTAGGGTTGCCAGGTTTAGCAAAT
AAAAATACAGGATGACAAGTTAAATTTGGATTTCAGACAAACAATAAAGAATTTTTTAGT
GTAACTATATCCCAAATACTACATGACACATAACCTCATACACTAAAAAGTATTTTTGTT
TATCTGAAATTCAAATTAACTGAATATCCTGCGTTTCATTTAGTATCTATTACTTAGATC
ACTAAGTATCTATTATCTATACCAACTAAGGGACCATTTATTTCCTGCTATGCCTGCAAC
CAGAGATACTTTATGCCACAAAGTAGGTGAAGCAACATATCCTAAAAAGGATTCAGTCAC
AAAATTGTCACAGAATCTTGAAATGTCTTCAGTATAGAGTAGGAAGGTTATTTTTCAAAT
AATTCAGGTCTAAGATTTCTGAGTAATGGACTTTTATGAATTCTACCAGATCTTTGAGTC
TGAGAATGAAATGTACGTGCCCTATCAAATGGGAAGTACAGAATGGGCTGCACATTGCAC
ACAAAAGATAATTGTCCCTAGAGGAGTTGCAGATGTGGCCGTTGTGTCACATTTGTGTCA
TTAGGTGGCAGAGAGAAAAAAGGCCATGTATACATTCAGTGTTCTGACCTATGAATGTTT
GAATGATTAATAGTCTGACACAGGAGAGAAAAAAAAAAAAAGGAAGTCCAGTGGCACATT
CAGGCAGGATAAAATGAAAAATAGTACGTTTCATTTGCCTTTCTCATTCTCTGTGACCCT
GATGCAAACACAATAAGGACTTTTCCTTTAAAATTAAGATTTTATACACAGCTATACACA
TATGTACAAGCAGTTTTGAGGGCCAGAGAAGTAACTCCAAATTTTGGAGCCTTGGAGTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGGATGGGAAGCAAAAG
CACCCACCATTTGATACCTACCTGGCGTACTGTGCTAGGTCCTTGACAGATCACCTCATT
GAAGCACCACAACAACATTTGAATCTGACATTTAACTTGATTAAAAAGCAAAGCAAAACT
AAAGGAAATGAACCAAGAAAATACCAGAACATTAAAAACATCAGAATTATATTAACCAGT
CCGTGTTCAGGGCACAGGCTCTGGCACTCACAGGCCTGGGTTTGGCTTTTGTTTTGATGT
CTGAAAATGGAAACCATAATGCCCATCTCAGAGATTCCTGTGAGGACCAAATGAGCTGAC
ACATACAAAGTGCTCCAGCTCCGGCACAGGGAGACCCTCAATGAGGAGGGGGACATGGTA
CTGTAGGAGGGTAGTTCACTCCCCCACTCCCACTCCACTCTTCTGGATTGTCCTCTTCCC
TTCAGGGGAAAAATTCTAGACGCACACCTCATCTAAGAGGTCAGGCGAAGTTCCTGGCCC
AGGGCAGACGCTCTGAGTCTGTTGAAAGGAAGAATGATGTAGCCTGCACACTTCTCCAGG
TTTCCATCAGTAACCACAAACCCAGCCCATCACCCCGCGAGCCCAGTCAATTTCCTCTCC
CTCTTTCTTCTTTCTCCAAGTAAAAAAACCACTCTCTCCACTGAAACTCAAAGTCTCTGG
TGAAAGACTCAGTGGTCTGGACAGCAGCCCATCCAATAGTCTCGATGGCATTTCCATCAT
GCCAGGACTCTGGGTTCCCACAGGACGAGGGTAGATTCCCCTCCAGTCTCCCAGGCCTTT
GCTGTGCCCCACCCTATCCAAGGTCACCTGAGCTTCTGGCCCCTGCCAGAGTGCCCTTTC
CACCCCAACTGCATGCTCTCACAAGGGACAGAGTTGGTGGCTTTACACTTCCTCCACTCC
AACTGGTTAGAAAAGCTCCAGGATCCTCCTAGTGAAACTGGTCCTGGGAGTGACTGTTTC
CATGGGTCCTTTGGGGTCTCTTCAGCAGCCTTATTCCAAGAAGACGATGGGTAAAGTTGA
GGCACATTGTCCCGTTCTTTGATAGCAAACAGTTGTTGAATGCCAGCTGTGTGCCAGCCA
TGGACTAGGCAGAGCAATAATTAAGACAGCTCTTACCCCCAACAACCAGAGCATAAAACC
CACCAAAACACAATCCTCTTAGGCTAACTTCAACCCCTACGCTAGGCAGAAAAATCTGCA
CCTGGTGACTGGTTCCACTGCAGACACTAAGAGGTTAGTGGAACAGCCTCAGAATATCTG
CAGAGGAACTTGACCATCCGGAATCTTCATCTGGCTCCTTTTGGATTGGCATGGTTAATG
TCAGTTGTATCCATTTCCACTCAGAAAGCCCTTTCCCTGGCCAGGTAGAGACAGGGCTGC
CATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTC
TTGCGCTGAATAAATGTCTGAACCTCTCTGCCGATAAGCCGTTACTGGCCTTGACTCTTT
GGTCTGCTCTCAGCCAGAGTACTGGTCTGGGGGTGTTATCCTCCATCTTCATGTCCTGGT
ACAAGGAAGCCCATTCTGCTTTCACTGCCTCTCTGGTGACCTGTTCTGGAGCCTCTGGCG
GCAGTCCGGCTGGTTGCTATGCCAAGCGGATCCCATTCCAGTAATGGTCACCGCTTACAA
AGGATTAGGCGTTCCCCAAGGGAGATATGAAGGCCCATCCCAAAAAGTCCATCTGACAAA
GTCGAGCTCTCTGATCCTCCTACAGCTGGTGGTAACCACAGCCTTTTGCACCCACCCAGG
GAGTCTCCCTGACTAATTTTTAAGTTCTTCCATCTCTCCCTTTTGTTCAGGACAGTGGGT
GGGAAGTAGAGTGGGGAACATGGGGCAACTGTCATTTTTTCCTAGTTTTCATCAGCACGG
AAACTGACATCTCTCTCCTCAATAAAGGGAAGGGTCAAGGATTTACCACGTCACAGACCT
ACCCATGTGCTGTAGTTCCCAGGGATAACCAAGGGAGGAGCTGTTGTTTTACAGATATCA
ACGAATGCCGTCACCCTGGCACCTGCCCAGATGGGAGATGCGTCAACTCCCCCGGCTCCT
ACACTTGCCTGGCCTGTGAGGAGGGCTACAGAGGCCAGAGCGGGAACTGCGTAGGTGAGG
GCTGCCTGCCAAGGCACTGAGAGGGCCGTTCAGCCTTGGGACCACTGGCTGAGCCCACAC
ACAGGGAGGGAAAGAGGTGGGCAGAGGGCAGTGGAGGCTACTGTACACCATCTGGCTGGG
GCCCCAGATGGCACTGGGCAGAGAGGGTGTGCTTCAGTTACTGGGGTTCTGCCTCTGAAC
CAGCCAGTGTGGGGGCCTCTTCTGCTCCTTGGCCATATCCATTCTGGACCTATAGCCCAA
AGTACCGGAAGCTTCTGTGGCTGGTCCTGTAGGGTGGAGTGAGGAACCTAAGGGTCTCAG
GATGGGGCAGACTCTAGTGGTGAAAGGCAGTTCCTTCCGCAGTTCCCAGGGAGGGGGGCC
TTCTGCCCCTCTCATCTCCACAGAGATGTCTCAGCAGACAACCTCACTGGGTGGTAGCTG
CCCTTCTCCCCCGAGAAGGGGGTCATTCAGGAGTAGAGTGTTCTTTCCCCTCAGCCCCCT
CAGAAAGAAGGGTCCAGGGTTCAGAATGCCAGGAGGGACTGAGTTTTGAATGGATGCTTT
GAGGCTTTGGAGAGGGCAGACATTTCCCAGGCCCTCTGGACTGCTACCCAGCCACCCAGG
CATGGCCTGGCCTCTCTCCACATTGCTGTCCACCCACTTATGCTGGTTGTTGGGCTGGGA
ACAAGGGTTGTTGGTTGGCAGGTGGGAAGCCAGAGAAATTCAGAGCCACCATGAGGTGAA
TCAAGGGTCTTGGACACCTCATTCCAGCATCCTCAGATGGGCCAAACCAGCCCCAGGTCT
AGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAATGCTGGGTTCGGCGATGGGTATTTTT
TGTGTAATGTGGATGAGTGTTGGGACCACAGGCCGTTTCCGGAAGGCCACTGTAATCAAC
ACGGAGGGCTCCTCGACTGTCTGTGTGAGACTGGCTTCCAGCCCTCCCCAGAGAGCGGGC
AGTGTGTAGGTAAGGGCTCCAGGGGAGGGAGCAGGGCTCTGCCCCACATCTGCCCACCTC
TGCCCTTACACCCCAGCCCTCAGCTCCCATGAAGCAGCGTGCTTTCTACAGAGTAATCAT
CCCTGGATAATGCATTTATTGAGCCTCTGCTGGCTGAGCAACTGTCCAAGGATGACAAAG
TGAAGACAGTTATAATCTTTGTGCTGGCAGAGCACACAATCTAGTTTTAAAGGCCAAATT
GATTCAATAGACATTTATTAAACACCTGCTACATTCAATGTCTTTTATTGGGACAAATAG
ACAGTTATAGACAATCTTGAACTTGAACAAGGGAGACAGATATGAAGACAACTCTCTGTA
ATATACTACCCTGAAGGTTCCATACAAAGAGCCGTATGAAGTGCTTCCTAGACTGCACGT
ATGTCTCTCCCATATGCTCAGCCTTACCTCAGCTGAACTGGATGTGCTTGGGTTGAGACA
AGCATAGTACTTTGGAACAGATCAGGGAGCCCAGAGATTGTGGGGCATAATCCTGTAATG
CCAGCAAGGTGGGACCAGAGCAGTGACCTGGCCACCTCTGTCCCCTGTTGTGGCTCTGGG
GACAGATATTGATGAGTGTGAAGACTACGGAGACCCAGTGTGTGGGGCCTGGAGGTGTGA
GAACAGCCCTGGCTCTTACCACTGCATCCCAGGCTGTCAGCCTGGCTTCCACATGGCCCC
GAATGGAGACTGCATTGGTGAGTAGGGAGGGAGGGCTGGAGGCCTGAGGGTTGAGGACAC
CTATTGTCATGTATCGAGCTAGAAACTGTTTTCTCCTGAGGACTGTTTTTGCAGCTGTTT
GAAATTTGTATATTTTCTGTACAGCAGAGCTTACACAGAAATTGAAGAGGAATGTTAATG
TTAGTTTTCTTGCCCTATGTTTAGAGTTTACTTTTCATAGATCTTGGTGTTAGTAGGCCA
AATGAGTGTTCCTGACACCGGGGGCTGGGAGAAAGAGCAAGCACACACCCTTCTACACTG
GTCTTTACTGCCCCACAGACATAGATGAGTGTCGCCTTATGGCCCATGTGTGGGAGCCAT
GGCTTCTGTGACAACACTGATGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGGGCAAGGGAGGCAGCAAGAAAGAGGGAG
GCTTCAGGCTCCCTGGGTGGGCACTCCCCCTGCAGTGGGCACCCTGGAGGCTGGTAGGGG
ACAAGCACAGAAGGAAGGTGCCTCCTGCTCTTGAGCCTGCAGGGCCCCCGGAGGCGTGAG
GTTTGGAGAACATGCACAGAGGGTAACCCTGCCTCTTTGTCACTTTCATGCTTCTTGTCT
GCCATTCCTCTCCTCTCTTCCTCCCCACATCCTCTGTCCATCTGTTCCTCCTTCCTATTA
ATTCAGGCCTGCTTCTTCTTCCCCCCAGGCCTAGCCTGTTTCTTTTTGGGAAATGGGTTG
GAGTTGGGGTGAGGACAGGGACTGCCTCTTCCCCACCCATGAACCTGTCCTCATGCCCCA
CTGCAGATGTGAATGAGTGTGAGCTCATGCTGGCGGTGTGTGGGGCTGCGCTCTGTGAGA
ACGTGGAGGGCTCCTTCCTGTGCCTCTGCACCAGCGACTTGGAGGAGTATGATGCACAGG
AGGGGCGCTGTCGCCCGCGGGGGGCCGGAGGTGAGGTGGTGGGGGTACTCACAGGACCTT
CCTCTACTCCTGCCACTGTCCATGAAGACTTTTAGGCTTACAGAGCACCCCTGGTCCTCT
AGCCTCTAGCGCTAGGAGGGAGACTGGGCCAGGGCCAGGAGCAGGGCAGGTGAGGCTAAG
CATTGAGCAGGGAGGGCCAAGGGGTCTGAAAGAACCACCCACGCCAAGACAAGAGGGTCT
GTCCCAGGCCAGGCTGCAGGGCTCTGATGACCCTAGAGGAGCTCTAGACCCTGATGCTGA
CTTAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCCAGGGACTGGGGGC
ATCCCACCACTGGGGAGGCAGGTGGGATACTGGAGAGAACAAGGGCTTTAGCTCCTGGGG
ACCTGGGCCAAATCCCTGCTTTGCCACATAACAGCTGGAGGGCGGTGGCAAGGCACTGAG
CTCTGTAAAAGGGTGGGATGATAATAATGTCTTCTTCATAGGGTTTGACAGCATCAAGTG
AGGTAATACAGGTAATAGCATATTACATACTGTAAGGAGCTATATAAATGTTAAATTTAA
GAAATAAATTCAAAGGCTGGGATACCTCAGAGGGTCATGAATAGACAATAGTAAGGGGCA
TCTATCACACACAGGTCAGAGTATCCCTGAAGCCCCAACAGGGGACCAGCACCCAGGGCC
CCCCCGCATGGAATGCTACTCTGGACAGCCCAGCCACCCACCCTGCTCCAGCATCTTGGG
CCAGAACACCACACAGGCTGAGTGCTGCTGTACCCAGGGTACCAGCTGGGGAGATGCCTG
TGACCTCTGCCCATCTGAGGACTCTGGTAAGTCCCCAAGAGTCTGGATCCTCTTAGAGTG
AGGGTGACACTGAAAGAAGGGGTGAGAGGAAGGGGGCGGAGGCCTTCCCTCTCTGAGCTC
GGATACCTCTCTAACAGTTGAATTCAGTGAGATCTGCCCCAGTGGTAAAGGCTACATCCC
TGTGGAAGGAGCCTGGACATTTGGACAGACCATGTACACAGGTACCCTTCCTCTAACGCT
GCCCTCCACACTCCACTCCCTTGAGTGGGCTCCAGCCCGGTCCATGGGGTCCGTGAGGGA
GTCTTGCATCCAGCTCTGGACCCCCAGCTTGCTTGCATCATTTCTGTCCCAGGACCGACT
CCCTACAGAGTGTTTACTGGGAGTTCTGAAGTGTCCACATGACCCTCACCTCAATTTCCC
TGCTCCCCCAAAGCTGCACCCTCCAACAACAACCTATGATGCCTTGACTGACCCTAACCT
CCCCTCACAGTGGGCACAGGGACAGAGCAGAGAGTACTGACCTAGAGGCCAAAGGCAGCT
GTGTATCTCCTGGGCCCCATTTATGAATGCAGAAACTTTGGGGAACCCATGCTTACATTG
GGGTGATACAGGTTCTGAGCCCCTTGCTACCCTAGTCCTGAGAAACAAAAGATAGAAACA
GAAGTGTCTCTGAGCTTGCTGTGTGCCGAGCACGATTTTGAGCACCTTACATTTATTCAC
ACTTATTAATCCTCATAACAACTGCAAGAGGTTAAGGAGTATGGTATGTGGGAAACTGAG
GCAAGGAGAACTTAAGCAACTTGCTGAAAACCACCCAGCTAGTAAGTGGCAGAGCTGAAT
TCAGACCCAGTCCGGTTTGGGAGTCCCTCATCTTGAGCACTGGCTCATGCTATTTCTCAC
CTCCCCCTCACCTCAGCTCTGCCTTCCCACAGATGCCGATGAGTGTGTGATGTTTGGGCC
TGGTCTCTGCCCCAATGGCCAGTGCCTCAACACGGTGCCTGGCTACGTCTGCCTGTGCAA
CCCTGGCTACCACTACGACGCCTCCCACAGGAAGTGTGAGGGTAAGGACACACGCGGCCC
CTCCCCAGCCCAGGCCCCCGCCTGAGTGCCCACCCAGCCCCAGCTGGCCAGGCCTACTCT
TGCTGAGGACCCCCATGCCTGGGAGGATGCCCACTCACGTGAGGGAGCTCTGGGCTGTCA
GGGATTATCCCCAGGGACCAGTTGGAAAGGTGTCTGAGGGAAAGGCCTCCTGGGCTGGGC
TGGGTTGGGGGTGGAAAGCAGGGGTTACCTCTGCATTGTCAATTCCAGAAGAACCCCCTT
CCCTGAGGGTAGTCAGTGGGGAGGTGGCCTTGGCACTGCGCCCTCTTTCCTGCCACCACA
GATCATGATGAGTGCCAGGACATGGCCTGTGAGAACGGCGAGTGTGTGAACACAGAGGGC
TCCTTCCATTGCTTCTGCAGCCCCCCCCTCACCCTTGACCTCAGCCAGCAGCGCTGCGTG
AACAGCACCAGCAACACAGGTGAGTGGGCCTGGGTGGAGTTAGCAGGGGGAAGGGACCTG
GCTGGGGGGCTCATATACCTCTCCATGCCCTGTGCCACCAGAGTATCTCCCTGACCATGA
CATCCACATGGATGTCTGCTGGAAAAAAGTCACCAATGACGTGTGCAGCCAACCCCTGCG
TGGGCACCGCACCACCTATACGGAATGCTGCTGCCAAGATGGCGAGGCCTGGAGCCAGCA
ATGTGCTCTGTGCCCCCCTAGGAACTCTGGTGAGGAGGAACCAAGGGAAGATACCAGCAG
GGCTGGGCTTAGCCCCTGGGAGGGGGATGGCCTCACTCTGGGGGGGAAGCTGGAAAGAAA
GGGCAGGGCAGTCAGAGCAGTGGCTTTGTCTTCCTTCCCTGTTGTTGGGGACAAAGCAGT
GCAGGAGAGGGCCAGAGAGGAATGCAGCTGGAACTCCCAGAGGGCACTGGTCACCTTTAG
CTAGCAGGAGTCAGAACTGCTCCCTCTCCCCCTCTTCCCTGACAGAGGTTTATGCTCAGC
TGTGCAACGTGGCCCGGATTGAGGCAGAGCGGGAAGCTGGGGTCCACTTACGGCCAGGCT
ATGAGTATGGCCCTGGGCCCGACGACCTGCACTACAGCCTCTATGGGCCCGATGGGGCCC
CCTTCTACAACTACCTGGGCCCTGAGGACACCATCCCAGAGCCCCTCTTCCCCAACACAG
CCAGCTACCCAGAGGACCACACACCAGTCCTTGAGCCTCCCTTGCAGCCCTCAGAACTCC
AGCCCCACTATGTGGCCAGCCATCCAGGTCTGTGTTGCTGCTAAAACAGGGACGAGCTGG
GCACTGAGGCTGCTTTACTTCCATCTCCTCTACCAGCCAGTCATACTGATGCAGGGTAGG
ACAGGGAAAGGGAACCATGAACCAAGCCAGATGTCCCTGCCCGTGGGTCCCTCAAGGGAT
GACTTTATATGCTGGGGTCAGAGCCTAACAACTCCGTCTGATGAACTAGCACAGGGACAC
AAAGAGATACAGGAGGTTTTCCCAGCCTCACAAGCTTCCGCATGGGAATTGTGAGCAAGA
GCAAGCGGGTAGGCTCAGGTCTGTTTCGCTCCCTCACATCACTTAGAGGCTGCAGAATAA
CCCACTCTGAGGAGACCCAGCATTCAAACTTGGGACCTCAAGTATGAATTATGGATTTCC
AATGACTTTAAAGGCTCATTGCAGTGACTCAATATGTGCATGGTGACAATTCCAGCACTC
AAGCCTTGGATTCCAATGAGGAAGTCAGGCCTGGCACCTGTGCAGTGGACACAGACCCAC
CACAGACACCGCCACCACATCTGATAGATTAAAGCCCTCCAGCCCCGGGGACAGGCCTGG
AGGGGTGATTGGAGAGAGAGGAGGGTTAGGCAGATATGGCCGAAGATTTGCTTTGTGTTG
AATGAGGCTCCTTGGCTGCCAATTCCTTCCCCCCAAATGATATAAAGATTTTTTTTTTTT
TTGGCCGGGACTGGGTTTGAACCCGCCACCTCCGGTATATGGGGCCAGCGCCCTACTCCT
TTGAGCCACAAGTGCCGCCCTGATACAAAGATTTTTAAAGAAAACCCCCTAACCCCAAGC
CCCCAGATATACAGACAGCTCAGCCAACCTCTCAGGAGCAGGGAATGGGTAAGCAGGGCC
TGCACTGAGAGCATCCCACTGCCCCCACCTAAAGTGGCACACGCATATTTTTTTAAGAGG
ACTGCCTTTTGTCCTTGAATCTTCCCGTGGGGGTTTTATGATCCTCGCACGCTCTCCCCA
GAGTTTGGAAGCCCTCGGCAGGGAGGCTGTGGTCCTGACGCGGGAGAGCTCTGTCGGACA
CACAGCCTCAGCTTTTCGCTCTGACCGCGCCCCCCCTCCCTGCCCCAGAGCCCCCGGCCG
CCTTCGAAGGGCTGCAGGCGGAGGAGTGCGGCGTCCTGAATGGCTGCGAGAACGGCCGCT
GCGTGCGCGTGAGGGAGGGATACACCTGCGACTGCTTTGAGGGCTTCCAGCTGGACGCGG
CGCACATGGCCTGCGTGGGTGAGTTCCCAGCCCGGGCGGGGATGTCAGCCTGGCCACAGC
CACTGAGCGCCGGCCGGACCCGGATGGCTGGGAGGACCTCTGCTGCCCCCTAGTGGCCCG
TCTGCGTCGGGCCAGGTGAGAAAGTGCCAAAGGAAGGGGTGGCGCCGCGCTCAGAAAGTC
CCTTAGAAAGCCCTTCTAAGGAGCTTGGAGACAACAGGGAGATGAGGGCAAGAGAGCAGG
GCCGTGGGCACAGTATGAGCACACTGCCCCCTGCTTTGTGTCCTTGAGCTGCTTGGTTTT
GGGAAATGACTTCGGTCTCTGGCTGTCATACCTAGGATTCCACAGCAGGGCAGGGGCTTG
TGCTTAGTGACAAAGCCACAGAGGCAGCAGGCCAAAGGCACCTGGGCTCCCTACAGTTTT
CTCTTCCTTCCCTCCCTCTTAGATGTGAATGAGTGTGAGGACTTGAACGGGCCTGCTGTG
CTCTGTGCCCACGGTTACTGTGAGAACACAGAGGGCTCCTACCGCTGCCACTGCTCCCCA
GGTTATGTGGCTGAGGTCGGCCCCCCACACTGCATCGCCAAGGAGTAGCAGTGAGGTGCC
AGTGTGGGCAGCTACCTGGAAACAGCCTCCAGCCACACGCCGGGGCCTTGAGGATACTTT
CCTAGCTGGGAAGATGCCATGAGACATCAGGCCAGAGGTTCTGCCTTGTCTGCCTTCATC
TCTCCCAGCAGAGCCCCTGGCTGCGAGCTTTCATCACTGCCTCCATGCCCTTGCTTGGCT
CAAATACCACCAGTCACTTTCATGCTTCAGCCACTGGCCAGGAGGCCCAGTCCACCACCT
GTCTTGACCTTGCTATGGGATGCTAACCAAAGGATGGCCCTCACTCACCCCCCCCACCAA
GCTGTGCAAATGTGCAATGTCCTGTAGCCTCACGCTGCAGACACCCCTTTCCAGCCATGA
TCCACTTATCATCCCAGTGATTCCGCAACTGGGACAGAGGATACATCTGCCCTGAGAGGG
TCCTTCAGAATCTATGGAGCAAGAAAGGGCTTGAGGGAGTGTGGGGACTGACTCCAATGC
CCCCTCCCAAGAACCATCACCACCACTCAGCCAGTCTGGTGTGGGCCCTGATTGTGCCGT
ATCTCCATCCTATAGCCGGTTTTCTGGCCCCAGGGAACGGCAGAAGATCCCCTCACTCAG
AGGCATGACTAATAGTAGCTTGTTGAGTGTAAGAGGTACAAATGAAGAGGAACAAAGAGC
CTGAGAAAGCAAGAAGGCAGAATGAAAAATGTGTGCAGTTGATAAGAAAGGGGGAGCCGA
GGATTTATATAAGTCTAAAGAAAATACTAAGTAGCTTGCAGTAAATTAATATTCGACACC
CACTCAGTGATAGCCCCTGTGCACCAGCAGCAAGGGCTGCCACAAGATCAAGCACCATCT
CCACAGAACACTGCACATATACCACTCTTGCAGGAAACAGACCTCTGTTGGGTAAAAGTC
AGTTTGATGCGCTAAAAACAAAAAGGTCTGTTTTCTAGGGTGGTCTTATTCAGAGAAAGC
CAGATTCCCAATGTTGTTCTTCCTCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 15881..16145, 44369..44478, 44481..44488, 44490..44511, 44514..44525, 44527..44559, 46955..47125, 47615..47821, 48508..48791, 48973..48975, 50009..50111, 91945..92019, 94460..94582, 96178..96342, 96597..96812, 97838..97857, 98600..98639, 98988..99101, 100842..100970, 102493..102621, 107896..108015, 134154..134273, 136156..136278, 136379..136504, 136605..136730, 136831..136953, 137054..137179, 138306..138319, 138321..138332, 138335..138353, 138355..138371, 138374..138428, 139025..139156, 139458..139470, 139472..139522, 139525..139586, 140046..140189, 141134..141325, 141437..141520, 142232..142360, 142681..142818, 142901..143068, 143325..143606, 144708..144857, 145282..145427
1001..1070, 15881..16145, 44369..44478, 44481..44488, 44490..44511, 44514..44525, 44527..44559, 46955..47125, 47615..47821, 48508..48791, 48973..48975, 50009..50111, 91945..92019, 94460..94582, 96178..96342, 96597..96812, 97838..97857, 98600..98639, 98988..99101, 100842..100970, 102493..102621, 107896..108015, 134154..134273, 136156..136278, 136379..136504, 136605..136730, 136831..136953, 137054..137179, 138306..138319, 138321..138332, 138335..138353, 138355..138371, 138374..138428, 139025..139156, 139458..139470, 139472..139522, 139525..139586, 140046..140189, 141134..141325, 141437..141520, 142232..142360, 142681..142818, 142901..143068, 143325..143606, 144708..144857, 145282..145424
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved