Otolemur_garnettii Locus ENSOGAG00000003276
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000003276
Otolemur_garnettii
ENSOGAG00000003276
GeneScaffold_534
SNORD101, SNORD100, SNORA33
1776..1848, 2961..3036, 3376..3473
4944
TTTCTCATTTCTGTACTCCCAGACCCTATCCCTGTGTCAGGCACAAGGTAGGTGTTTAA
AATGCATCTAAAGAATCCTGATTTGCGCGGGACAAGCAATGTAGGGCACGATCAAGCATT
CAAAACTAAACAAAAACAAACTTCGTTTAGAACCAACTCTCCCACTATGTTTAGAAACCA
GAACTGACCAATACATGCCAGGAAAATGGGCTCTGTTAAGTGCTTAGAAAGAGTGAAAAG
GCGTTGGCCGTTGTCTCTTGCAAACAAAGAGAGCACCACCCACGAAATGACACATTCGCG
GACAAAGAGACTAAGGAGCGAAGGAACCCAACGCGCTTTCTCGCTAGCTCAGTCTAGTTG
GGTCACTGGAAACCACCACGTGGTGGGGGAAGGGTTGAACTGACGTTTTGGGGGCGCCAG
AACTCCGGGGGGAGGTCTAAGACCAGGCAGACACCAGTGCTTGACAAATCTTCTTTGGCC
CCTCTCGCGCTCCATAGAAAGAACTTTCTGGGCTTTCACAGGCCACGCCCCTGGAAAAGA
CCCGAGGCTGCCCTCGGGATGCCTGCTGCGCGCACCGCGGACCGGCCGACCACGGGCGCA
CTTGTAATACTCTGGTCTCAGAATCGAATTGCCTCAATCCAGACGGAGAAACCCCGAGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAT
GTTTGTGGTTAATGGAGGCCCCAGCTTGTTTCCTGACTGGTTTGTGGATCGGCTGGGATT
GGTGGAGATGTGAGTCGAGGCTGACTTCCTTAGTAAGTTAGGGGTTATTTTTGCCTTTTT
CCGGTGAGTTCAAGATTCACCTTCACGCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
CCCAGGGGCTGGGGTCGGGCTGCCAGTGAGGCGCCGCCGCGAGCCTGCGGCGCGGGGCCG
GGTGGGCCGGGTCGCCGGGAGCGCGCCTGTTGTAGGTTACGCCTCTGCAGTCTACGGCGT
TCAGTGGTGCGAAGGTTTTAACTGAGGGTTCTGACTTGGCGCGGTTCAGCATTGCTGCTG
AAGGTGTAATAGATGTGAACACCGCTTTACTAGAGGTGCTGAAGACCGCCCTCATCCATG
ATGGCCTTGCACGTGGAATCCGCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTATCAGT
CTCAATACTGTGGGTTGTTGCAACCGGAACAAAATTGCAGCCCAGGGGAAAAAGCGTGAA
TGAAGTTCATGATGTTAGCCCAAAAGTTCAGAGTGGCATCTATATCCATCCTAGGAAAAG
TTATCAGCGCTCTTTGTGAGTTGCTGTTCGCACTGGAGTTGAGACTTAGTTTTAGGCTTT
GCGCCCGTAGGCAGTGGTTAGGGCACCGGCCACATACACCAAGGCAGGCAGTTGCGAACC
CGGCCCTGGTCTGCTAAACGACAGTGAGAGCAGTAACAAAAAAGTAGCCAGGCGTTATGT
TGGGCGTCTGTAGTCCCAGTCTGAGGCAAGAGAATCGCTTAAGCTCAAGAGTGTGAGGTT
GCTGTGAGCTGTGACGCTACGGCACTCTACCAAGGTGATATAGTGAGAGACTCTGCCTCA
AAACAAACTTGCTCTTAGTCCAACAAAAACTACAGTGTTTGATTGATGACTTCAGTTGTC
GGATACCCCTTCACTCTTGTTCCGAGTGACACATAACAATCTGACAAACTTGGAGGTTAT
GGGGTTAGTAGTTTTCTGGAGGTTAATTGGACAACCTTGTTGCATTTAACAGTTTAGAAA
CTATCCGGTTAAATTAATAATGAATAACTTAAGCATTTTGTCCTGAAGTTATTGCAGAAG
CATTTCATTCTAAATGAATTTGGTAAGTGCAGTAGCTGTGGAAATACATTTGAATCTGGA
ATACTCGTTATGTTGGCAGAACAGCTTAACATAGAGCTGAGTTTAAGTGCATTTTTAGGG
TCTCCACTGTTTACTTTGGTATAATCTAGCCAGGTGAATACATCCACTGTTGTGTGATGT
AATGCATGCTGCAGTGCACTGGGCCCTGGTGTGAATCTTGTGTAGTATTGACAGGTTGGC
CGTCCTGCGCTGTATTTTTGCAGTGGTTGGACCAGTAACATTACAACTGTATTTGGTAGT
TGACATAACACATTTCTTTGGATATATGAGACTGATTTACCAGAAAGTTACCATTTTGAC
CACAAGTTTTTCAGTTACTTCCCCTATACAAACCTGGAATTTGGGGGGAAGAAATCTTAA
GTGAAATTTACTTAGTTTTTCTTTAAGTGAACAAGATGGCTGGTAAGAATCATCGGATTT
GAGCACTTATATGCACATTTGTGGGGTGGTATTCAATAAAGTGCAAGAGTGGTGGGTTTA
GGTCTGGATTTTAACTTCATTGTTGTGTTTTGAATTTCAGGCACCCATCTTTGTGTGCTT
GCATCCAACTGTGATGAGCCTATGTATGTCAAGTTGGTGGAGGCCCTTTGTGCTGAACAC
CAAATCAACCTAATTAAGGTAAGTTACTCATCTAAATTGATGTGTCTGGTCTGTTAGTAC
ATCCTTTAGGAGAATTGGGCTAGTTAAGGGTCATTATGTTAAGACTGATGCTGTCCATAG
TGATATTTGTCATACTAGTGTAAGAATTAGTTCCATAATCCTTAGTTTGTTTTCTACAAG
TGTAAACGTACCATGGACTTGTCGTTGTTGGCTGTGTTAAGGCTTTTAATAAAAGCATTC
TATACCTGTAGAACTAAAATGCTAATTTTGATGTTGATATAGAACAAAAGTAAGATAAAG
TGCTGATAGGTGATCTTTTGTGCTGTACATGATGACAACTGGCTCCCTCTACTGAATTGT
CATGAAGAAACTGCCATGTCACCCTTCTGACTACAGCCACCTGTTGGGTTTAATTTATTG
TTAATGGCATTAATGCTTATTAATGTGACTTTTTTTTTTATTCTCCTGGTAGGTTGATGA
CAAGAAGAAACAGGGAATGGGTAGGCCTTTGTAAAGTTGACAGAGGGGAAACCCCATAAA
GTGCTTGGTCACAGTTGTGTAGCAGTTTAGGTAAGTCACTTTGTTTTTAGGGTGAATAAA
GGTTATGCTGGGTAACTGCATAACTTTGTATTAAGTTAAGTTTGAGGACCTTTTAAAGGA
AAGAATACAATACTCAAAAGAGTTAAAAACATTTTCTGTGTTTCAAAAAAGAAAAATTTG
ATTATTAGTGTTATAGAAGTCAGCCAATTAATCTGCTTACCTGAATGTGTTTCTGCAGAA
ATTTTTTAAAAGCTGGCATTGAAGTTGTTAAGGGCCCTTAAAATGGCTGTAACAAATTTT
AGTGATGTTACACACTTTCATAAGGCATAATTTTAAAGCTTGGCTGTGAGTAATGCTAAG
AACTTAGTGGAATTTATAAATGTTAACAAGAAGTTGCGCGTGATTTTTTTTTGAGACAGT
CTATATCTGTTGTGCTAGGTACAGTGCTATGGTGTCATAGCTCACAGAAACCTCAAACTC
AATGAGCTTGAGTGATCCCCTTGCCTAAACCTCCTGAGTAGCTGAGACTACAGACATCTA
CCCCAATACCTGGGTATTTTTACTATTTTTAGTAAGGCTAGAGCCTCACTCTTAGGCTGG
TCTGGAACTCCTGAGCTCAAACATTCCACCTGCCTGGGCCTCAGAGAGTGCTAGGATTAC
AGGCATGAACCACTGCACCCAGCCAGTAATTTTTTTTTAAAGGACTATGACAAAGAATCT
CAGGCCAATGATGTCATTGAAGAGTACTTCAAATGCAAGAAATGAACGAATAAAACTTTG
GCTTATATTCCTTATCTCTGACTTTTTATTTGGGGGAGTAATGTAAGGTGCCTATTAATG
AAAGGAAAGGTTATTGAGGAAAACGATCACTATGAATGAAATGAGAACATTCTGTAAAAC
AGCTCCCTATTTTTGACCTTTCTTGATTTTAAATGAAAGTCTCTTCTAACCAATGCCAGT
GTTGGGGCAGTTAAAATATGGACACTTTAAGCAAAGATAGGCCTGCCAATAAGGTGCTAG
TGACAGCTAGGGTTACTTGAGTATGGTCATTTGCCACTTACTAGGCCAACCTAGAACCTA
GAGAAAGGCTAAAGTTAGGTAAATGGATGTTAATAGACTGCAATCTTATGGCAGGACGGT
GAGCAGCAAAGATGGAAAGTATAGAGGTGGGGAGGATAAAATTTAGGCTCTGGCGTGCTA
GTAGAAGTGTGTGATAATCCAGAAATGCTTATGAGTATACCTATAGAGAAAGTCATAGCG
ACACCTGTTTTCATGACTTGAGTGCTTTACAGAGAAATAAGAGATGCTTTAGTTCATCTC
AGTCTTTAGGAAACTCAGCAGAAGGTTGAGAAATGGATACTCGTGTATGTCAAGCTTCTG
TACAGTTACTATGTTTTGAGGCCATGTACTGGGGCCAAATGTGGTTTTGAATGCTTTTTT
TGTATTCATGGTTTTTTTGTATTTAGAGTTGTAGGCTTTCATCCATAGTCTGCCACAAAG
TAGGGTCTTTTGTACTGGGTAGCTTGGTGCTTTTGAGCATTGTAGTGGTCTCTAGCTAAA
CACTGGTTGGCATCAGTAAACCAGGTATTCATTATGGTGTATTGAATTACCACTGGTGTG
AAATAAGAAGCTCTAGAGGTAATATTACTTATAAACAGTGTGGGTATACCCTTTAGATAG
TGTGACTTGGGATTTTATTGAATAGCACTTTAAAAAATTATAAATGGGGACGGTGCCTGT
GGCTCAAGGAGTAGGGCACCAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1189..1305, 2560..2560, 2562..2657, 3112..3129, 3131..3160, 3162..3206, 3882..3944
1001..1014, 1189..1305, 2560..2560, 2562..2657, 3112..3129, 3131..3160, 3162..3206, 3882..3941
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved