Otolemur_garnettii Locus SF3B3
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SF3B3
Otolemur_garnettii
SF3B3
GeneScaffold_4600
SNORD111
19784..19862
50869
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTAAAGATTTGATACTTAGTCTGAAGCAAGAAGTGAGACCTTGTCTCT
AAAAATGACCGAGTGTGTGGTGGGCACTGTGGTCTCAAGTACTAGGGAGGCTGAGACAAG
GTAATTGCTTAAGCCCCAGAGTTTGTGGTTGCTGTGAGCCATGATGCCAGGGCAGTCTAC
CAGGGGTGACAAAGTGAGACTCTGTGTCCCAAAAAAAGAAAAAAAAAATGTTGTTTCTAA
ATAGGCCTCACTCTACTAGTTCTGACTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAG
CTGTCCCCCTGGGTAGAGTGCCGTGGCATTACAGCTCACAGCAACCTCCAACTCCTGGGC
TCAAGTGAGTCTCCTGGCTCCGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAAC
GCCCGGCTATTTTTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTA
GAACCCACCACCTTAGGTGTACATGGCTGGCACCTTAGCCGGTTGAGCTATAGGAGCCGA
GCCAGTTCTGACTTTGTAACCAGAAATTTCCATACAGAAATGTCTATTAATAATAATTAA
CCAGCTCTTTTTCTCTTTTTATTTGTCTTTAGCTTTCTTTGACTTGGTACTGTTGGTATA
CTAAGGCCTGGAGTTCTGAGTGGCTCAGTTTTGCTGAAACCATGTTCCTGTACAACTTGA
CTTTGCAGCGAGCCACTGGCATCAGCTTTGCCATTCATGGCAACTTTTCTGGTAAGTTCT
GTAGATACTATGTTGTTTATCTCTTGTGGTGGAAATGTTTTACATTTACAAGAAAACAAT
TGGTGAATGTAAACAACACAAATCTGGCTTGTAATTTATAAGATTTGGTGTTAATTGAGG
TGTATTATCTGTTACCTAACTTCAGGTCTTTTTGTCACATTGTGTAATTTTATATTTGTG
TACATTTCTTGGTTACCTGCCTAGTGCCAAGTTGTGTGTTTATTGCTGTGAGGTATAATG
ATATGTGTAAGATGTGACCCTTGATCTTGAATTTGACATCAAATTGGATAAAAAGAATGT
CTAAAGGTGTTTGTTAGGTTGAGAGAATAGTTTTAAAAAAGGAGTTTACCTTGGCTTGGT
ACTTGAAGAGAAGGGAAAGTGCAGGTTAGATGGGGAGTGCTGCTTATGTAGAAACATTGT
TTGCTGTTATTTGTTTATTACCTGCTTTGGCCCATGTGTAGTAAGCTGGAGTGGTGGGGG
ATATTTTTGGAAAGAGGAATTAAGACAAGGTGTGAATTGTGTGAAATGTCAAATACTGGA
TTAGGAAAAGAAGTGGTGAATTGTGTGAAATTTCAAATATTGGATTAGGCTGGGCAAGGT
GGCTCACAACTGTGATCCTAGCACTGTGAGAGGCCAAGGCAAATGGATTGCCTGAGCTCA
GGAGTTTAAGACCAGCCTGAGCAAGAGTAGAGACCCCTGTCTCTACTAAAAATTGAAAAA
CTAACTGGATGTTGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTA
GTTTTCCCGGGTCACCTAATGCCCTTTAGGATTGACAAGGGAGCCCCAAAAGAACTACAT
TTGTTAGTAGGCAGTGACTGCTGGTCGAAAGTGTTTATCTGGGAATACCCAGCCATCCAA
GAATATGTTTGAGAAAATATCACCAAAGAAACATTTGGCAAGAGTGGATGTCGCAGTATT
GTTCCTGGGCCAGTTCTTAGGCTGTGGGTCCCAAAAGGCCCGTGTTTGTTATGATTAGTG
AGTGACTTGCTCTTACTTGGCTCTATTGAGTACATCTCTTTTATAAATGCTCAATTTTAG
GATAATAGTGCTGTGACCCTTGACAATGTGCTGTTGCATCGCTTATATGGGTAAAAGTTT
GGCATTTTCTTTAAAAATAATGGAAAAAGTCTTAATGCACTTTTTAAACTTTGCTTCTAG
TTGGAAATAGGATTTTTTTTTTTAAAATTTACTCCATTTGTATAGTAAAAAGGCTATAGT
GAAATGATCTTAGGGTAGTAGACAATGAGTATGGTTGCCTTCATCAGCCTGAAATGATGA
GTCACATTCATGTCTCTTCTCTGATAAATTCTTGAAGAAAATTCTGTGTATCTGATCGGG
CCTCTAGAGGGCAATCTTTTCTGAGCAGTCAAAAAACTGCTAGGTATACAAAGAATAAAA
TTAAAATTAACCTGTTTATGAGTTATTTAGTTTTTCAGTAACCTTAAATCTAGGACACAT
TTAAAAATTTTAAAGAGTTAATGTGTTATTAAGATCCCATTAGGAAGGAAGAGACCAGAA
TTATGCTGTTACTTATTTTAAGGATAGAAACCCCACCTCATGGGTTACTGCACTTATAGA
GTTAGTGCTAGCTGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTA
AATCTTTTCATTATCTGAAATCTTTTTGACTATAGGTGCCATTGAGAAACAGAAATTGGT
GTATATCTTGAACAGAGATGCTGCAGCCCGACTTACCATTTCATCTCCCTTGGAAGCCCA
CAAAGCAAACACTTTAGTATATCATGTAGTTGGAGTAGATGTGGGATTTGAAAATCCAAT
GTTTGCTTGTCTGGAAATGGATTATGAGGTAATGGGGACCATATTTTTCTCTTTGGGTAA
CCTCATTGTTTTCCTAAGACTGTTTTCTTCCTTGTGCGTATCTTAAATCTCATTTTTTCC
ATATTCCAAATGTCTTACTGAAATTCTTTGGAATGTTTCAGAGCTTAATTAACAATATAT
GGTAAATTAGGTCATTCAATATGAAATGTCTGATTTCGAATCAAAAATCTAGTTTATGGC
TCAGCACCTATAGCTCAACTGGCTAAGGCGCCAGCCACGTACACCTAAGGTGGTGGGTTC
GAATCCCCAGCCCGGACCCGCCAAACAACAATGACGGCTGCAACCAAAAAATAGCCGGGC
GTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTTGA
GCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGCCACGGCACTCTACCCAGGGGGACAG
CTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAAAATCTAGTTTATTACATCTCAAACA
AGAAGCAATACAATTAAAGTATGCCCCTAAACTATCGAAAGTTTTCCATTTTAACAGTAG
GTCATGTATGCCAACGGGAAAGAAGCCTAGAGAGTGAGTGGTGCTAAAATCAACAAAAGG
TACTTTCCACAGCTCAGTGAGAATTGAGTATTTTTCCTTGCAAGAAGTGGTAGTCAATTG
GTAAAGGTCTAATTAACATGGTGGATCACAGCTATGTTTGTGCAACAGTGTTACTTTGCA
AGAGAATTAGCCTGTCTCTGTTGACCAGTCTCAGATGCTTAATCACAAGCATCCTCATCA
TGTTGTCCAATTGGTTGCAGTAGACATCCGCTGTAATCCTTTGACCAGTTTTTATGAAGC
TGTGGTAGATAATACCAGCACTGGACCACCAAACAACACCATTAGCATTTTTGATGAATG
TTTGGTTTGTGACTGTTTGGGTACTTCCATCTTTATTCAGCAGTTATGCTGAATGCTTTT
GATTGTCAGAAAGAATCCATTTTTCATCACATGAAACAATACAGTGTAGAAATGGTTTGC
CTTTATGTCGTGACAACAAAGAAAGGCAAGTCTAAAGGCGATATCTTTTCTGATGTTTGT
TGAATGCTTGTGGAACCCATCTATCCAGCTTCTTTACCCTCCTGATTTTTTTCAAGTGGT
CTAATATTGTTGCAATAATAACGTCAAATTTTGCTGCTAATTTGTACATAGATTGAGATG
TATTCACTTCCACTACACCTTTCAGCTCAACATTATACACTTTGATCTCAGGTCACCTAC
TTAGCTCATTGAGATAAATACAAGCCAAAACGTGTTCAGAAGAATTAGGATATACCTTCC
TGATAAAAAAGAGCAGGCATTGAAGTGAAATGTCAGAGATAGCAACTGTCAAACTTATTA
CTTAAGGAAATCAGACATTTCTTAACTTGATCTAATAATAATTTCTTACTTAATCTAATA
ATAACCTTTGCTCCCCATGGAAAACATCTTTTCACTAAAAGATGCTTGAAAAATACTAGG
GTATTTTTTTTTCATAGGGAAATAAAGAAAAGCAGAACATACCATTCTTTGCCTTGAATG
GAAGGCAGTATCCTGTAGTAGAGGGATTCTTGGATCCAGAATTTAAAGATTTGGATTCTT
GTTCAATCTCTGTCATTTACTAGTAGGGTAAACTTGGTTAAACCATTGGACATTTGTGGA
CTTCTATTTCCTTGTTGGTAAACGGAGGAGTCCTGATGTCCTTTCCAGATGTAAAAATTC
TTTGATTTTATGCTGCTAATAAGTGTTTGTGCCTTCTCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTAGATAATTGAATTATAGGTCTGAAGCTAAGAACTGAGCCCCATC
AAGTTGTGCTGAAGGAGATGAGGCGTTGGAAGCTAAATTGGTTTATGAGTATATCAATTC
ACTGTTATGTTTTATTTTCTCTGACAGTTCCGGGAGGGTCAGATGGTCCAAGTGGAGTGC
TGATCTGCTCTGAAAACTATATTACTTACAAAAACTTTGGTGACCAACCAGATATCCGCT
GTCCAATTCCTAGGAGACGGGTAAGGTCTTTGCTATAAGAGAAAGAGGTATTCATGTTTG
TGAAATGAATTTAATTTTTATAATTATAATGTAGGCTCTTAGTTTCTCTGTTGTCAAGTT
TTAGTGTTTTGTATGTTGTTTTAATATATCTGGTAAAATATTTTAGTAAAGGCTCGGCGC
CTGTGGCTCAGGTGGCTAGGGCGCCAGCCACATACACCTAAGGTGGCAGGTTCAAATCCA
GCCCGGGCCCGCCAAGCAACAATGATGGCTGCAACCAAAAAATAGTTGGGCGTTGTGGTG
GGTGCCTGTGGTCCCAGCTACTTAGGAGGCGGAGGCAGGGAGACTCGCTTGAGCCCAGGA
GTTGGAGGTTGCTGTGAGCTGTGATGCCACGGCACTCTACCCAGGGTGACAGCTTGAGGC
TCTGTCTCAAAAAAAAAAAAAATTTTTTTTTTAGTAAAAGCAAAACAAATTCTTTGTGAA
AGTGAATTAAAAATTAACATAATTGCCATTTCAAAGGAGCCTGATAATTGTCTAAGTATC
AGTTTAAAATTCCTGAATGTTTCTGCTAGCTGAGTATCATGGCTAGTGCCTTGTAGTCCC
AGCTACTTAAGAAGCTGAAGCAGGAGGATCTTTTGAGCCCAAAAGTTTAAGGTTTTAGTG
AGTGGTGATGCATGGCACTTTACCTAGGGCAATAGAGTAAGACTTTGTCTCAAAAAAAAA
AAAAAAAAAAATTCTGGGCTGGGCAGTGGATTTTTTTTTTTTTTTTTTGAGACAGTCTCC
CTTGTCACCCTTGGTAGAGTGCCGTGGTGTCATACTTCACAGCAGCCTCAAACTCTTAGA
CTCCAGTGATTCTCTTGCCTCAGCCTTCCAAGTACCTGGGACTACAGGTACCTGCCACAA
AGCCCAGCTATTTTTAGAGACAAGGCCTTGGTCTGGCTCAGGCTGGTCTTTAACCTGTGA
GCTCAGGCAGTCTACCTGCCTCAGCCTCCCAGTGTGCTGGGATTACAGGCATGAGCCATC
TCAACTGTCCCTGAAGTTTTCTAGTTTGGGGAAGCCAGACATATAATTGTCGGAAATAGA
TTGTCTTTTGTTTTTTTCTTAATTTGTTCCAGTGTTTTGTTTTTAAAAATTTCAACATAT
AGGAGATTTAAAAATAATAGCACAATGAATTCCTATATGCTTATCCCTCTCGATTTCATC
TATTATTGTTTTGCTACATTTGCCTTTCTTCTCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTCAACAACAATAA
CAGCTGCAACCAAAAAATAGCCGGGTGTTGTGGTGGGTGCATGTAGTCGCAGCTGCTTGG
GAGGCTGAGGCAGGAGAATCGTATGAGCCCAGGAGTTGGAGGTTGCTATAAGCTGTGATG
CCATGATACTCTACTCAGGGTAACAGCTTGAGGCTCTGTTTCAAAAAAAAAAAGCTGAGT
GTTGGGCACCTATAGTCGCAGCTACTTGGGAGGCTGAGGCAAGAGGATTGCTTGAGCCTA
AGAGTTGCTGTGAGCTATGATGCTGTGGCACTCTACTGAGGGCAACAGAGTGAGACTCTG
TCTCAAAAAAAGTTAAGGAATTGCACCTTTTAGGAAATCAAGCCAGTTGATATAGAACCA
GGGTGGTTGGATGGAAGTGTCATGGACACGTGTTATATTCACAGCCTGAAATGATGACTC
TTAAATTTCATGTCTCTTTGTTATTGTTGTTATTGTAGTTTTTGGCCGGGGCCGGGTTTG
AACCCACCTGGTATATGGGGCTGGTGTCCCACTCCTTGAGCCATAGGTGCCACCCAATTT
CATGTCTTTTCTGACATTTTTATCTGGAGATAGTTTCAGCTAGATCTGATCAGGCTGTAG
AGTAGAATTGTGACTTTTTTTGGTTACCCAGGATATTTATAGCAGATAAGACTTTTTAGC
TGTTGTAGTGCTTTGACTGGTAGGCTGCTCTGGGTCTTTATCCAGAACTGAGAAGTACCC
ATTTTTTGTGGTTGTCATTGTTGTTTTAGCTGGCCGGGGCTGGGTTCGAACCTGCCACCC
TTGGTATATGGGTCTGTCGTCCTACCCACTGAGCCACAGGTGCTGCCTCGAGAAGTACTC
ATTTCTAAAATGTTGGTTTTGTATTTGACTTTGTTAGAATGACCTGGATGACCCTGAAAG
AGGAATGATTTTTGTCTGCTCTGCCACCCATAAGACCAAATCAATGTTCTTCTTTTTGGC
CCAAACGGAGCAGGGAGATATCTTCAAGATCACATTGGAGACAGATGAAGATATGGTAAG
TAAGCCATGGATGGAAGGGGAAAATAAAAAATCCCATTTGTTGTGGTTGTAGTTTGGTAA
ACATTATTACAATTTAAGAAAATCAAATAATGTTTTAAAAACTTGTATTTGTATGTACAT
TTAAGGTTTACAACTCTGTTTTAGAGACCATTTATTCAGTACAACTACTCTGAGATGAGG
TACAGCACAGTTAATATGTTACAAATTAAAATAATGGGAACTTAGAAGCTGTTGGTACTG
GTATATGAATATAAGTTTTCTCTCTCTGATTAACATATTTCTGATTTGGTAACCTTACAC
ATAATGACACTGGTAATGCCACCTCTAGTGATTACTTTTAGGTGGTAATAATTGGTGTCA
CTATGAGGAAGTTCTCCATTTCTATTGAAAACTGGTAATATACACAATCTGTTAACTACT
ATCATCCTATGGAAGAGCTCTGTGAACGTTAGGGCACTTTCTTTGGTGGCTGTTTTGATT
AGGAATTGGCATACTTTTTTTAAAGGCCAGATAGTATATGTTTGCAACTTTGGGGGACCG
TATAATTTCTGTTTCAAATACTCCAACTCTACCACTGTAGCATGGTAACAGCAGTATGGA
AGTGAATGGATGTGGCTGGCCCATGGGAGCTACTTTACTGACCCCCAGTTTAAATATGAA
GTAGAGTATTTTATTTGCTAGTCAGTTCGTACCATCTTATTATAGTACTAGGTTCACTTT
TGGTGGCCTTACTTCACATATCTGTGCACTAGAGTCTTGATTCTTTTCTCTCTAGGTTAC
AGAGATCCGGCTCAAATATTTTGATACTGTGCCTGTTGCTGCTGCCATGTGTGTGCTTAA
AACAGGCTTCCTTTTTGTAGCATCAGAATTTGGAAATCAGTAAGTAATCCTTTATAACCC
TAGGTTACCCTAGTTACTAGTAAAAGTTGGCAGGAGGGAGGTATGGCTTCAAGGCTTGGG
TAGCTTTTCACAAGAATATCTTAGTTTCTTCAAAACTAAAGTTTTGCTTTCCTTTTCTCT
TTAGTGGTTTAGTCAATTCCTCTGTGGTTATCTGCAAACATAATCTTTAGAAGAGATGTC
TTTCTTGAGCTTTTTGCTGGGCATTCTATCGAATAAATACTTAGGGAGCTACTTAACATA
AGGAGATATTCTTTAAGCACTTCATTACTACATAACTAAAGTTGAGGCTTATCATTCATT
ATCCATACCTGCCCACCACATCACCAATCAGTCCTCCCATCCTCATTGTTCCTGTTAACG
ACTAATGGGTCAGTTCTAGCAACTGAAACGTAAAATCTCAGTTATTTCCCCTCCTCCACT
TTCATTTAAATTAAATATATATATATAATATTTTTTTTTTTTTTTTTGAAATGGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACATCTGCAC
TAGTTCACTAGTTTACTTTTTTCATTTCATTGCCTTTCCTTTAAAACTCAGCCTTTTTAG
AGTCATCTCATCAAGTAGACAACAAACCTTGATGAAATAATTTTCCCTATCCCTGCATTA
TGCTCTTAAGTGGCTTTTCATTGCTAAATGGAAGAAATATGAACTCCAGTCTCAATTTTA
AGACCAGTGTCTAAGACTCCAAATTACTTACAAGATAAGATGACATGATTTTGTCAGTAT
CTGCTAAAGGTAGGAAGGCTAATTCTTTCTACTTTAAGTAGAGATGGGGGTCTCAACTGT
TGCTCAGGCTGATCTCAAATTTTTGACTTCAAGGGCTCTTCCCTCTTCTGCTTTCCAGAG
TGCTAGGATTACCAGTGTGAGCCACCATACCCAGCTTTAAGGCCCTATTTTAAATACTTT
GAGTATATACCCAGGAGCGGAATTGCAGAGTCATATGGTAATTTTTGTGTTTAACTTTTT
GAGGAGCCACCAAACTTTTCCATAGCAGCTGCACTATTTTACCTTCCCAAAAAAAGTGTA
TGAGGGTTCCAATTTCTCTACATCCTTCACTGGCACTTAGCACTTACTATTTTCTACTTT
TTTAAAATCATAGCCATCCTAGTATGTATGAAGTATCTCATTGTGGTTTTATGTTGCTTT
TCACTAAAGATTAGTGATTAGTGATGTTGGTTGTGCATCTTTGCTTTTTGTCACCCTCTG
CAGAGTGCGGTGGCATCATAGCTCACAGCAACCTCAAACTCTTGGGCTCAAGTGATTCTC
TTGCTTCAGCCTCCTAAGTAGCTGGGTCTACAGGTGCCCACCACAATGCTCGGCTATTTT
TAGAGATGGGGTCTTGCTCTTGCTCAGGCTGGTCTCGAACCTGTGAGCTCAGGGCAGTCT
ACCTGCCTTGGCCTCCCAGAGTGCTTAGGATTACAGGTGTGAACCACTGCGCCTAGCCCT
TTGTCTGTTTTTAATTAGAGACAGACAGAGTCTTAACTCTGTAGGGTGGAGTGTAGTACA
GTCTGCAGCCTCAAACTCCTGGACCCAAGTCATCCTTCTGCCTCAGCCTCCCAAGTAACT
AGGTGCATGGCATCACACTCAGCTAAGGTTTAAAATTTTTTTGTAGAGGTGGGGGTCTCA
CTAAGTTGCCCAGGCTTGCCAGAAGTTTGATTGAGGCTTGTCTTGAAGTCCTGGCCTTAA
GTGATCCTTCCTCTGTGGCCTCCCAGAGTGCTAGGATTATAGCCACTATCACTGCCCTCC
TTCAAGTGTTTTGAACAATTTTCAGCTATCATGCTTCATCATCACACTTAAAATTAATAA
TAATAATATTTTAATAGCTCTTGTATCGTGTTGATGTTTGACATTGTCTTTAGACAGAAC
ATGTTAAACTAACGTTTCTCTTCTGTGTTTCTCCTCAGTTACTTATATCAGATTGCACAT
CTTGGAGATGATGATGAAGAACCTGAGTTCTCATCTGCCATGCCTCTGGAAGAAGGAGAT
ACATTTTTCTTTCAGCCAAGACCACTCAAAAACCTTGTGCTGGTTGATGAGTTGGATAGC
CTTTCACCTATTCTGTTCTGCCAGGTCTGAGTCTTTCTCCTCACCTCCATAGTGAGCAGT
GCCAGCCGCCTACCTTCAGTTTACTTTTATTTTCAAAAATTTCTTCGCATGGCTCTGTGC
CTAATAGCTCAGCAGTTAGGGTGCCAGCCACATACTCAGGGGCTGGCTGATTTGCATCCA
GACTCGTGCTACCCAACAACAATGACAGCTAACTCAACAACATATATGCTGTGAAAGGCT
GTTGCGGGCACCTTCAGTAGCCAGCTACTTGGGAGGCTATAGCAAGAGAATCCGCTAAAG
ACCAAAGAGTTTGAGGGTGCTTGTGAGCTGTGATGCAATGGCACTCTCCTGAGGAGGACA
TAGTGAGACTCTATCTCAAAATAAAATAAATTTCCCCGCATGAGGCGTTTGGGATTTGAA
GTCTAAAAAATGAATGAGTTTATAGTTTCTTGCAATTAAATGAAGGTTTGTTAGCATGTC
TATGAGATCATCAGTGTGTAAAGGTGAAACAGAAATAGAAGTTAGGCACTAAAAATAAAT
TCTTAACGCCTTTTAAAAAATTATAAAACTCATGTTTTATGTCAAAATTCAAACCATGGT
GTAAAATAAAAGTCCTCCCTTTAGTCTGCTCAGTCCTCAGCTCCATTGAGGCCATTGCTA
TTAACAAATTCTTATGCCTGCATCTAGACATTTTCTTTGCATTTGCAATTTTAAGTATGT
CAATATGTGTTATCTTTTTTCTTTTTAAAGTGGGTTCATACACTGAACAGTATTCTGACC
TTTCATCACTTAACAGCCTGTCACTTAACTTTTATTTTACATCATGGTTTGAATTTTTAC
ATTAAACTGTAAAAATTTTTTTGCTTTTTTGAGACAGAATCTCAAGCTGTCTGCCTGGGT
AGAGTGCTGTGGCATCACAGCTCATAGCAACCTCAAACTCTTGGGTGTAAGCAGTTCTTT
TGCCTTAGTCCCCAAGAAGCTGGGACTATAGTTGCCCGATACAACACCGGGCTATTTTTA
GAGATGGGTTCTCTTGCTCAGGCTGGTCTTGAATGTCTGAGCTCAGGCCAGGCAAGGTAG
CTGTGCCTATAATCTGAGCGCTTGGGAGGCCGAGGTGGGCGGATTACCTGAGCTCATAGC
CTGAGCAAGAGCAAGACCACATCTCTAAAAATAGCTGACGTTATGGTGGGCGCCTATAGT
CCCAGCGACTTAGGAGGCTGAAGCAAGAGAATTGCTTGAGCCCAAGAGTTTGAGGTTGTT
GTGAGCTATGATGCTACAGTACTCTACGGAGGGTGACAAAATGAGACTCTGCCTCAAAAA
AGAGAAAGAAGTATTGTGTTACATATGGGTCTAGTGGAAATGAACACATTGATCTGGTAT
ATGTGGCTGCCATCCTAACCAATGAGCTATAGGCGCTGAGTCAAATAAGTTTTTTTTTTT
AAGACAGTTACATTATGTCATCCTCAGTAGAGCGCTGTGGCGTCACATCTTACAACAACC
TCAAATTCTTGGCCTTAAGTGATTCTTTTGCCTTAGCCTGCCAAGTAGCTGGGACTACAG
GCACCTACTACAATACCTGTCTATTTTTTGTTGCAATTGTCGTTGGTTATCTGGTCCCAG
CCTGGGTTGGAACCCACTAGCCTCAGTGCATGTGGCTGGTGCCGTAACCACTGTGCTGTG
GGCTCTGAGCTGATAAAGTAGCTTGTTACCTGTATAAATACATAAAGACACACACAATTT
TTTCCTTCAGCAGTACTTCTGGATCGAATGGTACTTACATTTTTAGTTGGAAGGGAATGT
TTTTTCCTAATTGGAGGTTATATAATACTTTATTCATTAAATACAAAAGCTCCTTTTCTA
ACTTAAGAACTAATTTAGGCGATTCTTTTTTGCACGATGTTGCTCTTTCAAACTGGAGTC
TTTTTTGGAATACTGAGGCTTGTTCTCTTTATATCCCAGAGATGGTAGCCAATATGTAAA
TTAAAAAGTAGTTTGTGTCCAGAGAATCTGAGTTGTATCAGACGCTTAGCACTAGTAGAG
AGATTTTTCTCCTTTGTCTTTGTGCAGGATAGCTGAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCAGAATCTGAGTTGTATTAGAAGCTTAGCACTAGTAGACATT
TTTTTCTCCTTTGTCTTTGTGCAGATAGCTGATCTGGCCAATGAAGATACTCCACAGCTG
TATGTGGCCTGTGGTAGGGGACCCAGGTCATCTCTGAGAGTCCTGAGACATGGACTTGAG
GTAAGATTGGAATTTCTAGATAATCTGCAGGAATTGGAGGGAAGAATTGACGAAGCTACA
GTTTATGGCTTTACTCTGATGTGGTCAAAGACAGAGTTAATGTTTCTATGAAAAAATATT
TTCCTTTTCCCTGTTTCCCTTAAATTTGTATTTTTCCTTTTTGGAGACAAGGTCTTGTTC
TTTCATCCGGGCTAGATTATAGTGGTGGGATTATAGCTCCTTGGCTAAACGGATCCTTAT
GCCTCAGCCTCTCAAATAAGTAGGACCATAGACACATGCCACCATGAATGGCTATTTATT
TTATTTTTTGGAGACAATGGGGTCTCACTGTATTGCCCAGGCTAGTCTCAATTTCTTTCT
TTCTTTCTTTCTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCCTCCTGGGTAGA
GTGCTCTGGTATCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGTGAATCTCCTAC
CTCAGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACGACACTTGGCTATTTTTTGG
TTGCAGCTGTCATTGTTGTTTGGTGGGCCCAGGCTGGATTCAAACCCGCCACCTTAGGTG
TATGTGGCTGGCGCCTTAGCCACTTGAGCCACAGGTGCCGAGCCTAGTTTCAATTTCTTA
ATCCTCCCAAAATGCTGGGATTGAAGGCATGAACTGTCATACCTGGGTAGTTTCAGTCTT
TACTCATAATTTTTAGATAAGTTAATAATGCTAGGTATATCTTTTTGTATGTTATTAAAT
TTATTTTTCATCACTACATGCTCTTCAGTAGCATCATTTTTAATGTTTATGTAGTATTTC
ACCAAAGTGAATTGGATTTATGAGGATTTATCTAGTGAATCTTTTATTATTGGACGTTTT
TTTTTTTTTTTTGGAGACCAAGTCTCAAGCTGTCACCTTGGGTAGAGTGCCATGGTGTCA
TAGCAACCTCCAACTCTTGGGCTTAAGCAATTCTCTTGCTTCAGCCTCCCAAGTAGCATT
GGACTACAGGCACCCTCCATAATGCCTGGCAATTTTTTGGTTGCTTTTGTCATTGTTGTT
TGGCAGCCCCAGGTTGGACTCAAACCCGTCAGCTCCGGTGTATGTGGCTGATGCCCTAGC
CACTTGAGCTACAGGAGCTGAGGCTATTATTGGACCTTTTGACATTCAATTTTTTTTTTT
TTTTTTTTTGTAGTTTTTGGCCAGGGCTGGGTTTGAACCTCCACCTCCAGCATATGGGGC
CGGTGCCCTACTCCTTTGAGCTACAGGTGCCCCTATTGACATTCAAAATTATTTTCTCAA
ATCCCATGTCCTTTTCTTTACAGGCCTACTGTTGATGCCTTCTATTAAGGGCCTGGCTTT
GATCTTGTTAATAGTAAAATAAAATTTCCTATAACTTTTGTTTTCAGAGGTTGGGATTAG
CAAACTACAGATCTCAAGAGGCTTGCTGCATATTTTTGTAAATTTGTATTAGAACACACC
CAAGATGACCTTGGTTTTGAATTCTGGCTCTACCACTTAGTAGCTGCTATCAAGCTTTTA
TTAAGACATTATTAATCACAAATATTAATGTTAATCCATGATTATTAATATTAAAACATT
AATAATGGACATCAAGTCCACTTTACATTTTCTTCTCTAAAATGGACTAATGTACTTGCC
TTAAAAGGATTATGTAAATCAAATGAAGCGATGGCATATGAAGCATTTAGCTTAATATAT
GGCATGAAATATTTAATAAATGTTAGCTACTAATACTGCTGTTTCAGGGAATTTGAACAT
ATTTTATCTCCCAAAATATCAGTTCACCAAATTTTCAATAAATTGGACCAAATTTACATT
TGTATTCTTAATTATTTAGTTTCTTACTATTCATTGGGATAGTAATGATCATCTGACGAA
AACGTAACACTTTCTGCAAAAATACGTGTAAACAAAATTTGTGTATAGCGTGAGATTAAG
AGTCATCATGTTTTAGTTTCCTGCCACCTTACCCCTTCAAATCTATAAACAAATCTTTGT
TGTATATAAAAATATTTTTAAATTATTGGACATGATCTTGCTCCTGTAAGTTTGTTTGTT
GTACCTTTTTTTCTGGCTAAGTAGTGGTCTCAGTTGAGCAGGGTTACTATTAGTGTTACA
TTTGGTATAGAGTAAGTTGACATATTTTATTAATGATAATGCTCTTAAATCTTTATGTTA
TTATATTGGTGAATTAAGAAAAGGGGTAATGCCTTCCTTGAATAAACTTAAATTATTCCT
ATAAAATGTGATTGCACACTATAATACATTAAGTAATTTATTGTTTCTAGATGATTTAAA
TGTGTGCATATATATATATGGTTGTTTTTCTTTTTTTTTGAGACAGTCTTACTTTGTCAC
CCTCCATACAGTGCTGTGGCATCATACCTCACAACAACCTCAACATCTTGGGTTCAAGCT
ATTCTCTTGCCTCAGCTTCCCAAGTAGCTGGGACTGCAGGCACCTGCCTCAACACCCAGC
TATTTTTATAGATGGGGGTCTCAGTCTAGCCCAGATTGGTCTCGAACTTGTAAGCTCGGG
CAGTCCACCTGCCATGGCCTCCCAAGTGCTGGGATTTGAGGTGTGAGCACGCCCAGCCCC
TAATTTAAATGTATTAATAAATTTTTTTTCAAAATTGAGACAAGAGTTTTACTTTGTTAC
CCTTGGTAGAGTGCCCTGGCGTCATAGCTCATAGTAACCTCAAACTTTTGGGCTCAAGCA
ATTCTCTTGCCTCAGCCTCCCTAGTAGCTGAGACTACAGGTACCTGCCACAATGCCCTGC
TATTTTTCTTTTCTTTTATTATTATTATTATTTTTTGTTTAGTAGACCCAGGCTGGGTTC
CAGCCCACCAGCCCTGGAGCATGTGGCCTGCATACAACGTAACCACTGAGTTACAGGTGC
CCAGCCAAAATATATTAATAAACTTTTTATTTTAGATTGGTTCAGTATTTATAAAACAAT
TCTAAGAATTTAATTCAAAGTTCACATAATGCATACCTAGTTTCTCCCTCTAGATTATTT
TATATTTATCTTAAGAAACTTCATGGCTTGGCGCCTGTGGCTCAAGTGGCTAAGGCGCCA
GCCACATACACCTAAGGTGGTGGGTTCGAATCCAGCCTGGGCCCACCAAACAACAACGAC
GGCTGCAACCAAAAAAATAGCCGGGCGTTGTGGTGGGTGCCTGTGGTCCCAGCTACTTGG
GAGGGTGAGGCAGGAGGCTCGCCTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATG
CCATGGCACTGTACCCAGAGGAGGGAACAGCTTGAGGCTCTGTCTCAAGAAAAAAAAAGA
AAGAAACTTCATTTGTCCTCAGGTTTGAGAACTTATAGAACATTTAAGATTACTGACTCT
GACCTTAAAGAACCTAAAAATCTAGTAGGAAAGACAGAACAATTAGTTCCCTAAGAGGTG
GTGATTGGCTTCTATGAGTGCTTACAGGAGGGAGAGCTGATACTCTGCCAAGGGGATAAA
GGAATGTTTTTCCTAAAAGATGTAGCATTATATTGGTCCAGATGGGATTTGGTTTTATGG
GATGCTAATTTAGATGGCTTGTTATGTTCCCCAGTGGTTACCACTCTTTTTCTGAGGAGG
ATGCTTGCATGCCATACCCAGGGAAAGGGTATGGTTTTGGGCTGCAACATCTGTACCTTC
CTAGACATTCCATGACTTTTGCTAAAGTCTGATCTGGAGGCTGCCAGTGCCTCTTAACTG
TTTTGATCCTTAAGTTTTTTTCCCCACTAGATGGTTTCATCCTTTAAATCCAGCATGTAG
TCTGAGCACTGCCTTTGAGACTGTGACTGTACTGCCCAGTGTAGTTATAAGCAAGTAGCC
AAATTGCATGCTCACTGTATTCTCCTGTCCTATCAGGTATCGGAAATGGCTGTTTCTGAG
CTACCTGGTAACCCCAATGCTGTCTGGACAGTGCGTCGACACATTGAAGGTAAGCAGCCC
TTTCCCAGTAGTCAAAATGAGGGTCTGGGTGCCATTGTCATAGAAGGCTTAAGAGGTTGT
ATTTGTAATATTTCTTGATCACTTCATCTAGGACCAGACCAGACACATTTTCTGGCTCAA
CAGCATGATTTTGAGGCTCTTCTAATTAGGATGCCTTCACTTACTACTTTTTTTGCAAGT
GGGTCAGGGGACATAGTGTGGCTATTCATATTTCAGTACATCAAAGTTTGAGTATCCTAG
TGCTGTCAAATGTGATGTTCTTTGACCTTATATTCATAAACTGGTTCCATCTATGTAAGA
GGTGTGGTGTGAGGAAATAGTGTCGCTTTTTCATTTTTCTTCAACTATGTACTCTCCTAT
TGTCCTGAAGTTCAAGGTGGTAGTGGTTTACAAATTGAGAGATTGACTAATTAACAAGCT
AATTGACTAATTAAAGCTTGTTAATTAGTCAGTTATACTGTATGAGCTTAAGGAAAGCAG
AGCTTTGATTGAGTGGAATCAGAATTTTAGCGCAAGTGGATAAGCAGGGCTAGGGGAAGG
AAAGGGGAGTTTGAGTTCCTGGATGAAAAATGGTCACCTCATTGTAAACTTTTGAAAGTA
ATGGGAGAGTGCAGAGTTGTGCAATAGCATGGAAGTCTTGTGGTAATTGAATTGCAATCC
CATAAAATAAAGTCAGTGTCATTACACCTATGATCACTGTGGTGCTGGAGGTCAGTGCTA
GATCTCATTTTCCTCTTGTTTCTTTGGGAATGTGAGACTGGTGAGTAAGATCCTGGCCAG
TAGGCATAGCTTTTTAAAAAAACAGCTGTAGTTCTGCCTGAAATTTAGATGTTCTGGTTG
TATGAAACATGTAGGAGAAAAACCTCTATCAGGTTTTAAAACCTCTATTAGAATATGCTC
TTTTGTGGATTTTGTTTTCATTGTAGGCATTAGAGTCAAATATGAATTGAGTAGAAAGGG
AAAAATGAGTTAGAAAATTGGTAGGCTTATTTGAGCTGAAAAGATAATTATTAGATGATT
TTTTTTTTAATGTAATATGTACATCAGGAAATTGGTCAGTGTTGATGTTCAACTTTGGCT
TGGTGGCACGTTGATACTACGGCTCTTGAAAATGTTGCCTAGATTTTTTGAATTAGAAAG
ATTCTTTGAGGTACACGAGTATGCTCTTTTTTTTGTTTGTTTTTGTTTTTGTTTTAATAC
GGAACCTGTAGAACATTTATGATTATTAACTCTGACTTTAAGAAGCCTAAAGAAAAACCA
CCTGTCATTTTTATGAAGGAGGTAAAAAGTTGGAGGAGTTGACTTTCAAGGTAGCCTAGG
GAATAGGAAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTCTCTTCCACAGGTGGCTGGTGAAGGTGCTGATCACCACAGGTGTGTACCTACT
GCTAGGGTCTTTTGTGGGGTCTTATAGTTTACCCATGGAGAGGGACCTGCACAAAATAGA
GGCTGCCTTGATGGTGTCTCTCAGAGGGTAACTTTGCAGTTGTACGTTGATGTGCATAAT
AGTGATGCACACCCATCTGCCTGTTTAACGGGTGGTCTGATGCAGGGATCGTCTTCTCTA
CTTTCTCCCATAGAATTTGTAAAATTTGACTAAATTTTCTTTCATTAAGCTGAAAGGGCC
GGTAGCTAGCAAACCTTAGCTTAATATTCTCCCTTGGAGTTGTATGTTCCAGGTGTACTG
ACTGAAAGATCAGGACCTAGGGGGAGCTTTTGAGTATATTCAGGACTTTGCTGAAACAAG
AGAAGCATCAGGTACTGACTATAAAGTGACAAATATTGGAGGCTTTAGTCATCTGGATGG
TGGCTCACTTTTACACTTTGGAGTGAGCCAATTATTGAGCCTTAGATCCTAAGGCAAGGG
AAGTAGTAGGTAGAGTAAAGTGTTCCCCTCTCTGGGGTGCTTTAGCAGTGCTCGACAGCA
GTTAGATCTTTCTGAGACCTGAAGATGCATTCTCATACCTTAATAGTTTCTTGACTGAGG
TATGATGTAACAATGTTCCTTCATATGAGATCTGCAACCCCTGGAAAAGGGCAATGTGGA
TATTTATAGGTCTTAACTTATTTACCATGATAACATACTTTGTTAAAAGTCCAACTTTAA
CCTGTAGTCACCCTATGACATAAGAGTAAACTGCTGCAGGTCTTTCTCTTGTAGAATGGA
AGGGGTAGAAGTTACAGTGTGCTTGGTATCCTCAGGGTGATGGATATTTTGAGAAAATTT
GATATAAAGCAACTTTCAGACATCAGTGGTTGCTTTCCTGCTTATTGAGTTGTCTAGCAA
TTCAATTTAAGTCCACTAAGCATTTCTTTTCCTTTATATGTGAACATTTTGGGCCTTGGT
CATATTCAAAATAAGGACCCAGGTACCCCTTCTTCCTTTGTTCTCCTGCATTTTCTTGGT
CTATTTTCTAGACTGCTCCCTTTTGCCTCTTGACTAAAGAAAGAAGTTCAAAATCCCAGT
GGGTTAGAGCCCTTTGTTAGTTGGCTTTTTAATTTGCTCTGACAGAGGTTTTAAGTTACT
AGGTTTTAGTAATAACATTTCCAACATTGGAAATGATAACAGTACTCATATAATGTTAAA
AATTAAGGAATTTCTGTTAATTTTTACACATCTGAAATTTCCAAGTTTGGTGTCATGTGG
AGATGGATTTTGGTTATATTTTAAGCTATTGAGACATAATTTCAGGGACAATCATGTTTT
TTACTCACTTTAAGATTGCAGTGCTTAGTCTTATAAAGTTGTTTTATAAGATGTCCTCAA
AGCATTTGCTATACATTGATAGTTATAATGGAATAATTAGAAACTAAGTTTCTTGTCCAC
TTTTACTCCTTATGATTTGGAAATTGTTCTTTGTTCCTTGCTTTTCAGCCACCCCAGTAT
ACACACACACACACATATATTATTAACTGAAATGAAAGTTTTGCAAAATAGTACTTACCC
TTACTATGTGTCTGGCAATCTCATAAATTATATTTATTTCTATTATGAAGTGCTGATTGC
AAACTACCAGTTGACTTTATGTATATGTCCTGCTGATGGTCAGAACACTATCATAGACCA
TGCCAGTGATATATCTTCACTTGACCCCTCTTCTGTAAAGAATACTGATTCTGGGCTGTG
CCTGTGGCTTAGTGAGTGGGGCACTGGCCCCATATGCCGAGGGTGGCGGGTTCGAGCCCG
CCCCGGCCAAACTGCAAAAAAAAAAAAAAAAAAGCTGGTCATTGTGGTGGGCGCCTGTGG
TTCTAGCTACTTGGGAGGCTGAGGCAAGAGAATCGCCTAAGCCCGAGAGCTGGAGGTTAC
TGTGAGCTGTGATGTCACAGCACTCTACCAAGGGCGACAAAGTGAGACTCTGTCTCTAAA
AAAAGAAAAAATACTGATTCTCCTGAACTAATCTAGTAACTTTCGTTTATCTGAACCTCT
TTTAGGGCAGTTAGAACCCAGTATATCCTTGTGTGAGTGGACTAGACCAGTCTCCTATGG
CATTGAATTCTGACAGGCTCAGACAGGCCTTAAAGCTGCTGGGAGTCAGTCCGCTGTTAC
AATTTAATACATTTTCTTGTTATTTCCCTTGGTTACCTGTCTTCTGGGTAAGGGGGACAG
AAAATGGGGAGTTGATATAAAAATAAAATTATAAAGTAGAGAAATCAACTCTTGAAAAAA
TAAGCATGCCTTTGTTTAGTATTTATCAAGCTTTATGCTAAACATTGTACTGAATGTGGG
GACACACACACACTTAAGCTCTTCCATGTTATAGGGTGGATATATGGAAATAGATGGCCT
TCAACTATGGGATGTGTAGGAGGAACTTTGGAAGTTTCCTGTATATTTCAGATCCTCTGA
CCTCCTTGAGAAGCTCATTAGCGTTTATTTATCCAACTACATTTCATTATGAAAAGCAAA
TCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGAATGCCACCCTGTATTATCCATCGGAGAGACTGTGCAAGAAG
TGACTGACTCTGGGTTCTGGGCACCACCCCGACCTTGTCCTGCTCCCTGTAGGAGACGAT
GCCTTGGTGCAGGTGAGGATTGTCAAAGGTCACTCCCCTACTCAGGTTGCTTTGTTCCTT
CTTGCCTCTCATTGTGGTATAAGCTACTGAGTTCATGTCTCTTTTTCCCCTCATCTTCCA
GCAAGCCTTAGAGGAGGGAACATTTATAATAATTTTGATATATAATATCACCTCTCTGTT
TGCTATTTTTCTCTTTGTTACAGAGCAGAGTCACATTACTGCTGCTTTCATCTTTGTTAA
AGCTTTTTTTCGTTTTTCTTTTTTTTTGAGACAGTTTCACTTCGTCGCCTTCTGTAGAGT
GCTGTGGCATCATAGTTCACAGCTTAAGCGATTCTCTTGCCTCAGCCTCCCAAGTAGCTG
GACTGCAGGTGCCCACCATAACACCGAGCTATTTTTGTGTTGTTGTTATTGTTGTTTAGC
AGGTCCAGGCTGGGTTCGAACCCACAGCCCCTGTGCATGTGGCAGGCACCCTAACCACTG
AGCTACGAGCCCTGAACCTCTGTTAAAACTTTTTATTAATGAGTTTAGAACTTGAAGTAG
ACATTGCAAAACAAACTTTTAAGAAGTTGACCTTGCGTATGGCCTATTAACTCACTTTTA
TCACTGATTCAACTGGTGCTTCAAGATGATGGTTCCAGATCTGACAAGGATGACAGATGC
AGTAAGTGTGAGGGTCATTTTGAGTGAGAAATCAAATCATTAAAGTCATATTTCCTTCCA
TAATTGACTCTAGGTGTATCCAGATGGCATTCGTCACATACGAGCAGATAAGAGAGTCAA
TGAGTGGAAGACACCCGGAAAGAAAACAATTGTGAAGTGTGCAGTGATTTCAACGGCAAG
TGGTGATTGCCCTGACAGGAGGAGAGCTGGTCTACTTGAGATGGATCCCGTATGTTACTT
TATTCACTATGAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTACCTGCCACAACAC
CCGGCTATTTTTTTGTTGCAGTTTGGCCAGGGCTGGGTTTGAACCGCCACCCTTGGTATA
TGGGGCTGGCACCCTACCCACTGAGCCACAGGTGCCACCCTAGTTTTTCTATTTTTGATA
GAGACAGGGTCTTGCTCTTGGTCGGGCTGGTCTCCTGAGCTCAAGCAATCTACCAGTCTT
GGCCTCCTGGAGTGTTGATTACAGGCATAAGCCAGCATACCAGGAAAACTATCTCAAAAT
TTAAAATTGTAAAGAAGAGTTTGCTGTACATGGTGAAAAAAGTAATTTATAGGGTGTATA
GTGAAAAATAAGTATGTTTTACTATGTTACTTCATATTAACTGTTTAATAACTATTTGAA
CAAATAAATGATTTAGTGAGAAAATGAATGAATAGCTCTCTGATTATTAGAGTCCTTTTT
AAACCACCAAGTCTTTTCTTTCTGTTTGCTCTGATTTGCTGTATAAAATAGCCAAGGGAG
AGGTCCTATCATAGCTGATAAGCTTCCATGATGAGTAGGCTTCAGTTGCTTCTCTCTTTT
TGATTAGAATGGTGTGCTGCTGAGGACAGTTCTGGACCCTGTCACTGGAGATCTGTCTGA
CACCCGCACTCGATACCTGGGGTCCCGTCCTGTGAAACTCTTCCGTGTCCGCATGCAAGG
CCAGGAGGCGGTAAGTAATGGAATGGGGGAGCTAGCACATTTGGATGTTAGTTGTACTGA
GTGAGAAATCTCTTTATTGTAAGCTTTACTTTAACTAATTCGCCAGCATTTAGTTCATGA
CTGGATATCTGTCATGTGGGAAATCTTGAATTCCTTAATCCAGAGTTTCCTGACTGGGGT
TCCATGGAACTGTGCCGTGATTTGCTTATAGGTAGGTTGGATCATCGGTCCCTTCATCCC
TCTTCTCTGCAGATAGGCCTGGAGGGTAGCTAGAAACTTCATATCTAGGGGACCACTATC
TATGAGTAATCTTGTTGGATTTATCCCAGTCTCACATNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 19146..19274, 19276..19289, 19291..19300, 19302..19310, 19313..19321, 19324..19338, 19340..19348, 19351..19368, 19370..19397, 19399..19405, 19407..19447, 19449..19459, 19461..19496, 21155..21327, 24226..24367, 25587..25699, 29317..29454, 30235..30338, 32618..32783, 35004..35099, 39036..39108, 44623..44666, 44669..44716, 44719..44748, 44751..44771, 45493..45586, 45588..45634, 45637..45648, 47228..47383, 47484..47627, 49747..49869
1001..1070, 19146..19274, 19276..19289, 19291..19300, 19302..19310, 19313..19321, 19324..19338, 19340..19348, 19351..19368, 19370..19397, 19399..19405, 19407..19447, 19449..19459, 19461..19496, 21155..21327, 24226..24367, 25587..25699, 29317..29454, 30235..30338, 32618..32783, 35004..35099, 39036..39108, 44623..44666, 44669..44716, 44719..44748, 44751..44771, 45493..45586, 45588..45634, 45637..45648, 47228..47383, 47484..47627, 49747..49869
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved