Otolemur_garnettii Locus CENPM
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii CENPM
Otolemur_garnettii
CENPM
GeneScaffold_4829
SNORA70
2012..2131
14749
CATACACTGGAGCTGACAGGTTCAAATCCAGCCTAGGCCGGCGAAACAACAATGACAAC
TATAACAAAAACAAAAACAAAAAAATAGCAGGCGGCACCTGTGGCTCAAAGGAATAGGGC
ATTGGCCCCATATGCTGGAGGTGGCGGGTTCAAACCCAACCCCGGCCAAAAACTAAAAGA
AAATTAGCTGGGCATTGTGGCGGACACCTGTAGTCCCGGCCGCCTGAAAGGCTGAGGCTT
TAGGAGAATCGCTTAAGCCCAAGAATTTGAGGTTGCTGTGAGCTGTGATGCTACAGCACT
CTACCAAGGGCAATAGGTTGAGACTCTGTCTCAAAAAAAAATTGGCTTGGCGCCTGTGGC
TCTACTGGGGGTAACAAAGTGAGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAAAAGAAG
AAGAAGAAGAAAATTAGGTTAACTTAAGGTGGCCAGTGTAAGGAGCTAGGCAGCTATGGA
GATTCTACACTTGCTTACACATTGGTTGTGGGGTGTGAAGGAGTCAAGAATGACCCCAAG
GTTTTGTTCTGAGCAGCCGCAAGGATGGAGTCAGCTGAGATGGGGGACGACGGGAGGAAC
GGGTCTGGAAGGAACTAGGAGAGTAGTGAACGGCCAGGCTAGGTGGCTCCCATGTGTAGT
CCCAGCTACACCGGAGGCTTAGGCATGAGGATTGCTCCAGCCCAGGAATTCAGGGCCAGC
CCGGGCATCACAGCCACACCCAACTCTAGAGCTCTATGAATGAAAAGTAAACGAACGAAT
CACTGGGAACTTCCTCTGAAGTGTGGCGCAAAAGGCCCTTCCAGCACCTTCTGTTCTTTG
TCAGCGCTGGAAAGTCCCCTAAGGAAAGAGCATAGCGGTTCCTTTAAGAGAAGCCCCGCC
CAGGCAGGGCCACGTACCCAAAGCCTAGCACTTGGGGCGGAGTCCCGGCAGTTTGAAAGT
CTAGCGCGCACCCTGGAGCGGCGGTTTGGCCTGCAACTGGGATGTCGGTGTTGAGACCAC
TGGACAAGCTGCCTGGCCTGGACAGTGCCACCATCTTGGTAGGTGCAGACGGCTCCACTT
CTCTGCCTGCCTCTCCTCTGCTGCCCGCAGTCGCCCGGCCTCTGCGCTCTGGGAGGTACA
GGCGCTGACTGTTCGGGCCCGGGCCCAGCTCAACCCCGCCCATTCGCCAATCATAAGCTG
GTAAAGAGTTCGCCGCGGACCTATTGGTGGATGTGTCCCTCCTCTTCAGGGAGTAGCTAC
TCGGATTAGCTCAGAGCCTGGCTCTCCCGCCTACCACCCCCATCGAGTGCGGACATGATT
TTTACGCACAGCAGAGCAGGTTTCCTTACCCGCAGAGGCCTGACTTTTGGAGGGAGGGTC
GGGGAGGAGTCCGTGCGGTGCCAACAGGCGCGGAGCGGGTCCAAACCTCAATCCTCCAAC
CCGATCCTCCTCGCAAAGGTCCTCTTCTCGGGAAATGGCACCGTCTGAGCTGCCCTGGAG
CGGTGGCCTGATCTCCCAGGGAGTAGTTCCAAGTGCCAGACCCTCCCAAAGGGTTGCTGT
GCCCTAGTCTCAACCGGTCTCTTTCTCTCTCCGGGCAGCTGGTGGGCGCGGAGGATGCTC
AACTACAGCAGCTAGCGGACTCGATGCTCAAGGAGGACTGCGCCTCCCAGCTGAAGGTGT
AAGTAGCTGCAACTGTGTCCTGAACTTTGGGTGGGGTCTGAGGGACTGAGGAGACAGGGG
CCGGGGCACGGGGGTGCCTGTTGGCTAACTCCTTCTTGACATGCCTTTGCCCTCGCTGAA
CCTGCCTGTCGTTCTGCCCCAGAGCTGGCGCCTTCTCCCCTTCAGATGTGCATATACCGC
AAGCAGGACCCCACTGAGCACTTGGTCTAAGTAAGGTAGCCTCCATCACTCTCTGCCACC
ACATATGTTCTGTTTCGCTCATGGAACTTGTCACAGTAAGAAATTAACTGTCCAGAAGAG
AATTAAAAAGAAAGAAGGAATTACCTGTCCACCTGCAACCAATTAAGCCGATTGAGTTCC
TTTCCTCATGGGGACCTAGTACAGCAAGCTCCTTGGGAGTATAAGCAGCCTGATGCTTGT
ATGGATTGCTGTCAGGGACCGTGGAAACAATCCTTTCCAATATGTGTTCACGTGTCTGAC
TGTGTGCTGTCCCCAGCCTAGGCTCCAAACAGTTATTGTGGTGCCTTTGGAAAGTCCCAG
GACACTGTGGCCAGGATTCTTATTGACCAAGTCATCATGTCCATACACATCAAACTGCAG
AATAAGGAGCATGTGATTGAGGCCTTAAACAGGGCCAAGTTCAAGTTCCCTGGCTACTAC
CAGAAGAGTCACATCTCATAGAAGTAGGAGTTTACTAAGTTTAGTGCAGATGAATTTGAA
GAAATGGTGGCTGAGAAGCAGGTCATCCTAGATGCCTACAGGGTCAAATACATCCCCAGT
TGAGGCTGCTTAGACAAATGGCAGGCCCTGTATTCACTCTTAAGGGCTTCTACTGTGCTG
CTGCCTCATGTGCACCTACCAATAAATCTTACTTTTTGATTTTATAAAAGAAATTACCTG
TCTATTTGTCACTTTACAAGGTCCATTCTGCCACATGGATGAGAGTCAGGCCCCTGAGGG
CAGGAACATTGACCCTTGTTCACTGGTGAATCCCCAGTGCCTTAAGTAGTAACTGGCACA
GAGTAGATGCTCAGTTAATAATTGTGGAATTAATCTGGTTAATTCAAGATTCATGAAGGC
TTTTGAGAGGAGGGGATGCTGGAAATGTCTAGAGATTAGTAAAAGTGGAAGACAAAGATT
CCTCAGTAAATATGGTGAAATAAAGCTGACTACAAAATTTTCTTCCCCTCAAACTTAATG
AATGAATGGGAAAATAACAAAAATCAGCAAGCTTCAGTGGCAGCGAAATATTCTGGCATG
GTATGCCTGCTACCCCTACTCCCACAACAAAAGTCTGAGAGTTCTTTAATATCCCTCAAA
TTTGGAGAAAAGATAACTTTTGTTTTCCTTCTCCTAACTGGTAAAGGAGTAGAAACAGCT
GCTGTTTTAGTCAAGTGACTATGTCGTTGTCCTTGATAGAAAAATAGGCCCAGGGGTCTG
TGTTGAAGGAGAATGATCCAAATCCAGAGGATATTTCTCTGAGGACATTGGAATGCCCTT
ACTAGGGACAATAAACCCCAATATAGCACTTGGAGGACTCTGATGAGGAAGTATAATCTT
TCCCTCTAAATAAAGATTGTTCATTGGTCTTTCTGTGCTCCACCTACCTCACCAGCTCTC
AGGCTACTGAACATCAAACCTGACCATCAGTTTCGAATTTGTAGCTCAGAAATAGGAAAG
GATTAAAAAATATACTTAGGGTGTCGCCTGTAGCTCAGTGAGTAGGGCACTGGCCCCATA
TATGGAGGGTGGCAGGTTCAAACCCGGCCCCGGCCAAATTGCAACAAAAAAATAGCCGAG
CACTGTGGCAGGCGCCTGTGGTCCCAGCTACTTAGGAGGCTGAGGCAAGAGAATCGCCTA
AGCCCAAGAGCTGCAGGTTGCTGTGAGCTATGATGTCATGGTACTCTACCAAGGGCGACA
AAGTGAGACTCTGTCTCTAAAATAAATAAATAAATAATATACCTAATTAGTATCAGGGTA
AGTGGACAGAATGGCCTACACTGAACAAAAACAAGATGGAAAGAAGTGTCATGGGCACTG
TTGCAAAAAAAAGGGCAAGTCAGATCACAAACAAAAAAATCTAAGGAAGAACCCACTCTA
AAAAACGGAGAAGAAAGTTGTTTTATTTTTTCCTGGTGTTTTGGGGAAATCCCAGGACAG
TGTAGAAAAATTACCCTCCAAACTTTGGTTCAGAACCAAAGGATAAATTAGACAAGCCCA
ACTTGATGAGCTGGATCTGTTTATTAGAGGTTGCTTACAAGGGCTCTTGCTTCTAAGCAG
CACGGGAATTTCTTCCACAGGAGCTTTCTTGCATGCAAAATCCACACCACTCCATCTCTT
CCCAATGAGTAATGCAAAGTTTTTTTGTTTTTTGAGTCTCATTTTGTTGCCCTCAGTAGA
GTGCTGTGGCGTCATAAGGAACCTCAAACTCTTGGGCTCAAGAGATTCTCTTGCCTCAGC
CTCCTGAGTAGCTGGGACTACAGGTGCCTGCCACAACGCCTGGCTAGTTTTAGAGACGGG
TCTTGTTCTCACTCAGGCTGGTCTCAAGCCGTGAGCTCAGGCAATCCACCCAGAGTGCTA
GGATTACAGGCATGAGCCGCTGCACCCAGCCTAATGCAAAGTTTTTACAGTTTTCTTTTT
TTTATTGTTCACAGTGAAATAAATAATGCAGGTACAGTACCGTTATCATGCTGCCATGCA
ACACGATGCACATATTACAGTTTCCCACTAGGCAGGGATTACAGTTAGCTAAAGGGCACG
GTAGGACATTCAAAGCAGCTCTAAAGGAGTGAGGGCCAGTTTGAACTGGCTATTTCAAAG
CAAGAAAGTGCTGGACACTTTTCCAAGGTGGTAATTATCTTGGTAAGGGCTTAATTACTT
TGTAACAACTTTGCTTAGCACTCCAGGCTAACCGGGCACAATGTTTCTGTTATGTGATGG
AAAACTTGCCTTTTTCCCTCATCTGTGTATTGAGAAATTTAATAAGAACATGAATTTGAA
AGAGAAACATTGAGAGACCAAATAATCAAACAACAGAAAGAAAAAAGGAGGTTGCAGAGT
TAAGAGTAAAAAACGAGGGCCCAAAATATTACCATTTGAGATCTAATAAATATATAGAAA
CACTAAGGATCAGAGTGGATGTAATTGAAAACTCTTTTTTACTATTTACAAAGAGAAAAG
ATTTGAGGAATTATAACAATGGTGTTTGAAAATATAATAGAAGGCTCGGCGCCTATAGCT
CAACCGGCTAAGGCGCCAGCCACGTACACCTAAGGTGGCGGGTTCGAATCCCCAGCCCGG
ACCCGCCAAACAACAATGATGGCTGCAACCAAAAAATAGCCAGGCGTTGTGGTGGGCGCC
TGTGGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAG
GTTGCTGTGAGCTGTAATGCCACGGCACTCTGCCCAGGGGGACAGCTTGAGGCTCTGTCT
CAAAAAAAAAGAAAATATAATAGAAGAAAATTTACTGAAATGAGTGAAAAGTTAAATTTT
TCCATTAAAAAGAATATCTTATTTGAGGAAAAATGGATATAGTATACTTGATATCAAGTT
AATATCCTAGTTAAGGTATTGAACTTAAGGTATAAATAAATTTTCAGGCTTTTAAACAAA
TATTTTTAATTCTCTGGGTGTGTAGTACATGAGTACATGGCAGGGATAAGTAACTTTTGA
GACTCTTGACCTTGTGACTCATTCTGGTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGAAGGGGCCACAGGAGTGGATTGCGGAGTCGCCTCCTGCGGCTCCCTCCCAGCTT
TTGTAGGATCCCCACCCTTGGCGGCACAAAAAGGCACATGACGCCCTCTCTTCTTATAAA
TAAAATATATATATGAAAAAAACATGAGGAAGTGGCAGGCGCCCTATTGCCTCAAAAGCG
GAGATGTGGGGTGCTTGGCCTCCCATATGAGCCCCGAGAGTGGGTGGGGGTCCAAACCAC
AGCCCCCGGGCCAACAAACCTGCCAAAAAAAAAAAAAACTGAGGCAAGAGGATCACTCTG
AGCCCAGAGTTGGAGGGCTGCTGTGAGCATATAGACACCCACAGCACTCTCTCCCAGGGC
AACACACTTGTGACTCTTGTCTTCTCGAAAAACAACAAAACAATGTTGATGTAATGTACA
TTTATGAGTCTTGACCAAATGGTAGGATAAAGTATTAGAATGTCAGGTTTATTTTTTTGG
TTGTAGTTGTCACTGTTGTTTGGCAAGCCCAGGTTGGGTTCGAACCCGCCAGCTCCGGTG
TATGTGGCTGGCGCCCTAGCTTCTGAGCTACAAGCCAATTTTTTCATACTCTTTTAAAAA
ATGGGCTCCTTAGGCGGCGCCTGTGGTTCAGTGGGTAGGGCAACAGCCCCATATACCCAG
GGTGGCGGGTTCAAGCCTGGCCCCGGCCAAATTGCAACAAAAAAATAGCCTGGCGTTGTG
GCAGGTGCCTGTAGTCCTAGCTACTTGGGAGGCTGAGGCAAAAAGAAATGCCTAAGCCCA
GGAGCTGGAGGTTGCTGTGAGCTGTGATGTCACTGCACTCTACCATGGGCGACAAAATGA
GACTCTGTCTCTCAAAAAAAAAAGAGCTCCTTTAGGAAGTAATCTGTATGATTAAGAAAA
GTTTATCCGGCTCGGCGCCTGTGGCTCAAGCGGCTAAGGCGCCAGCCACATACACCTAAG
GTGGCGGGTTCAAATCCACCCCAGGCCCGCGAAACAACAATAATGGCTGCAACCAAAAAA
TAGCCAGGCGTTGTGGCGAGTGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGACAGGAGG
CTCGCTTGAGCCCAGGAGTTGGGGGTTGCTGTGAGCAGTAAAGCCATGGCACTCTACCCA
GGGGGACAGCTTGAGGCTCTGTCTCAAAAAAGAAAAGAAAAGTTTATCCAAAGTTCATCT
ACTTTTTCAATTTAACTTTAGTTATTTTGCTTTTATTCATTCAAATTAAACACTCCTATC
CAGTTTTTAGATCATATTTATTGTCTGGATATGTATATATTATGCACATGAAGGCATGTT
TAGAAAATGTTGTAATGCTAACAGTGGTAATTTATAGGGGACTGGACTTTGAGGGGGGTA
TAGGTTGGGTTTTTTTTTAATGGTCAGTAGTAGAACATTCAAGAAAAGCCTTTGGGTGGG
TATTTGATAACTGGAGACCAAGTCCAGATGTCCCAGTTGTGTGCCCCGTGGTCACGTGGT
AATTGATAGAACTGGGACGTGAGCCCACATCTGCCTTACTCTAGAGGAGTTCAGTTTTAG
CTCTTAAACTTCATGGCCCAACACCTCCTATTCTGAACCAGGTCTCCCTCCTTCCCACCA
TGCAGGTGGTAACTACATGGCTATAAGTGCATGACATCTTATATCCAGACCTCCTCCTTG
CCTACGTGGTTACTAAATAGATCTCCTTTCTGGAAGAGAGAATCAGACAGGAGTGATCCA
GATAGGACTGACTCTGTCCTGCCTCTGCACTCACCCAGGGGGTCTTGGCAATAGGAGTCT
TGGTTGGGAGCCCTTGACAGCCTCTTCCCCATGAAGGGCAGCGTGTGAACATTCACTATG
CATCTGTGTTTAGTCCTGTAATTTCTTGTTTTTCAGCCACTTGGCAAGGTCCCTCCCATT
GCCCACCAATGTGAGTCGGCCCCGAATTGATCTGATTGTGTTTGTGGTTAACCTTCACAG
CAAATACAGGTGAGAGCAGAGCATGGGGCTGTCAGGACTCAGGCAGACCTGGCTTGGGAG
TGTGCTGGGACAGTGACCTCACTTGTAATGGGAAGGGGGGGAGGCTACTGGCTCACACTG
GTTGTCCTAGCACTTTGGAAAGCCAACTCCTTGAGGCCAGGACTTTGAGATCAGCCTTGA
CAACATAAGGAGATCCCGTCTCTACAAAAAACAATAATTAATTACCCAGGTGTGGTAGCA
TATAGGTGTGGTGCCTATAGTCCCAGCTGCTCAGGAGGCTGAGGCAAAAGGATCTCTTGA
GCCTAGGAGTTTGAGGTTTCATTGAGCTGTGATGATGCCACTACACTCCAATCTGGGCAA
CAAAGTGAGACTTTATCTCAAAAAAAAAAACAAAAAACACCTGAACGATGAGTCAGTCAG
GTAAAGATGGGAGCGAGGCCCTCCTGGGGTATGAAGCTGAGGCTATGCAGAGCTCAGAGT
CCAGCAGACACTAAGACACCACTAATGCTGTGGTAGAAACCCCCAGGGAGCCAGGAGTGT
GGAGATCCAGATACAGGTGGCCTCAGGACTAGTCAGCAGGGGTTGAGGCCTGTAGAGAGA
CTGAGAAAAAGCTGAGATCTGCGGTGAAGGCTGCAGGGTAGGATGTGTTACCTCAGCAGA
TCTGTTGCTTTCTGAGTGAGGCCTCTGTGCTCCCTGAAAGGGCACTGGTCTGGTCTTGGA
GAGACCCAGCTCTGCACCCTCAGGAGCAGGGTCATTGTGGCTTTTGGCCTCAGGCTGAAA
CCTTGGCTTGGGCCACCTAACCAAGACGACCTTTTTTGGCCAGGAGTCAACAGTCCCTGG
ACACCAGTGAATGAAAGCCTGGGCCCAGGAGGTCAAAACATCCCTTGTTTGGAGGAAAAA
GAGCATTTTCATACAGTGGTCTGATTAAATTATTGCAACGAATAATGAAAGCACTTTGGT
AATACCCAGCTCCCTTTTTTTTGGAGACAGATTCTCACTATGACACCCTAGGTAGAGTGC
GGTGGCATCACAGCACACAACAACCTCAAACTCTTGGGCTTAAGCAATTCTCTTGCCTCA
GTTTCCCAAATAACTGGGGCTACAAGTGCCCACCACAATGGCTATTTTTATGTTGTAGCT
GTCATTGTTTTTGGCAGGCCGGGGCCGGGTTTGAACCCACCAGCCCTGGTGTGTGTGACT
GGCACCCTAGCCGCAGAACTATAGGTGCCAAGCCCTACTTTTTTTTTTTTTTGAGACAGA
GTCTCACTATGTTGCCCTCAGTAGAGTGCTGTGGTGTCACAGTTCACAGCAACTTCAAAC
TCTTGGGCTTAAGTGATTCTCTTGCCTCAGCCTTGCAAGTAGCTGGGACTACAGGTGCCC
GCCACAATGCCTGGCTATTTTTTTGTTGTAGTTGTTATTGTTTGTTTTCTTAGCAGACCA
GCCCCGGTGTATGTGGCCAGTGCTCTAAGCACTGAGATATAGGCGCTGAGCCACCCCATC
TACATTTTTTTATTATTATTTATTTATTTATTTATTTTGGAGACAGAGCCTCAAGCTGTC
CCCCTGGGTAGAGTGCCGTGGCATTACAGCTCACAGCAACCTCCAGCTCCTGGGTTCAAG
TGAGTCTCCTGCCTCTGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCG
GCTATTTTTTGGTTGCAGCCGTCATTGTTGTTTTGGCAGGTCCAGGCTGGGGATTCGAAC
CCGTCACCTTAGGGTACGTGGCTGGCGCCCCTAGCCGGTTGAGCTATAGGTGCTGAGCCC
CATCTACATTTTTTAAAGACACATGCTATGACCCAGCCATTCTGCTTCTGGGATCTACCT
ATCCCTACAGAAATACTTGTTCAGGATGTGGCAAAGGATGTGTGTAAAAGAATGTTCACC
CTGCATTGTCTGGAATAATGAAAAATCAGAGACCATGTGGATGCTTATCACTGGGGGAAG
CAGATTGTAGGGATGCTTTGCCAAGGCATCCTTGANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGGCTTTTCAAGTTCAAGCATCTTTCTACTCAGCTTCCCCA
GGTAGCTGGGGCTAGAGGCACATGCCACCTCACCTGGCTTATTCTTTAATATATTTAGAG
ACAGGATCTCACAGTGTGCCCAGGCTGGTCTCGAAATCCTAACTTTAAGCAGTCCTCCAT
CCACCTTAGCCTTTCAAAGTGTTGGGATTACAGGTGTGAGCCACCATGCCTAGAAGTAGT
TTTTGAAAAAAGGGATAAAAGCTTCTCCAGGGCTATTTCCTGTCACCTTCCTCTTATTCT
CTGACCTTTCTAAGATCAGAGAAGGGGGTTTCTGTTTTCCCTGTGTAAAGTTTGTCCTCT
GATCTGCTTTCTCATGCTGGCCTGGCCACCCCAGCCTCCAGGTCACAGAGGAGTCCCTGC
ACCATGTAGACACCAGTTTCTTCTTGGGGAAGGTGTGCTTCCTCGCCACAGGCGGTAAGT
GTGTCCTGCACGTGCCACTGTCCACCCTAGCCAAGGGAAAGCTGTGGCAGTTGTAGATGC
CTTGCTGAAGTGGTCTGGGGATGGAGTTGGACTTGTGGTCAGCCTTTCTAAAAGTGGATC
CAAACAGAGAATTTTGCTGTTGCTTAGAGTCTCCTAGTGGCTCCCTGTAGCTTTCAGAGT
AAAATCCAAACTTCTCCAAACACTTGAAGTACTTTGTGGTTTGGCCTCTGCCTTCTTATC
TACTCTCATTAGTCTCTCATTCTTTGAGTTAGGAAATAAAAATAGCCAACTTTTACTGAG
TTCTCACTGTGAGCCAGCCATTGTTTGTAGCTGCCTTGTTCTTTATGTCATATTAATATT
TGAAGTAGGCATTATTGTCCCAGTTTTTATAGCTGAGGAAACTGATGATGATGTTAACTT
GCCCAAGGCCCCCATAGCTAAGGAGTGGTAGAGCTGAGGTTCACACCCAGATAGTCCTAT
TCCAGGGCCCGGCCTCTTTTTTTTTTTTTTTTTTTTGGAGACAGAGCCTCAAGCTGTCCC
CCTGGGCAGAGCGCCGTGGCACTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGGG
AGTCTCCTGCCTCCACCTCCCAAGCAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGC
CATTTCTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGACTCGAACCCG
CCACCCTAGGTGTACGTGGCTGACGCCTTAGCCGGTTGAGCCATAGGCGCCGAGCCAGGG
CCCGGCCTCTTAATGGTACTATGTGGCTTCTCTCAAATACTTTTTTCTTCTTTGTGTTGC
TAACACCTACAATTACTTCAAAACTCAGCTCCAGTGTCACCTCTGGTACCAATGACATGT
CTGACTCTCCAGCTTAAGTGTTAGCTCCTTGAGAGAAGAAGGACTTGGCAAGATTATTCT
CAGTAAGCGCTAGGGAAGACATGAAGGCCAGGTCGTTTCTAGGTATCAAGTCATTGGCTC
TGGAGTAACCAGTGGGGTAGGAGCTATCATTGTCTAATTTAATAGCCTTGATTACCCAGA
AAAAAAGGGTAGAACAGGATTGTCACCCCCACTGACTAGAAAGAAACTGAGACCCAGAGC
GGGGAAGTGAATTACTTTGCCTGGCACTCACTGGGTTACAGCCATGAAGGCAGAGGTTAC
TGCCGTCACTCTCACGGTTTCCTTGCAGCTGGGCAGGAGAACCACTGCAGCATTCATCGG
CACACCATTGCGAAGCTGGCCCACACCTACCGAAGCCCACTGCTCTTCTGTGACCTGGAG
GTGAGGACACAGCCACCTGTGTTATACTTGGGTACAGGGAAGGGGCAGTCAGCACACAGT
GCATCGTCAAGAGCAACTTACTGAATGATCAAGTAGCCAAGTGAGGTGGCTCCTGATGTG
GAGGGAGATGAAAGATCCTGCTTTGAATCCGGGCTTTTCTGCTCACTGGCTGTGACCTTG
TTCTTTCCCTGGGAGATCAGAGCCACCCCACCCATGCACAGGCCTGCTCAGTTGCTTTGC
AAATCTATTTATTAGTTATGAAGTTCATTTTGAAGATTATGTTTCTGCTCTGTTCTGGGT
GTCACATCCATTCCCAAAGGCAAAGTGATGTGACCTTTCACTACTGTCTAGACCAGCAGT
TCTTATTCTGGAGAACTTGAGTCTGAGGACCAAATTCAAGGAATCTGTGAACTTGGATGA
GGAAAAAAAATCTTTTTTTCCTACTACTAAGTGAAATTGAGCATTATGAGTGTAAAAAAG
ATATGTGGGTAGTTATTAGTAGTGTCTGTGACTGTTGCCAATAGAAATGGCAGGCAGCTG
TGTGTGATGCCTATAGTCCCAGCACTTTGGGAGGCTAAGGTGAGAGAATCACTTGAGGCC
AGAAATTTGAGGCTGTAGCCTGGGCAACATAGTGTGAACCTGTCTCTATTTAAAAAAAAA
AAAAAAAAAGACAGGCAAGGTGGCTCACGCCTATAATCCCAGCACGTTTTTTTTCTTTCT
TTTTTTTTTCTTGAGACAGAGCCTCAAGCTATCCCCCTGGGTAGAGTGCTATGGCATCAC
AGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCAAGT
AGCTGGGACCACAGGCGCCCGCCACAACGCCTGGCTATTTTTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNACTGGCAACAGTCTTGTCCCAGCTGAACCCCACTGCCC
TCTCCACCCCCAGCAGCCTGGGTAAAGGAGCTCCTTGTGAATGGTGCCTCCGCAGCCATG
ATGGGGGCCGCTCTCCCTCCCTCCTTCCTTCCCACCCCTGTGAGAATGTCTTTCTCAGAT
CCTGGTAAGTGAGCCTTTGGGGCCCTGTTGTCTGGGACTAGTCCTAGCTGGAGCCCAGCT
CTGTAGTCCCTGTGTGACCTGGATGATTTACTGGACCCAGCCCGCCTTGCTTGCTAAGCC
TTCGTTTCCTCTTGAGCAGAGATCAGTCTGTGGGTATCTCTGGAGGCTCTTTGGGGGATT
GTGGAAGCTGCGGTGGTTGGAAACTACTTCATAAAGTGTGGCGTGAACAAAGGTCACTGT
GATGGGCAGTGGAGGCCGAGCTACCCTCTGGCAGCCCCCGCAGCTATTCTGAGGGAGGCG
GCCGGCTGCTGCGCAGCTGACTCACGGTGGCTCTCCGTTCTCCCCGCAGGTGGAGAGCTT
TCGGGCCACCATCGCACAGCGCCTCGTGCGCATGCTCCAGATCTGCGCTGGCCACGTGCC
TGGTGTCTCGGCGGTGAACCTGCTGTCCCTGCTGAGGAGCTCCGAGAGCCCCTCCCTCGA
GGATCTGTGAGGGCCAGTGGCCCCTGAGCTAACCTTCCCCAAAGCCTGGTGCCAGCTCCG
TCGTTGTTGGCAGGGACACCTCAGGGCTTGCTGGGCCCTGGGTCAGCTGCAGTGCTCTCG
CAGGTTGCCGGCAGGGAGGGTGCATAGCCTGTGCCAGAGCTTTGTGCCTTTAACTGCCAA
ACATGTGACATTGCTACTTAAGATTTTGTTTGAACAAAAGGGTCTGCGGCTGAAAAAAAT
TTGCGAACCAACTGGTGTCACCTACTACTTTGCCTCTGCAGATGAGGAAACTGGCTGAGA
ACAGTTATCAGGGAGCTCAGACTCCTGAGCTGGGTCTCAGTCACATCCTGGCCCTGCTTG
TTCCAGAACCTCATTGTTGCCTCTGGGATCTCAGTTTCCCCAGTGTAAATAGAGAGTTCT
GCTCACCTCGCAGGAGGGGACCGAATGGAACAACGGAGGGTCTGAGGCTTGTCACTCCTG
CCCTGTGGTGGGTGGACTTGCCGTGTTCATAGCACAGCCTCGGCACCTTGCACACTCCCA
ACAGACCCTCCGGCAACAGTCACTATTGGAAATCACACAGAGCTGGCAGCATGCAAGGGT
CAGTGCGTAGGGCACTGGCCACAGACACTGAGGCTGTGGGTTTGAACCCGGCCTGAGCCA
GCTTAACTGCAATGACAACTGCAACCAAAAAATAGCTAGGTGTTGTGGCAAGCATCTGTG
GTCCCAGCTACTCGGAGGCTGAGGCAAGAGAATCACTTAAGCCCAAGAGTTGGAGATTGC
TGTGAGCTGTGACACCACTGCCTCTACTGAGGGCGACATAATAAGACTCTTGTCTCAAAA
AAGAAAAAAAGAAAAGAAAAGAAAGGAAATCACACAGAGCCAAGTCCAAAAACAGGTGCA
GATTGGGACTCATACCACAGTGTCAGAAGTTAGTGAAATGGGCCAGGTACGATGGTTCAT
GCCTATAATCCCAGCACTTTGGGGGGGCAAGGTGGGTAGACCATTTGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1598..1677, 7536..7628, 10714..10793, 12028..12119, 13609..13749
1001..1057, 1598..1677, 7536..7628, 10714..10793, 12028..12119, 13609..13746
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved