Otolemur_garnettii Locus SNX5
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNX5
Otolemur_garnettii
SNX5
GeneScaffold_5265
SNORD17
7257..7492
31156
ATGGCGACCGTAACAGTCATAAATAACAGTTACACTGATTCCTGAACACCAGGTTCTTT
GCTAGGTATTGGGTATAGATATTTCTCATTTAATCCTCACACCCTTTAACGTGGGCACTA
TTATGACCACTTTTTACAGACCTGGAAGTCAGGTTTCTGAAGGGTCACGTCGCTTGTTCC
AAGTCGGAGCTGGGAAGCGGCGGTCCGCAAGACCAACCTTCGTGATCCACAGAAAGCCGT
GCAGCCCGGGCAGGGACAGGACCGTTGTGACCCTTCGGGCAGGAGTCTGCATTAGGGAAA
AGGCAGTTTAAATAGAAGCCCAGCTACCTCTGAAGCCACCTCGCTTCTCTTAATTCCGAG
GGAGCAAACCACCTCTCGCGACCCGTACTTTCATCCGTCCCGCGCTTCGGACTTAAGTTA
GGCACACCCTAAAAGGGCGGTCCCAGCATGCACTGCGGCGCTCACGCCCCGCCCCGAGGC
CCTCGTGAGCCTCTATGCGGGCACGATAGGTCAGTAATCCCTCCCCTCAGGCGGGGGAAT
CCCTCCTCTTTGCTCTCACGAGATCTTGTTACGTCACCGCTCGTCGCCATCTTGGGTCCG
GGTTGAGTCATAAATTCCCCCCGCACCGACGCGCGGTCTTTCTCCAGACGCACTTGGTCG
GGAGAGTCTCAGTCCCTCCGCATCCCCGTCGCGGTCCTGCGATCGGCGGTCTCCGCGTGG
TGCGGAGTAAGGGTAGGCTCCGTCTTGCATCTTTGCCCGGCTCCAAGATGGACGGCAACG
GGGACGGGGAGGCCGCTCTGGGGGAACACGTGGCGCCCTGCTCGCCTGCTCTCGGGGCTG
CTGGGATGGTGGCGGAGTCCCGAGGCCTCCTGCCGCGTTGGGCAGGGAGGCCAGCGGAGG
CGGGGCTGCGGCCGCCCCTGAGAGGCGCCCCGGCGGCGGCGGCGGCCCAGCCTCTTCTTT
CCTCGCACAGCCAGGCGGCTCCTGCTCGAGTCCGCGTCGTCATGGCCGCGGTTCCCGAGT
TGCTGCAGCAGCAGGAGGAAGATCGCAACAAGGTGAGGTTCGTCCTCCCCGCTTTAGGGA
GGCCCAGCCGAGCTCCTGGACCCCCTCCCTCTTCTGCCTTCTTTCTCCTGCTCTCTTCCG
GGGCCCTGGCTTCTCGTGCAGTGCGGGAAGCACCCGCTGGACGAGACCCCGAGCATCCTC
ACTGCTTAGTCCCTCCGAAAGGCTGCCTCAAGCAGCCCCTGCAGACCTTTCTGTTTTACG
GAGAAGGGAATCAGAGACTTTGTACTTAGAAGCCCCCGCCTGCCCTGGTGCCCGGCACTG
AGCGGATGCTCGAGCAGTCTTAGGCTAATCTCTGGAGGAACCAGAATGTGTTCTCATATT
AAATGTTACTAAAGCTTTTCTTGGCATCGTGGTGATTGGTAGGTGAATGTGAAATCTGCT
TAGCCTGCAGTAAACGACAGAGTTTGGTTTCTCGCCTCCGAAATTGCCAGCTCCTGCCGC
CCCTTGAGAAAGCAGTCTTTTTGGCTCAAACAACTGGGGAAATTCCATCAAGTCAGCTGT
TTGAAGCATTTTTCTTAGAACTTCATGAACGCTAAACACGTCTTTGTGGGAGTCGTGTAA
TTTTTAGTAGGTGCTCAAATACTTGATTAACTTGGTTTTTGTTTTTAAATCTTGTCTAGA
TATGTAACTTATACCTAGGCCGCATATATCTCGAGGTCTAGAAGATTAATTAGTACAAGA
AATTGTGGTTACCATAGTCGATTAAAGATTCAAAGACCAGTCTCCACTCTTTCATTGGTC
TTTTAAATTTAAGTCCTGATTTGAAATGATACAGGTTGTGAGCCACACCGTTGTGCAGAA
TCGTCAACATGAAAGTAGTTGTCACAGAAAAACGAAAAAAAGTCTACGATACAGCTGGTT
AAATTAGTACTCAAAAATTAAATCTCTTTGATAGAAAGCAGCGTCATAACTTTTTATCTA
GTCAGTAAATACCAAAGTGACTGGATTGTTTCACAAGAATATCGTTGTGTGTGTTGGTTG
AAATAGACCTTTGTACGTAGGAGGATCTTGGTTGGGGTGTCTCTTTAAAAAAGTTGAAAG
GAACTGTTTTTTACTAAAACTGAAGTGGGAAGTTGAGACTACAATTCTTTAGGTAGTTTT
TTCCTTAAAGTGTAGATACTGCATAGGAATTTTGATAGCAATGTTTTTTCTAAAAAAATA
AAAATTTTTTTGGTAGAGAGTTTTCTTCTAGCTTTCTTGCTCCAGAATCAACCACATAAA
AAGGACTTGATTGCCTTAACCCAACTCCTTATTTATTAGTATATTGCAACTGGTTTTTTT
TAAATAACAGCCGAATTGTCCTGATCCTCTGCCTAAATTGGAGTCAGCTTATGAAGGCTA
TTTCCTGCCTCCTGGTTTTAGTGGCTACAGGAACTTTTAAAAATTACATGAATAAGGACA
TGTAAAACTAAATAAATTATTACCCTAATAGGTGGCTTCATTTTATTCTCTTTCCTCTGC
TTATACTGTGCTGTGGCAGATCAGGTCTCTGGTTTTATGGTTAACCAAAAGAGTTTGGAT
TAAGGATGAAATAAGGGATGGCCAAACCTTGGCCATAACAGTGTCATGAGTTAACTGAAG
ACAGTCTGCATTTTTTTTTTTTTTTTTTTTTCGAGACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCGGGCAGGGTGGCTCATGCCTGTAATCCTAGCACTCTGGGAG
GCTGAGGTGGGTGGGTTGCCTGAGCTCACAAGTTGGAGACTAGCCTGAGCCAGAGTGAGA
CATTGCAGCAGGTGCCTGTAGTCTCAGCTTCTCTGGAGGCTGAGACAGGAGAATCGCTTG
AACTCAAGAGTTTGAAGTTGCTGTGAGCTAAGATACCACAGCACTCTACCAAGAGTGACG
AAGTGAGACTCTGTCTTAAAAAAAAAAAAATGTAAAGTTTAAATGTTCTGATCATTTGTT
TTGGTTTAGGGATTCCCATGAGGATAGGATGGGGTTAAGACCAAAAAGGTAGGAAACATA
ATTGATCAAGATGTTGAGTGCGAGTCCTATACTCATTTTGGCTAATACAGCAAAACTGAA
ATGGGAGAGAGCTGTTGTCTGATAGGTAGTGGGACGCTTCGATTATAACATCCTTTCGCT
GAAGGTGTTGGAGTTCTCAGAAAGCAGGATTGCATGGCTCTTAACTTGTCCTCTATTAAT
GGGAAACGCTGTATTTTGGTCTTCAGATTTAGAAAACTTGGGTTGTATCAAGTGTAGCGC
CTGAAAACCGGAATTAACTAGAGCATTAGGTCCCACCTTCATGGCACCTAAGAAACTGCC
CCATCTCCCACATTGTCTGGATGATGAGAGTTCTCAGATGTCTGGGGGCTTTTAGTGGGT
AGGAGAAATTTTTGGAGATTATGCAGAAAGAGCCATGCTCTGAAAATAAGTTCACCCCCA
TCTTCAGCCATCTTTCACTTTTTAGGTTCTCCAGGCCTTCTCTGCCACAAGTCGTTAGGT
AAGTGGGTTCCAAGTTTAGGTGCCCATTCACAAATACACTGTGTATCCCGGGGGGTCTGT
AAGGTTGAGTCATGTTCCCTTTAGTCTAGCGAACCTGGTAAATTGAGAACAACAGCACTG
TTTGTAGGTGTCAGAGATCTAACTGCCTCCTGACACTTACTCTGAAAAGCTTTAAGTTTC
TCGGCTGTAAAAGTGAGTTAAGGAAAAAGAAAAGCCCTGCACCAAGGTTGAGTTTCTCAT
CACTGGTAAGGGCCAGGTGATAATCCTTCCCAGCCTCGTGCTATTTTTAACTAGGGGTTT
TCTTTCCTTGACAATAATGGTCTGGCCTGAGCTTTAACTAGTTGCATGGACTTTGGTGGA
TAGTTGTCTGTCTTATATACCACATCATTAATATGGAAGTCCTGCTGCTTTGGTTTGTAA
GTAAAAGGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAATTTTTGCAGTTCTACAAGTAGTATTCAGCCTCCC
AAAGTGCTCATCTGAATGATTTGGACATTTGCTATACTAAGACTCAAAACAAAATGTTCA
ACCATATTAAACAGGCAGCCATCCCTCCATCTCTTGATGCTAACATTTGTGTCTCAATAT
TGTAAATCATCTTTCTTGATGATGAAAGTAAATTCTCAAACCTGTTTCTCTTTCATCTTG
GGTTGAACATAAAGTAAGGCCAGGAAGGTTAAGCAGTACTTAAATTTTTTGGGGGGGGGG
TCTCTATTGCCCACACTAGAGTGCCATGGTGTCGGGGTAGCTCACAGCAACCTCAAACTC
CTGGGCGCAGGTGGTCCTTGTGCCTCAGCTTTCCAAGTAGCAAGTAGAGGGGACTACAGG
CATAGGTGCATGCCATGATACCTGGCTAATTTTTTTTATTTTTTAGTAGAGGCAGTCTCA
CTTTTACTCAGGCAGTTCTAAAACTCATGAGCTGAAGAATCCTTCCACCTCTGCCTTCCA
TCCCAGAGTATAGGGATTACAGGCATGAGCCGTTGCTCCCAGCCATGAATGTTTTTAAAT
ACCCTCATCTATGTGGGTGTCAGCTTTGTGGGCTTGTCTGCTTGATACATTGGTGAATTT
GAGGGAGGAGACCCCTCTTGGGTTGGGTAGTGAGTGAAGGGTGTTAGTACTGAATGAAGG
CGTGTTTCTGCTTTTCATTTATGGGGACTGCTTTCTCTAGCACTGGCACTGTGGCTAACT
AGTGGCTAGTTAGCCACTCCTCTGCTAGGAGAGGCTAACAGATCACATAGAGCTTAACCG
TTTTTTGCTTTGTGAGTTTGTTTGAAAATAACTTAGATACCTAGTAATAATATGGATTTT
CTTTTCTTCCCTTTCTTCCTTCCTTTCTTTCTTTATGATGAGTCTGACTTTGTCACCCTT
GGTAGAGTGTGGTGGCGTCATAGCTCACAGCAACCTCAAAGTCTTGGGCTGAAGCAATTA
CTCCTGACTAGGTGGGACTACAGTCACCCACCACAACATTTGGGTACTTTTAAAGACGAG
GTCTTGCTCTGGCTCAGGCTGGTCTTGGACTTGTGAACTCAGGCCATCCACCAGCCTAGG
CCTCCCAGAGTGCTAGAATTACGGGTGTGAGCCACCGCTCCCAGCTTCTCTTTCCTTTTT
TATTTGAGACAGGGTTTTGCTCTTTCTCAATAGGTAAAATGAAGTGGTACCATCATAGCT
CATTGCATCCTCAAACTTCTGATTGTAAGCGATCTTCCTGCCTTAGTTTCCTTGGCTGGA
CTGCTGGCTTCTGCCACCACACCTAAAAAAAAATTTTCTATTTTTTTGTAGAGATGGGGT
CTTGCTCTTGATCAAGTTGGATTTCTTGACATGAATTACTCATTTGAGGCAGTAATTCAA
CTCAATCTCTTTCTGGTTCTGTGTTGAGATTCCACCAGTGTATGGGCTGACAGCCTTGTG
AAATGATGATTCAGTTTATCCATTCGCTGAGTGTGCTGCACTGACCTCCTTCCAGGTCTC
AGTTCCTGTTCTAGGAACTGGGGCTATGTAGCCTCCAACTGCCCTGCAATCTGCGGTGTT
CTACTGCGGTCTGCTTGGGTGTTGGCAGACTATCGGTAAGGATGGTTGGTCTCAGCAGGG
ACGGGTCCCTCTGGGTCCCATCTCTCAAAGATGAGTGGTGAAAATCTGATCACTTGCTGG
AGTCCTTTGTCTGCCATTTTATTAATCTCATATCTGAGTAACTTTTATAGGTTTTTGTAG
CTATTATCTTTGTCTGACTGAGGCCTTTGAGAAGTTATTAGCTCTATCGTACTTGAGAAC
TGAGATACGGTTATTGCAAACTTGGATGAAAGGGACAATCATTGGAAGGAGGAATGCAAA
ATACCTGCAAAGGTGAAGTCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATCATGAATCTACAGTGTAGTGGTGACTCGGGCTTTATTGCGTGACAGATGAGTGT
GACATACATGTCATGGTGTGAATGTCTTGGTCCCGTCGAAATGCCCTGTTTTTGCTTCCA
GTAATCAAAATGAAAATCTGATTGAGGAGACAGGGTTTCTGGCTCCCTGCCATGAACAGA
CCATTCGTGGACAATTTGTCATATTGGTCTTCACTTGAGCAGTAAGATGAAAGATAAGAA
AGCAAGGCTCAGCGCCTATAGCTCAACCGGCTAAGTCGCCAGCCACGTACACCTAAGGTG
GCGGGTTCGAATCCCCAGCCCGGACCCGCTAAACAACAATGACGGCTGCAACCAAAAAAT
AGCCGGGCGTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGAC
TCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAAAGCCAGGGCACTCTATCTAC
CCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAGATAAGAAAGCAAAAG
TCCTTAGAGGGGAAGAGTAACAGTTTGGAAGAAGACATTGATGGAGCATGCACAGTGAGA
AACCAGCCCAGCCAATACATCAAGACTCCTTCTCTTAGGAAAATGTATATAAGTAGTATT
TTTAAATCTGCTTTAGTTTCTTTGTGATATTTAAATAAATATGGGAACATAGGAGCTAGC
ATTTTATATTACTTAAACTTATTACATCATTTACAAAACTTACTACATAGTTACTAAGTA
GAATTTAATTTTTCTGTGGCTTCTCATTTTGGGCTGCAGTTTGCGGTCAACATAAATATT
ACATACGCTTCTGTATGTATTTTCTCTTGTTCCCTTGTGGATTTTGAATTTTGGAATCAT
GCCTTTTGTGTTGTCTAGTCACCTAAGTGCCCTTTGCCATCTGTGAACCATTAAAACTTT
TGAAGAAGGCATTAAGTGTCCATTGAGTCATAAGTGAGATTTGCACAAAAGTGAGTTTGA
GCAGACTGGTCATCTGCAATTCAACGCTCTACACAGCCTGCCACTAGTGCCACCCTGCTG
TGAGGTGCCCCAGCTGGGAAGCTGATCAGCAGGTGAGGAAGTGCGCAGGGATCTCCTACA
CAGGTTTCCTCCTTCCAAGAAAGTGCCTTCATTCTTTTACCAAAAGCATTCAGCGTTCTT
TTACTAAAGCATTAGTAAAACAGTTTAAAATGTGCTTTCTACATGAAGCAATGCTTATTT
ACCCCTTATTTTTTCTTACTGTGAGAGTAATTGTAATCTTTATTGGAGGGATTGATCTGG
TAGGAAAGTATATTGGAAGCTGAAACTCCATTTAAAACTTACTGTGTGATTTCTAGGGAA
ATCTACAAAAGTCAATTTTAAAGCTTAAATCCATTCTATGGCCCAAACCCAGTTTAAACT
TAGTGACCCACAGGGCAAACTGCTTCAAGGGGTGAAATGGGAAGGGTGCTTCCCTTCCTT
ATGCCCTAGAACAGGGGTCCTCAAACTTTTTAAACAGGGGGCCAGTTCACTGTCCCTCAG
ACCATTGGAGGGCCAGACTGCAGGCCCCAGGACAAGTCAGCCGCTAAGCAGGACAGGCAG
CGGTGTTAAAAACACCCAGCGGGCCAGATAAATGTCCTAGGCGGGCCGCAGTGTGAGGAT
GCCTGCCCTAGAACCTGGTGGTTTTATTTAGCAAGTAGTGTTGTGTTATGACTGTGGAGT
GTTGGTTTTGTTGACAAAGCAAAAGAAGAAACGCTGAACTTTTAATCACACTTCATTCTT
CTGGAGGGAGGACACAAATGCTAACTTAGGAGCTCTAGGCATTTCACAGCTTCATACTCC
TAGATGAGTGGATGGCTGCTTCATCATCTGGAGGGGTTACGTACTAGGGTATGAGCAACA
TAGGTTGAAGACTATTGAAGGCTTAGGGATTTTGCCAGAATTCTCTCTTAGACAGTTCTT
TAATGCCAAAATACAAATGGTTGCATGTTACTTGCTTACAGGGTGGTTGATTTTTGTTTG
AATCTCTTCCTGAGGTGAAATGTCCAGGTAGAAATGGCTGCTGGAGAAGGTTGAATGCTT
GATACCCTACTATGTAGTCCTTTAAGACCTAGTTGTTTTCTTTATTCTTTTGTGACTGTA
TTAACTCTCACACAGAAGAAAGATTGCTCTGCTGACCAGAGGGAAGACAGACACAGCCTG
GGGTGTTGCCTCTAGGTGATTGGAAGTGAGAGAAAAAGACTGTGGAGTGAAAAGTTGCTA
CAGCAGCTAGTAATATCCATTGTAGTTTTAACTGCGGCACTTAAGTGAACCCTGTTTGTT
TGATTTCATCACAGTTGAGGGCTCCCCCCCATTCCAAAATGAGCTAAAACGGGATTGTCA
GCGTGCTGAGTTGAGAAGTGCTAGAAAACAGGGTTTGTGACTTCTTTCAGAAATAGAATC
TAAGAAATTGTGGTAGGTTTTTGTTTTTTGAGACTCAGTTGCCCTAGGAAGAGTGCTGTG
GTGTTATAGCTCAAAGCAACCTCAAACCTTTGGGCTCAGGCAATCCTCTTACAGCAGCTT
CCTGACTAGCTGGGACTATAGGCGCCTACCAGAATGCCCAGCTATTTTGGTTTTATTTTG
GGGGGATGGGTGCTGGGCTGGGTTTGAACCCACCACCTCTGGCATATGGGCCCAGGTGCC
CTACTCCTTTGAGCCACAGGCGGTACCCATGCCCGGCTATTTTTAGAGACTGAGTCATGC
TCTTGGTTCAGGCTGGTCTCAAACTCCTGAGCTCATGCAATCTGCCCTCCTCAGCCTCCC
AGAGTGCTAGGATTACAGGTGTGAGCCACTGCTAAGCTCTGGGAAACATACCTTAGACTT
ACCCTATGGGTTACCCTATTTTTTAACAGTGTCCCTTGTCATGTTGTAACACCTGGTCCT
CCTTATTCCTGTGTTTGGACTTACCTGACTCAGATAAACAAAAGATTGGTAGAATGGTCA
GTGTCTCTGAGCAGTCATATTTCAGTTGGTATCTTGAGATATTTTTTGTAGGCTGTATTT
GTCCAGTGGCAACTTGTCAGAAGGAAGGAAACTTTTATCAAGAAATGTGCTAGAGTTACA
GTTACAGTTAAAGCATCCCTGACCTTGAAGCTTATCTTTGTTTGCAGAGATCTCATAAAT
GAACATGAAAATTAACCTGGCCGACCGTTTACACTGAGCACTTGGGAGGCCTAGGCGGGT
GGATTGCCTAAGCTCATAAGTTTGAGACCAGCCTGAGCCAAAGCGAGACCCTGTCCCTAA
AAATAGCCAGGTATTATGGCAGGCGCCTATAGTCCCAGCTACTCAGGAGGCTAAGGCAAG
AGAAATAGATTGAGCCCAAGAGTTTGAGGTTGTTGTGAGCTGTGATACTAGAGCTCTCTA
CAGAGGGTGACAAAGTGAGACTCTGTCTCAAAAAAAAAGGAAAATAAACCTAAAAAGCAA
ATATTTCATAGGCGTCATCAAGTATTCATTTGAAAGAGAGATACTTGGCTTGGGATTGAG
ATGTCAGGACTGTTAAGTTTAATAAGATTCTACTAATAGCTGATGATAAAATCAAGTTCT
GGAGATAATTTGAATCTTATTTTCTTGGAGAAAAGTCATTGTTTAAGACTATTTTTGGTC
TCCATAAAAATGGTGACAGTGCTTAAGGAAAAGGGAGTACTTATAGCTAGTGAGTATCTA
TGCATTTTTATTTACTCTTTCTTAGCTGACAAGACTGTTTCAAGCTTTAGAGGTCAAATT
CAACAGGTTTTTTTCTTCATCAGTCTCCAGGCTCAAGTCATGCTCTTATCTCAACCTCCC
AAGTAGCTGGGACTACAGATACCCACTACAATGCAAGTCTCACTTTATTGCCCTTGGTAG
AGTGCCATGGTGTCACACAGCTCACACCAACCTCCAACTCCTGGGCTTAAACGATTCTCT
TGCCTCAGCCTCCCATGTAGCTGGGACTATAGGTGCCTGCCACAATGCCCACCTATTTTT
TTTTTTGGTTGCAGTTCAGCTAGGGCCAGGTTGGAACCCACTACCCTTGGTATATAGGGC
AGGCGCCTTACTCACTGAGCCACAGGCGCCGCCCTCGATTATTTTTTTTTTTTAGAGACT
GGGGTCTTGCTCTTCCTCAGGCCAGTCTCAGCTCCTGAGCTCAAGCAATCTGCCTTCCCC
AGCCTCACAGAGTGCTGGGATTATAGGCATGAGCCACTGTGCATGCCTGAATCAATACCT
CTTAGTCTTAAACTTTATTTTGATGAAAAGAATTCAAAGGGAAATTAAAAAAAATTTTTT
TGAGAGACAGTGTCTCAATTTGCGGCTCAGCATAGAGTGCAAATTTAGCTCACTGTAACT
TCATCTTACGGCCTCAAACATTTTTCCTACCTCAGCGTTCCAAAGTGCAGCAGTTACAGG
TATGAGCCGTTGTGCTCAGCCAAGAAAATGAGAGGGAAATACCTCATTTTCTTAACTTCA
GTCTTCACTTCAGTTTTTCCCAGTATTAAGTCATCTAGAGTTTTATGATTTAAGCACACG
CTACAATAAGAGGGATGGGGAAACACATGCTTCCTTCAGCTTTAAGATTGACCATCAACT
TGTCTGCTTTAAGAATTAAGGGATTTACTTTGTTTAAATACAGCAGGAAAACCATTTTAA
TCACTTTTCCCTGAGAGCCTCGTTCTCCTTAGTGCTTTCACTATGTTCTTTTCATAATCT
GCAAAAAGTTTCTTACTTTTTTTTTTTTTTCTTTTCCTTTTTTTGGACTGGCAAAAATGG
AGTTGGGCTGTGGCCTGGTGCCCATCCTTGGCCTGTGGGAGGAAGTGAAGCTTCATCTGT
GCTTTCATCCCCTCCCGGTTGCTCACATCACGGCCTAAGCTCTGCCTCCTGTCAGAGCCC
ACTCCTCCCACCCCCAGCCTATTGTCTTCCTTGAACCTGCTCTCTGGTCAGAAAGATTGA
GGACTACTGGAGTTGGATATTCTTTCCTTTTGAATTTCTACCTTACAAATTCAGCTAGTT
TTCCTTCTCTGGTAGAGCTCACACTTGTCACTGATGTGTAACTACTGTGGGATTAAGGCT
GTGGTTAGTTTTTATAATGTGCCCATCTCATCTAGATTTCTTAGCTTTTTGAAGGAGTCC
TTAGATGGAGGTGGGTCCATTCTAATTTGTCCACCCAGTGTTGTACATTGTGTGGTCTGG
TTGATGGCTTTTGACTGTTTGTTGCACTTCAGCATTTATGTTAGAAGCATAAGATTTTTT
TTATTCTATCGTTAAAGCCTTTTTAGTGTACTAATGTACTGCCTCAAGTACCTGGAGAAA
TCTCTTTCATGTGGACAAACTATGCAATGTACGTGACATTAGATTCCGACAGTCGCTTTA
TTCAGATACTTTGGATACACCTGTGCATTTGAAGAGTAGTTTCCCCCTGAGTTTCAAATA
AACTTTAGAGATGTCTCAAATGACTTTGTTTTAACTGATCAATAAACTCCTTTTAAGTAA
TTGTCTTCCATTTTTGGAAGGATGATTTTTAGGGCCAAGTGAATTTGAGATACTAATGCT
CAGAATATGTATTTCAGCTGAGATCTGTATCTGTGGACCTGAATGTTGATCCCTCGCTTC
AGATTGATATACCTGACGCACTCAGTGAGAGAGATAAGGTTAAGTTTACAGTACACACCA
AGGTAAGTGACAGAATGACTTCGTAATACAGGCAGTGCTAGGTTATCCTGTTATTTACAG
TGGGGGTGAGACGAGATTGCCTGAACTGGAATGTTGCTGTTTATTTGTAGTGTAGCACTG
TTGCTAACTGGGAAGCCTCCCTTATATTGCATCAGGTAAATGCTTTAGGATCCAACTGTG
GTAGAGCCCTATGTCTGTAGGCTGGCAGATCTTAGTGTAGCTTGGGCTCCATTTCATGGG
GAAGTGTACAGGCAAGGTGATGCAGCAGGTGGACCCATCTACCTGCACGGCTCAGATCTT
CTGCCTTTGTTTTTAATTTGCATTTGAGGGAGATCTGTGTGGTTTGCAATTTTTCCATAT
TTACTAAGCTGGGAAGATCCCAGTTTCTTCCTTATTGCCTCAGTGGCATGGTTAGCACAC
CTGCTTCAGATATCCAGCAGGCAGTGTGAAGACTGCCCACATGCTTCTCTGCCTGAGCTG
ACCTCATCAGAGTGGGTGAGATAAGCATTCACTGAAACAAAAGGGGAGGCAAGGACAATT
TCCAGAGCTGGAGTAAACTGTAGCTAAGATTTTTTTTTGAATGGTAACACATATATTTTT
GGTCATTATTGGGATGAGTTCAGACTTACAAAAATAGAATTAGGGCTGTTTTAACTTTCT
GAAACTTTTTCTAGTAGATTCTTGCCTCTTTGGATGTTCGTTGCAAGCTTCAGAAAGGTG
AAGTTTTATGAAAAGAGTTCCGTAGGGATTCAGTTGAATTTTATCTGTGAATGTGGGCGG
GGGGTGGGGTGGGTAGGATCATGGATTATTGCTTTGTTCTTTACTGGGTGTTACTTTGAT
GTTGTATAATGTAGAATATTCCCATTTGGCCCAGGAAACCCAAGCTATTTTATCTGACTG
TAGGGTTACAAGTGAGCTTCTCCTTTCTTTCTTTACAGACCACACTACCTACATTTCAGA
GGCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGGCTACATGACACTCTCA
TCGAAACAACAGACTATGCTGGACTTATTGTGAGCACACTTTAGACAGTCAGATAATTAA
GCTAGTTTCTTTTACCTTGCTATTCATTTGCAAAAACTGCTTATATAAGAGAATGTGAAA
GTCTAATTTACCCTGCCTGAGTAGTAGGTAATGATTACTGGTAAAGGCTCAAAAAATGCG
AGGGAAAATTAAAGCTTTAAGTTGGGGTGTTATTTTTTTTTTTTGAGAAAGGCCTCAAGC
AACCCCCCGGGGAGAGGGCGGGGATTTCGCTCAAAGAAACTCTACTCCTGGGCTCAAGCG
AGTCTCCTGCCTCCGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGC
TATTTTTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCAAACCCG
CCACCTTAGGTGTACGTGGCTGGCGCCTTAGCCGGTTGAGCTATAGGCGCCAAGCCAGCT
TTAAGTTTTATCTACCTTTAGGATTGGCTTTTTTTTTTTCATTGTGAAGAGTTGATTTCC
TGTGAAGTGAGGAAGTCAGTATTAGTGGTAGTGTGCAATGAGTTTTCTTAAAAGTGCTCA
AGGAGTAAATTAGGCAGTTCACAGTTGAGTCTTGGCTTCAGAAACTGAGACTTGGCTGAT
TTTTAAAGGTGATTTAAGTCATCTTGTCCTACTAGACATCCTAAAGAATCTGCCCAAATG
GTGATTTTTTTTTTTCTTTTTGATTGAGACAGAATCTCACTATGTTGCCCTTGGGGAGAG
TACTGTGGCGTCATGGCTCACAGCAACCTCAAACTCTTGGGCTTAAGTGATTCTCCTGTC
TCAGCCTCCCTAGTAGCTGGGACTACAGGCGCCCACCATATCACCTGGCTATTTTTTGGT
TGCAGTTGTTACTATTTAGCCAGTCCTGCCTGGGCTTGAACCAGCCTCAGTGTATGTGGC
CGGTGCCCTGCTCGCTGAGCTATGGCACCAAGCCATGATTAAGTACTGAAGGTTGTATTA
AATGAATCTTGATTGTCCTTCCTTTTCAAATCTGGAGACTTCATAATTTTTATGGTTAAT
CATTGGTCTTCAGCATTGTACTAGTTTTAGGCTCCCATTACACTTCACCAATTGTTTGTA
ATGGGTAAAGGAATAAGGTTAAAAACTCAGGAGATTTTCTTTTTTTTCTTTTTTTTTTCT
TTTTTTTTTTTTTGAGATAGAGCCTCAAGCTATCCCCCTGGGTAGAGTGCCATGGCATCA
CGCTCACAGCAACCCTCCAACTCCTGGGGCTCAAGTGAGTCTCCTGCCTCAGCCTCCAAA
GTAGCTAGGAACTACAGGCGCCCGCCACACGCCTGGCCATTTTTGGATTGCAGCATCATT
GTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCAGCACTGTCTTTTGAGAAGTA
AAATGGTGCTATGTGCCAGCACATTAGTAGAAGAATCTGACTAATTAAAAGTATAGCTGT
TAATTAGCTGCCTAGTGTTTGTCCTAAAACTTAATTTCACAGAGTGTGGGAGAGTCATGC
TCTTTGTCTTTATAAACTATTTTTTAAGCTGCTCCATGGTACTACAAAGCTTTCTTCAAA
ATTTGGTTACTAGAAGTACAGGAGAAGTTAGATTGTAGCAGGTGTTTTAATAACCACATT
GGCTCAAAAGAAGTCCAACCAGCCTGAGCAAGAGCAAGACCTGTGTCTACAGAAAATAGA
AAAATTAGCCAGATATGGTGATGTGTGCCTGTAATCCCAGCTACTTGAGAGGCCAGAGGA
TTGCTTAAGCCTCAAGAGTTCAAGGCTGCAGTGAGTCGTGACGATACCAGTGTACTCTAG
CCCCAGCAACAGAGGGGGAAGCCCTGTCTCTCTCTCTCTATATATATATACACACACACA
CAAAAAAAAATCTGGTTACAGTTTAAGTATTTTAAACCAAAATAGATTCTTTTTTTTCTC
TTTTTTTTCTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCCGTGGCATCAC
AGCTCACAACAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCACCTCCCAAGT
AGCTGGGACCACAGGCGCCCACCACAACGCCCTGCTATTTTTTTTTTTTTTTTTTTTTGG
TTGCAGCCATCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCGCCACCTTAGG
TGTACATGGCTGGCACCTTAGCCGGTTGAGCTATCGGCGCCGAGCCCAAAATAGATTCTT
GAAAAAGTTTCTTGTTAAACCGTCTTTGAAGGGTGGGCGCAGTGGCTCATGCCTATAATC
CTAGCACCCTGGGGAAGCCAAGGTGGGTGGTTCACTTCAGCTCATGAGTTGGAGACCACT
GAGGAAGAGTGAGACCCCCATCTCTACTAAAAATGAAAAACTGAGGCAAGAAGATCACTT
GAGCCCAAGAGTTTGAGGTTGCTGTGAGCTATGAAGCCATAGCACTCTATCGAGGGTGAC
AAAGTGACACTGTGTCCAAAAAAAAAAAAAAAAGCTTTGGACTTTAGTACTTTATTATTA
TCTTAACTCAAAAGCACTCACCCCTGCCCTCTTCCACTCTCAGCGGCCCTACCCCGCCCC
AAGTTTGTGTTATGTTATCTAAGTCATTGTTCACATCTCCAGCTCTGGGGGTGTAGCACT
AAACACAGCACACTTAAGTTTCTACACTTGGGAAGCTTCAAGTATTCTTTAATGTCTAGA
ATGAGAAAGCTGCTTTGTAATTCTGAGCCTTACCAAACTCATCTTGTGTACCTGGCAGCA
AAATTAAAGGGTTTTCCCGGTTTTATAGAAAAGAAAATGTTTTGTGGCTGCTATAAGCAG
TTATTGTATGTGGTTTTAGGGGCTCTCAAACTTGATCCATCAAATCTAGTTATAACATCA
CTTTTCCTCCATTGATTTATTCCACAGATTCCCAAATGACAACTCATTACTTCATTACGC
AACTGGACACCAGGTTATATACCAAATAAAATAGTGTTTTGGTCCAGTTGTGTATTTCAT
GTAGTGGCATGAGCAGAACCGTGGGGTTAGCGAGAGTGGTGCTGGGCCTGCCAACTGAAC
CCCCTGTGTGTCTCTTTCAGTGAGTATCTTGCTGTCTTTAAGAAGACTGTGTCTTCCCAT
GAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGACCGAAACTTTCAC
GTTTTCCTAGAATATGATCAGGATGTAAGACATTTTAATTCCGTTTTCATGATCAAGTTA
AAATGTTTAAGACTCTAATAATGTATTTTATTTTCTGAAAAAACTTATGGATTTCCTGTA
CAATGGAACCTCTTTAGATGCTGCTTGGGATCCCTCCCACCAGAAGATGCATTGTGTGTC
TTTTTGTTAAACTCTGCAAAGAAAATTTGGCCTTTCTTCAACTTCCAAAGATTAGTTTTC
TCCCGCAGTTCTGTTTGGGATTGTTAGAATGAACTTAAATTAAATCAATGTTTTTTAAGA
GAGAGATGGGGTGTTGCTATCTTGGGCTGGAGTGCAGGGGTATAATCGGCTCGCTGCAGC
CTTGAAATCCTGAACTCAAGAAATACTCCTAAGTAGCTGGGACTACTGAGGTGTGCCATT
CACCTAGCTAATTTTTAAAGATGTATAGAGACAGTCTTGCTGTGTTGAACTCCTGGCTTT
AAGTGATCTTCCTGCCTCAGTCTTCTAGTTGATAAGATCAGTGAGCTACCACACCCAGCT
GTTTTCTTCTTGGCTGCTCATTTTACAGAAAGGAGACTTGTAGTTTTTTTATGTATCATT
TTTCTTACTATTTAATATGTGTGAGAAAAGCTCCAACTTAGAAATTTCTTCAGTTTTTTT
CTAGCTGGTGAGGCGTAACAAATAGCATGGATAGAACAGTAATTTGACTAAGGATTTAAA
ATTACACCAGGACATCATGCCTAGATCGTTTTTTCTTTCAAAACATCTAAGTTAGGCTTT
TAGGCTGACCTGTTTCAGTAGGTTTAGCAAGTTGTTATCTTTAAGAGAACCAAGACAAAG
ATTATAATATGTTCTTTTGGACTTTTTCCCCTTTTTTGGACTTTTCTTTCTTTAGCTAAG
TGTTAGACGGAAAAATCCCAAAGAGGTGTTTGGCGGCTTTTTCAAAAGTGTTGTGAAGAG
TGCTGATGAAGTCCTGTTTTCTGGAGTTAAGGTAAGTAGCTTTTAATTCTTGACTTAGGG
GAATAAGTGACCTTTTATTTCATTGGAAGAGATCTGTAAGTTTTTTTTCAAGTTTTGGTT
GGAGGAGGAGGATTGGTGTGCTCCCACCTGATGGGCACAATCTACAGTATATGGAACGCC
TCCTGAGTACAGGTCACAACTGTAACAGACTTGACCTAACAAATGCAGATACTATAGCCT
AATCATTGGAACCCGCATGTTAATTTGAAATTTTGTTTTTTTAGTTTTGATTCTTTTCAT
TTACTTAGTTTTCACAAAGCACCTTTTTCTCATTCCAGAGAGATGGCATGAACCTTTCCA
CAATTGAATCTTCATTTTCTGTAAGGAAAAGTTTTAATTTTAAAAACACAGTGAGCTATA
AGTTTGTTTTCATGCCATTCTCCAGAACTGTGTCCTGCCTGCCGTGGTGGCCCAGGCACA
GATGGCAAGTGACCACTTGGCAAGTAGTTGAGCTGGCACAGTTAAGGAGGTGAAGTTGTA
TTTTATTTACATACTAGATATTAAGGACCTAATTACAAGGAAAATAATACTAATGTAGAC
ATTCTTATGTATTGTGGTTATATTTTATATACACTATGTTAAATATTAAAATGAATTTCA
CTTGTTTATTTTCACCTCATTGTAAAGCTACTAGCAAGTTTTCAGTGGTACCTGTGGTTC
ATTCATTCTTTTGATTATTGCTGTTGTAGAGTATAAAAACTAATACACAAGTCTCATTGC
CCTCATAGGTATGATTTATTTCTTCACTCCTCAAGCTCTTTTCCGTTTTAACTGAGTTAG
CTTTATAGTTAGTACATGTACCTGGTATCTTGCTTTCCCAGTCCAGGGCTCGAGTAGAAT
TCGAGTGCTACGTAGAGGGCACTATCAGAAATTTGGAAACTCTTGGGCTATCCTTGGCTC
AGTATAAAAAGTCTGGGACTGTCCTTTATCTTTGCATTATGGGATGTTTGGCCCCCCTGG
CCAGTGCCTACCAGATGCCAATATTGCCTCCCTGTTTGAAACGAAACAAATTGGGAGAAA
AAACACCCACGTACAATGTAGTGTCCCACTTAGAACCATTGCATTAGTGGTAGAATTGCT
GAGTCTTAGGATAGCAGGGTTTTATTGGCCATTGTCAAATTGTTCCTTAAAATGGTTCTC
TATTGATGTTTCCTGCCAGACCTGGTTTTTGTTTTTTGTTTGTTTGTTTGTTTGTATTTT
AATTGAGACTCTCATTTTTGAGTCTCAGAGTCTCATTTTTGTCACCCTCGGTAGAGTGCC
ATGCCGTCATGGCTCACAGCAACAACCTCAAACTCCTAGGCTCAAGCAGTTCTCTTGCCT
CAGCCTCTCTAGTAGCTGGGACTAAAGGTGCCTGCCACAAAGCCTGGCCATGGTTATGAA
ATAGTAACTTAGAAATTTGCATAACTTTTTATTGGTGACCTTATCTGCCGTGATGTTTTG
TCAGTTTTTTGAGACAGTCTCCTTTTGTTGCCCTCAGAAAAGTGCAGTGGCATCACAGGT
CACAGCAGCCACAAACTCTTGGGCTGAAGTGATTGTCTTGCCTCAGCATTCTGAGTAGCT
AGGACTACAGGCTCCTGGCTAGTTTTAAAGACAAGGTCTCACTCTACCTCAGGTTGGTCT
TGACCTCCTGAGCTCAAGCAGTCCACCTACCTCACCTTCCCAGAGTGCTAGGATTACAGA
CACGAGCCACCATACCCGGCCTCATGGTTTTTCTTAATACAAAATACATATTCACATTCT
TAAAATGTCTAGTTCATGAATTTCTTTTTTCCCTTTTAGGAGGTGGATGACTTCTTTGAG
CAAGAGAAAAACTTTCTTATTAATTATTATAATAGGATTAAAGATTCCTGTGTAAAAGCT
GACAAAATGACCAGATCACACAAAAGTAAGTACCCTTCATTCACTAGCCACTTAAAGCCT
TGCTGATGAGCCTGGCTTTGTTCTCTGAAAGGGCTGCCCTGTGTCTGCAGATGTTGCTGA
TGACTACATCCACACTGCAGCCTGCTTGCACAGCCTGGCTTTAGAAGAGCCCTTGGTCAT
CAAAAAGTAAGTTTGTGTTGGAAAAGCCATTTGCCATTACCTAACTACAAACTGCTGAGC
GGTATATTTAAAAAGAAAAATGAGTAATGGCACATAGTTTGAGTTCTCCTTTGGAGTTAC
AAGCTTATTAAGGAAAGTCTAAGACAATCATAGAGGACTTAAAAGAACTCTTGTGTAGAT
GGACGAATTTGGTAGCTGTTATCAAAGCCTTTATTTCTGTCATATGTAAATGTTTTAAAT
TTTGGGCTTGTCCCTGAAAGACATCCACTTTCTATCTTCTGTCACTGTATGTTTGGCATT
TTGGCTGATAATGCCCTGAACTTTATTGGTTCGATTGTGGTGGTCCTGAGAATACTACTG
TGGTGACCACGTCTGATCTCATGGTTATTTTTATATATGTTTTTTTACATTCTCCCTGCA
GAGCATTTCCAGTTAAGTATTCTGCTTAATAACGAGGCTTGAAGTAACAGATGGGATTTA
CTTCTGCTTTGAAATTCAAAGCCAGGCTTATGGCAGAACTGAGACAAATAAAGTAATAGC
ATGTTTTGTTGCTATGATGGCCACAGGCGTAGCTCATTAGGATCTGACCTTAGTTAACAC
AGCTTTGAGATCTGATAAGAATTATCCTGGTCAGGTTCGGTGCCCATTGCTCAGTGCTTA
GGGCACCAGCCACATATACCAGGGTTGGTGGGGCCGAACCCAGCCCAGACCCTCTAAACA
ACAATGACAACTATAACAAAAAATAGCTGGGCATTGTGGCGAGCGCATGTAGTTCCAGCT
ACTTGAAAGGTTGAGGCAGGAGAATTGCTTAAGCCCAGGAGTTTGACGTTACGTCAGTTG
TGATGCCATAGCACTCAACCAAGGATGACAATACTCTGTGTCTTAAAAAAGAAAAAAAAA
ATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAATGAAAGCTCTA
CTTTATATTAAAATGCAAAAGCTAGGGCTCCTGAATTAGTTTAATTCCCATCTTAAGAGT
ATTGATGAGTTATACTTCCATAGCTTGAGACCCTTAACCCATATTATGTGTATATTTTCA
GGTACCCTATTGAAGTTGCTGAGCTATTTGAAAAACTTAGGGTAAAGGATTTTTGTGTTA
GCATTTATGATACATACTTCATACTCTGTAGATTTCTGCCTTGATGGTGACCTTTACTTT
TTTAAATAGAAAGTAGAGGGTCGAGTCTCATCAGATGAAGATTTAAAGCTGACAGAGCTT
CTCCGATACTACATGCTCAACATAGAGGCTGCTAAGGTAAGACAAGGTGTTTCATTCAGT
GCGTTGAAGACCTCCTCGCCATGACCCAAGAGTTTATGTCAAAAGACTGTTCTCTTTGTT
TAAAGGGGAAGTTACTCTATTCTCAGGAGGAAAATAGGAATTTATCAGGTGTCTTTGTGT
GGATGGTAGGCCTTAAAGGTTATACATGCATATTGCTGGTAGTGCTATAGGGGTTGGGGA
TTATAGGCTACTGGGTATTTGTGAGTTTTTATTGACTGGCAGCTATTTCTGTAGCCTTTG
AGCCATAGTTAAGAAAAACTAAGACTAAGTGAAAAACAGGGTACTGTTGGAGAATTAAAA
GTGCTTTTTTTGTTTTTTTGGAACAGAGTCTCACTGTGTCACCCTGGGTAAAGTGCTTTG
GCTTCATAGCTCACAGCAACCTCAAACTCTTGAGTTCAAGGGGTCTCTTGCCTCAGCCTC
CCAAATAGCTGAGACTACAGGCACCCGCCACAACACCTGGCCAGTCTTTTCAATTTTTAG
TAGAGACAGGGGTCTTCCTCTTATTTCTCGCTGACCTCAGCCTCCCAGAGTGTTAGGATT
ACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCATTGCAGAGCT
GGAGGGTTTAAATCCAGCCCAGGTCTCCAAAACAATGATGACTGCAACCCAAAAAATAGC
CAGAATTTTTAATTATCCTCCCAGTGGAGGCAGGAGAATCGCTTGAGTCCAGGAGTTGGA
GGTTGCTGTGAGCTGTGATGCCACGGCATTCTACCCATGGCGACAGCTTGAGGCTCTGTC
TCAAAAAAAAAAAGGAAAGTAAAAGTACATTTTTCCTCAGTATAATTTTATTTTTAGTTA
TGTTGCCTTTTGGTATGTTTTCTCAGTACTGTATTTGGATTTTTTATGCATTTTAGGCTT
TTGTAGTTTGTTTCCTCCCATAAAATTAAGAGTTCACTTTTAAATTTTTTTAATATATAC
AAAAGATAGAATGTAGCATGTCTGTAAAAGGACCATACATAGAGAAAATGGGAAATTCTA
GCTAAATGTACCTTAATATACAGAATGTTCTCTACGTGTTCGCCACCTCTTTGTAAAATT
TTGTGCTGAATATTTTGTAAATAAAGGTAACATTTAGCTGTGATTTCCCATTTTCCCTGT
ACTGGGTGACTTTTGAGACATCCTATAGTTTTACCTGACTTTAATTATTTTTAAAAACTG
CATAATCTGGGCATCATAATGCCATTTTTAGGTACTGTAGTATGTTCTCCTTAGCTATGT
TTTGTGAAGAATCTTTAGTTCAGGTAAGATAGATCCCCAGGGTAGATTACCAGAAGCTGG
ATTTGCAGGGTTAGGGTTACATGTTTCTTACTGTCTCATTGTCCAGTTATGTTTTAGCAG
CATCCCACTTGACTGCACCAGCAGTAACTCTTGTGTTTTGATATACAGTGCTTAGTTTCT
TTAAATTAACCTGCTGAATCAACTGAGAAAAAATTTTTCTGTTTTCACTCTCTTGGTTTT
CTCCCCATCTAAATGAAAAATTGCAAAAGCTGTCAACGATAGCTATCGGAGTTCCCCATT
CCTGCTGAAACTGGAGGTTAAATAATGATGATGGGGAAGGGAGACACAGGGGTCACTTAG
GTTCTAGGCTGTCCGCAACAGTCCAGGCAGTATATTGATGTGTATATTCACAGTGAATGG
ATTATTTTTTTATACCGGTTTGGATATTTGATACTCCTTTCGATTTTTTTTAATGTTGTG
CCTGTTAATTTCCTTTTTAGGATCTCTTATATAGACGCACCAAAGCCCTCATTGACTATG
AGAACTCAAACAAAGCTCTGGATAAGGCACGGTTAAAAAGCAGAGATGTCAAGGTGGCTG
AGGCACACCAGCAAGAGTGCTACCAGAAATTTGAACAACTTTCTGAATCTGCAAAAGAAG
GTCAAGCACGGGAACATTCTTTTCTTTGGGAATAATTTCAAGCTTACAGAGGAAAAGTTG
CTCAAGTAATGCAAAAGACACCCCTGTTCTGCACCCAGAATCACCCAGCACCAGCACCTC
ACTCCATTGCTGTGTCACCATCACAGCTCCTTAGTGCTCATGAGCACGCCAGGTTTTTTT
TTTTTTGAGACAGAGCCTCAAGCTATCCCCCTGGGTAGAGTGCCATGGCCTCACAGCTCA
CAGCAACCTCCAACTCCTGGGCTCAAGTGAGTCTCCTGCCTCCGCCTCCCAAGTAGCTGG
GACCACAGGCGCCCGCCACAACGCCCGGCTGTTTTTTTTTTGGTTGCAGCCATCATTGTT
GTTTTGGCGGGTCCGGGCTGGGGATTCGAACCCGCCACCTTAGGTGTACGTGGCTGGCGC
CTTAGCCGGTTGAGCTATAGGCGCCGAGCCCAGGTTGTTTTTTTTTTTTTTTTTTTTTTA
ATTGAACTGTTTCAGGTTAAGTTGCGTAATCATGGTTCTTTTATCCCTAAATACACTGTT
ATGCATTTCCTAAGACTCAGACTTGGATACAGTGGTACAGTCCCCACTGCGGGGTACTGA
ACTCAGTCTTGCATGATTTGCCCAGTAATGTTCTCCACTACGCAGTCCGGTCTAGGATTG
CATCTGGGTATTTTAGTCTTTTACTCTGGGATAGTTCTTACTCACTTTTATATCTGTGAT
ATTAGTCTTAATACAGAATGTATACTTTTTGGTAATTTTTATAAATAGTATGTTCAGATG
TTGAAATTGCCCAGACTTTGCCAATGGGAGTGCCTTTAAGCTGGCATGAGTTTGTAAACC
CCTCCCCAACCCACCCACTTTCTTTGAGCAGTTAGATGTTTTATGCTTATCTTTTTTTCT
TTTCTTTTCTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCTTAGGTAGA
GTGCTGTGGCATCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGTGAGTCTCCTGC
CTCTGCCTCCCAAGTAGCTGGAACTACAGGCGCCCGCCACAACGCCCGGCTATTTTTTGG
TTACAGCCATCATTGTTACTTGGCAGGTCTGGGCTGGATTTGAACCCGCCAGCTCAGATG
TATGTGGCTGGTGCCTTAGCTGCTTGAGCCATAGGCGCCGAGCCATTTTTTATGCTTATC
TTAAACTTAGTATTCTAGCTATAGATTTGCCTATTCTTTAAGAAGCCAGAGAGCGCTCTT
TTTCTTAGGTAATGGTAACCAAAACCTTGGTATGCTAAGATCTTGTTCATTATTCCTGGG
GTTTTTCACTCTCTAGGCCCTTGAGTAGACAGAGCCAGGAAGGAGCGTGTGCATGCACCC
AGTTTCATACATCACCATGTTTCAGTCATGAGTCCACACTGACTGCCAGTCTAAGTCTAT
AGGATTCTTTCTTGCCTTCCCCTCTTCCAGGATAGGGGACTTTTTAAGTTCACATAAACT
TTATTGGTAGAATAGCATTTCAATTGTACATGAGTGTAATATATAGTCTTTTAAGAGACA
GGCTCTTACTTGTCACCCAGGCGACAGCCGTTCACTACTGTAATCTTGGATTAGCCTCTG
AATACCTAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCTGTAGTCCCCAGCTGGCTCAGGAGGCTAAGGCAGGATCAGA
TAGAGGGGGCAGGAGTTGAGGTTACTGTGAGCTAGGCTGGTTTTCACAGCACTCTAGCCC
AGGCAACAGAGTGAGATTGTCTTAAAAATAATAAAATGGGCTCGGCGCCTGTGGCTCAAG
CGGCTAAGGCTCCAGCCACATACACCTAAGGTGGCGGGTTCGAATCCAGCCCGGGCCCAC
CAAATGATGATGGCTGCAACCAAAAAAAGAAAACAGCCAGGCACTGTGGCGGGTGCCTGT
GGTCCCAGCTACTTGGGAGGCGGAGGTAGGAGACTCACTTGAGCTCAGGAGTTGGAGATT
GCTGTGAGCTGTGATGCCACAGCACTCTACCCAGGGCAACAGCTTGAGGCTCTGTCTCAA
AATAATAATAATAATAATAATAAAATGATTTTGGAGACCTCTATCTCACTGTATTGCCCT
AGCTGGTCTCAATCTCCTAGCCTCAAGCAGTTCTGCGTCAGGTTTACGAAGTGCTAACAA
ATATGAGCCATAAAATGTAGTCTTAACTCTGGAGGATCTTGTGGATCTTCCCTGGCCATG
GAACATTGCAGAGCAAATTTATCTTTCAGAAAGTGAATGTAATAGTTATAGCACACTACA
CTTGTCTCAGGTGTTGCCTCCTAACAAATAAACAAGTTTCCATGAAAACAGAAATCCCTA
TCTCCTTTATTTTTCTCAGGTCTTTTTTGCTTACTGGTGGTGGACAAATGTGAATGTGTC
TGGAAATGTCCCTGTTCAGTAACTTGCCTGAAAGGTGCCTGGTGTGTCTAAACCTGGGCC
ACCTGGGGTTTGGCTCTGTCTCACTGGATGGCACAGAGCTTCTCTTTGTTGCACCTTGAC
AAATGACATGTAGACAGGCTCGCTAGCTTTGGGTTCTGCCAAAGTAACATTCATATGCTA
CCCTATTTTTAAATTTTTGCCATTTTTTTTAAAAAGAGCTTATTTAAGTTTACAAGGAAA
AGTAATTATACATTTCTTCTTCTCTTTTTTTTTTTTTTTTTTTTTGAGACAGTCTTACTT
TGTTGCCCTCGGTAGAGTGCTGTGGTGTCACAGCTCACAACAACCTCAAACTCTTGGACT
CAAGCAATTCTCTTGCCTCAATAGCTGGGACTACAGGTGCCTGCGGTAATGCCTGGCTTT
TTTTGGTTACAATTGTCATTTGTTGTTTAGCAGGCCCAAGCTGGGCTCAAACCTGCCAGC
CTCGGTGTATGTGGCCAGTGGCAAAAGCACTGTGCTACGGGTGCCAAGCCTGTATATCTT
CTCAAGAGTTGTCACTCTTTTTCCAAAGCCCCTGGTGAAGCATGTCTGGCTCACCACCAC
CCTTCTCCAGCCCTGTCTCAGCTGCTGTTCTCCCAGTTAACAAAGCTTGGTGATTGGGTG
CTGTTGCCCTCTTGAAGGCAATGACATCCACTTCACCACCATGAGCATAAGATATACAGA
ATGTGTCCCAATCCCAGAATTAAAAATGTGAGAAAATAATGGTGGTACATCAGAGGGCAT
TTGTTTAAGTATGTTTGGAAGTTAAAGTGAACATAAAACTTTAGTTTTTTGTGGATTTGT
AAAGTTTGTTTTTTTTCCCTGTAGAACTGATGAACTTCAAACGGAAGAGAGTGGCAGCAT
TTAGGAAGAATCTAATCGAAATGTCTGAACTGGAAATAAAGCATGCCAGGGTAAGTATTT
TTTTCAAATTAAGCCAACAACTTCTTTGGGATTTTTTTCAAAGTTATTTCCCGAGTTTTT
ATCCCAGTGTCATTAGGCACTAAATTGTGCCTTGTGGCATTAATTCTTTGTAGTACTTGT
AGAGGATGCCACTTATTGGAGTTTTTTTGGTATAGCAAACCATAAATTCACAACATTTTT
GAGACAGTGTCACTCTGTTGCCCAGGTTAGAGAGCCATGGTGTCAGCCTAGCTCACAGCA
ACCTCAAACTCGTGGGTTCAAGCAATCCTCTTGCCTCAGCCTCCTTAGTAAGTGGGACTT
AGAGGCAGTGGACTAATTTTTCTTTCTTTTTTTTTTTCTTTGCAGTTTTTTGCTGTGGCC
GGGTTTGAACCCACCACCTCCAGTATATGGAGCTGGTGCCATACTCCTTTGAGCCATAGG
CGCCATCCTAATTTTTCTTTTTTAGTAGCGGTAAGGTCTTGGTTTTGCTCAGGCTAATCT
CAGCCTCCTCCACTCATACAATCCTCCCGCATTAGCCTCCAAGTGTTAGCATTATGGGCA
TGAGCTCTCGTGACTGGCCCATAAATTCACATCTTGCCTTGCCTGACTCTCAGACTGGGG
ACTTCTTAGGCTGTGGTGTTCTCCATGCAAGTTCTGGGCTGGTTTCAGGGCGTAGGGCAG
CCCTCAGACCTGAGGGAACTGAGAGAGGAGCTGTCACTCACCCTCAGGCTTTTGACCTTA
TTTATTTATTTTGAAAACTCCTTTGCTGCATAGATGTTTTTAATCACTTGCCTTTTGATT
AGGTCCAAGTCTTGTTTATGACTCTTCACCCTCCCCAGCATTCTCTCCTGTTGTATATGG
CATTAAAGTGGAGTTTAAAACTGCCGTTTTAATTCACATTAAATCACATCCATTAATGTT
TTGGGTGTTGTGTCTTCTAAATTTTTTCAAGGCTAATGGGAGAACTTTATAAAGCAAGTT
TTGCAGATTTCTTATATGAATATTATTTGCAAATCTCATCCATAATCTCACCCATGACTA
ATTTATTCAGTGTTCCTAAGGCCCTCAACTTCATAAAACACCTCATTTATACAGTGTTCA
AGGTTAAGACATTGAAGTATGCGGGATTGGCCTGATCACATTTGGGGGAAAACAGGTAGG
AGGGGGTGAGTGAGGATGGAGTTGCTGGGCAGCGTCCTCCAGCTCTTTACCATGGAGCTC
CTCCCAGCAGCAGTTCCAGACCCATGCATGGAGAGAAGAACTCTTCAGCAAGACCAAGGG
AGGAGAGACAGGTTGCAGTTCACCTGAGTTTGAATGAAGAGTAGTGCCAACCAGTCTGGC
TGGCTTCAAATCTCTCTTGTGAGAAGCTCTGTTTGTGGACTTGTGTTGAGTTCTTAACTG
CTGTACAGCAAGTCTGCATAGTCCATTGACTATGGGCTACCTTAACTTTTCTCTTCCCCC
TAAGTGGCAATGTCTCCCTCTTCAAAGCTGCATTGACTTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTTTGGGAATAAATTT
TTTTGATTTTCTAAAAACCCTACCCCTTACCCTTGTTGGGTTTAAAATTTTTTTTTGCAT
TCTATTTGGACATTACCTACTTCCATTCAGCAATTTAAATCCCTCCAAGGGGGGCAGGAA
TTGAAATACTGGGGTCTCCTGTATTTTGTCCGAGTTTCTAAGGAAGGGCCGTAGGAGTTC
ATGTTGCTTCTGGAAAGCAAGTAAAGGCAGTCACCTGGCCAATGTTTGTCTCTTGTTTTC
TTGTGCCCATGTCCCTACTAATTGTCAGGGAGGTGCCAGTTACAACAAATGATTCAGCTG
CTTGTTAACAGGTAACAGACATTCCATTCCTTAATACTTGTGTTTTTGCTCAGTTACTCC
CATAACCTCAAGTGTTTGTACTATGGCAACAGCAAGAAAATCTCATTTTTGTACACATCC
TTTGCAGCTCCATTTTTGTAGGTGGGATATAAATATTTGAGGGCAGGCTATGTAGAGAAG
CAAGGCCTCCTTTAGAAGATAGCCAGATCTCCATTAAGAGAGATGTGAGCTCTTTCTGTA
ATGGTAGTGGGGGATACACATGTTTGGGCTTCTGTTTATAATTTTATAAAGTATATAATA
AAATAATAAATTACGCTACTGTATGAGTGTTTTTGTGGAAAACAAGGCCAGAGTATTCTG
CAAGTGCAGTTGTGCTAAGCCTTGGCTGTGGTGAAAAGGCAACAGTGACTTCCGCTCAGC
ATCCAGGGGGGCCTTTGCACTAGTCTTGAAGACATTCCCTCTATCTGGGTTTGTCTGTTT
GCTCTTGACCTGGTTCCGGCTTGTGGGTTTTGCCAGGGACTTGAACACTGCCACCTTCTC
TCTACTGCAAACTTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 13397..13501, 14438..14548, 16248..16369, 18440..18563, 19435..19530, 21339..21444, 21530..21605, 22741..22745, 22747..22754, 22757..22780, 22869..22955, 24800..24959, 28584..28669, 30125..30139, 30142..30156
1001..1051, 13397..13501, 14438..14548, 16248..16369, 18440..18563, 19435..19530, 21339..21444, 21530..21605, 22741..22745, 22747..22754, 22757..22780, 22869..22955, 24800..24959, 28584..28669, 30125..30139, 30142..30156
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved