Otolemur_garnettii Locus ENSOGAG00000001860
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000001860
Otolemur_garnettii
ENSOGAG00000001860
GeneScaffold_5401
SNORA42
4633..4764
25823
TATTTGTGGAATGGCTCTATGCCCGTAAGTACAGTGGGTACAGCATTGGCCACATACAC
CGGGGCTGGCGGGTTAGAACCCAGCCTGGGCCAGCTAAACAATGACAACTGCCGCCGAAA
AATAGACGGGTGTTTTGGCGGGCGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAAGA
GAATCGCTTAAGCCCAAGAGTTTGAGGTTGCTGTGAGCTGTGACGTCACAGCACCCTACA
GAGGGTGACATAGAAAAAAATTGTTGAATGAGTATATTGTACATAGAATTTAAAAAAGTA
TAGGTGAAACAAACTCTATGAGCGAGAGTAGGAGAGAAAGCTGGGTTGGACGGGCCCTTG
AATAGGAGGAAGGGAGCTGTGGGGATTAAGAAACTAAGATCCAGTGGGGGAAAGGCCTGG
TCTGAGTTAATAATCCAGGACTGGAAAGAGCAGAAGCCAGGACCATCTGCCGATTTAGGG
CGCAGGCCAGCTCAGCGCAGCCCCACTGGGCCCCACTGGGCCGGGTCCAGCCCCTGAGTG
GCGGGAGCCCCCAGAGGGTACCTCTGCTCTAAGAGCTGCTGTCCCTGGAGTCACGCACAG
GGACTGATAGCCACGCTCTGCTCTGGGGGACCAGAACGCCGCTGGCCGGAAAAGAGGACA
TCGGCGATCCAGGTTGAAATCCCGAACCTCGTACTCACAGGCAGGCCACGTTCGACCTCC
CGCTGCAAGCTCCCTCCCTCCCACCGCTCCCACGTCACACCGCGAGCGCAGACCGTTCAC
CTAGAGCTTGAATCCAAACGCGGAACGGAAAAGATAAGGCCTCAGTTTCCGGGGACGTTT
AACGCATTGCACCGGCCCCTTCCTTATCCGGAAGGGTCGGCGGCGGGCTGGTGCGGCCCC
ACGTGCGTAGGCGGGGATGCCGGCGTAGCTGCTGTCGCCGCGGTAGGTGAGATTGCCCCA
GTCTGGAGAGCGGAGGTCTCCCGCGCCGCGACGACTTCATCATGGTGGGCCCCTCCTGCT
TCCCTGTACCCTCTCAGTTGGTTCCTTGGAGGGATCTTGTCGGGCGGACAGGCAGGCAGG
CAGGCGGGGAGTGGTCTCAGGAGCGGGGCCAGGGGAGGAGGCAAAGTGAAAATATTGTGG
AGCCGGGGCGCGGGTGCGGGCGAATCCGACAGATCTAGGACCCTTGGAGTTCCTGTCCCT
GTGCTGACGTACTCACTTGCCGCCCCGCCACTCTGTCTCCTGCCCACCTTCTCCTTAGGC
ATTAGCCCCTCATGGGTGGGGGTGGCGGGGGCAGCTCGCATCTTTGCTTTCTTCTCTTGG
ACAAAACTGAGAGCGCTGGGCCCGCACACCTGTTCCACCCGTGAGGTCAGACTGGGCCCG
GTCACTTCTTCCCTGGCGTCCGGTCATCGCCAGTTAGTGACCTGTTGCTGCCCCAAATCT
TGTCTCTACGATCCTCTCACCCTCATTCCCGCTAGTGCCCAGACGCTGTTTTATTTTTAT
TAAAAATTGATACAAAAGTCTTCATAAACATTTACTTGTAAAGATAGGCTGTATAAGGAA
CTCCCCTTTACCCGTTAATGTAGTTTAAGAAGTAAAATACAACTTTTGAAAGCCTGTGTT
CTGTCCGAACCTGTATCCTTGGGGAACCCCTCAGAGGTAACAGTATCTAAGTTTAATGTT
TATAGTTACATTATTTTTCTTTATAGTTAACTACATATGTTTATATTCCAAAACAATATG
TTGTTTCTTAAACAGGTTTTTTACATTGTTGTGTGATCTATGAGGAACTTAAAAGTTGGA
GTGATGCACCTAGTTTTTTAAAGAGATGTTCATTATGTTTTTTAGTTGTTCTTTGGTATC
TGTTTTAAAGAGATGTTCATGTTTTTCATCTATTTTAAAGAGATGTTCATATGTTTTTTA
CTTGTTCTTTGGTATCTGTTTCATAAGTTCTTTAGTTCTTTGGTATTGGTGTTGGTTTCC
GAACCCCCTTGAATGCTTAAGTCCGCGGATATGGATGCTGGGGAATTCCCTTATATAAAG
TGGAGTGGTTTTTGCATAAAACCCACAGACAACCTCCTGTATATTTTAAGTCATCTCTAG
ATTACTTACAATACCTAATACAACGTAAATGCTGTGTAAATAGTTGTTACCCATTATATA
TTCTTTTGAATTTGTATTGCTTTTATTGTGGCATTGTTATTTTTATTTGCCAAATGTTTT
CTATCTGCAGTTGGTTGAATTTGGATGCAAAACCTACACATACAAAAGAGTGCTGGAAAT
AATATCAGTCTAAAACTGAAACACACAGCAAATGTTACAAAAAAATAAGTAACTAGTTCA
GCTACACTTAAAATAAGTTAACTAGTTCAGCTAAACTTAGTAAACTAAAGGATGAATTAT
TATCAAGTGCTACTTTTTGTTTTGTTTTGTAACATAATATGCACTTTTTAAAATTTATTT
TTATGGTTACATTTATTTTATGTTCAGCATTCTGAAGCCTAGGCTTGATTAGTAATAATT
ATTTTCTAAATCACTACTAAGTCTAATCCAAAAGTATATTTGGAATTACAGTAACTGACT
TACAAATGAAATATCCTAGTTTAAATACCTAAGAAATTTGGAATTTATTTATCTAATATT
TATATCTTAATACAGTTTTTTAAAGCTGTGTATGTGTCGGGGTGGTCATGGTAAATTGCC
TCAAACAAGACTGCCTTTTTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAAAGTTAAGGAGTAAGCAT
TTAGATTTTTATCTTAGAATTTTTGCACAAAATTTGTTCAGGCAGTTCACCTTTATTTCT
CTATTGCGTCCCATCTGAATATCCTTGATAGACTAGACTATACTTCTCTTTAACTATCTC
TGGAGAGAGGCAGTCCTTTGCATCTTTCATTGATTGTATCTTTATTTCATTAAGATTTCA
AATATGATATTCTAGTCTTTGATACATAGTAGAAGTAATTAAGTAATATGTTACTTAATA
ACATTAATTTTTATCTTAATGTTCCACGTAGATCTAAATAGTGTTGCATGTGAAGTGAGT
TTGCACTACTAGACTTTTACTAGACTTATTGTCTATTTTAAAGACAATGCAATCTTTTCA
TAATTTATAAAAACAATTGCAATTCCAAATATCGTACTCTAACCTCTTACCTTTAAACTC
TTCTTTCAGACTTTGGTTGGAACAGTCTGACTGAAGTTAAACAGAATTAAAACCTGTGTT
TTTCCTGCATCTTATTTTAATGTTTTTCTTTTAATTGTCTATTTAAAGCACTGACTGTTT
CTTCCCATTTTATAATTAAAAACTAATGGTATGGAAGATAATTGTTGTTCAGTTCAAATG
GATTTTCAGTTTTCACTGTCATGTTGCAAAGAATATTTGATTAATGACATCCAAAGATAT
GCTACAGTAATGCAGGTACTTTTTGATGTTCGATCAGAGTCAATATTGAACTATATTATT
TCATACTAGTTTTCTCACTTTAAGGACAGGGAGGATATTTGATTTGATTCCTAGATTTAA
ATGTTAATTTCCATATTAATTAGGTAGTAGGTTTATTTAGTAGCTTGAAAATTGAGAAAT
ATTTGGGAAACTCCTTGTTTCTTAGATCTCAGATTACTTCCTCAGGGAGGCCTTTCCTGA
TTTTTCAAAGTTAGTCAGGAACATAACCTTTCTGGCCAGCACTTATTAAATTAGTTAATC
ATGTGATAACTAGATTATAAGCTCCATGAAGGCAAGTTTATGTCTGGTTTTGATCCTGGC
ATCTCAGGCTTATCCTACTACAATGTGTATATGGTGTATGCTCAGTAAGTTTTGTTTTTT
TTTTTAATAATCTTAACTGTAACACACATTTTTAGCTATGAGTCTCATCTTTGCTTTGAA
GATGGAATAGTTGAAGAGCTGAGTTTTATGATCCCTTCTGTGCCTTTCTTTATTCTCTAA
TGTTATGGGAGAGTAGTTCCAAATATCTCTGTATGACTATGAAAGCAAAGACTATTAAAA
TTGTTTAATAAATGCGTGGGTTTGTATTTCTGATAGGCCTATACGTGTGGGCCTGTCACA
GAGCCCCATGCCAGAGCAAACTGGCCCCAAACCATTGCCTCGCCTCTACCTATAGGCTGC
TGGCACTGAAGTGGGTCGTACAGTGAAAAAAAGAAAGAAAAAAAATTGTTTAATAAGTCT
TGTTCCTCTCCTGACTTCTTGTCTAATATTTCTGGCTCGTTGCATTTCTCTTACATTAAT
TTTTTTTTAATTTATTTTTAAAGAAATTTGTTTGACTGGAGTCACTTATATATCCTACTC
TCATTATGTTTTTGTATATTTTAGCCTAAAGTGCTAAAGGGAAAAAGTGCAGGACGGGAA
AAAAAAATCATCCATCCATATAGTAGAAAAGCCGCTCAAATTACAAGAGAGGCCCACAAA
CAAGAGAAAAGGGAAAAGTAAGTATCTTTTCGTCTTTTATATTATGCATCTATCAGATTG
GTAAAATGCCCTTAATTCATTTATCCTTCAGACGTAAATCTTCCCTTAATATACACCTGC
TTTCTTCCTTTAGTAAATGTTTGAGTGTTATATGTGCTGAAGCTAAAACCAACTCTATAC
TTACAGAGCTTACCTAAAACAGATAAATAAATTAAAAGAGCAATGTGTGATGAATGTAAT
GAGGAAAATTAAAAAGCGCTGGAGGATTGAGAGCCAGAGAGATTTGTTTTGTATAGGCTG
GTCATGGAAGGCTCTTCTGTCATTTGGGCAGTTGAAAGATGTGAGGGAGTGATTGATTAT
GCAGTGGGCATAGAGATTAAAGTGCCTAGTAGACGTATAAGGGGACATGTGGAATGGATA
TGTTTGGTAGTCAGAATAGGTTAGGGATGTAGACAGAAATGTGAGAGCCATCAGTACCCA
CATGGGGATTCAAGCTGGAAGACTGGATAGAATATCCTAATAGTTACCTCTAAATAGAGA
AGAGAAGGAAGCCACGGCCTGAGATGAGAGGCCCTCTGCTGTTTAGGGGTTGGGAAAGGA
GGATTCCACAGGGGAGACTGAGAAGGAGAAAAAAGAAGATGGTGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAAAGGGAAAAGTAAGTATCTTTTCGTCTTTTATATTATGCATCTA
TCAGATTGGTAAAATGCCCTTAATTCATTTATCCTTCAGACGTAAATCTTCCCTTAATAT
ACACCTGCTTTCTTCCTTTAGTAAATGTTTGAGTGTTATATGTGCTGAAGCTAAAACCAA
CTCTATACTTACAGAGCTTACCTAAAACAGATAAATAAATTAAAAGAGCAATGTGTGATG
AATGTAATGAGGAAAATTAAAAAGCGCTGGAGGATTGAGAGCCAGAGAGATTTGTTTTGT
ATAGGCTGGTCATGGAAGGCTCTTCTGTCATTTGGGCAGTTGAAAGATGTGAGGGAGTGA
TTGATTATGCAGTGGGCATAGAGATTAAAGTGCCTAGTAGACGTATAAGGGGACATGTGG
AATGGATATGTTTGGTAGTCAGAATAGGTTAGGGATGTAGACAGAAATGTGAGAGCCATC
AGTACCCACATGGGGATTTCAAGCTGGAAGACTGGATAGAATATCCTAATAGTTACCTCT
AAATAGAGAAGAGAAGGAAGCCACGGCCTGAGATGAGAGGCCCTCTGCTGTTTAGGGGTT
GGGAAAGGAGGATTCCCACAGGGGAGACTGAGAAGGAGAAAAAAGAAGATGGTGTTTCAG
AGATTTCCTTGAAATCAAGTGAAGACCAAATAAAAATCATCATTTTGATTATTTTAGAAT
AGTTCCACTGTTTTAATTAGTAAGTGCATTTACATACTAGCTGATGGAAACCAACACTTT
TATTATGTGATGATCCCTTGCCTAAGACAAAAGCCATATTTAGTAAAGCTTAGCTGTTTC
ACCAGATTACATAGCCCCCAAAGCCTGAAGTGTTATTATGTGACCATTTAAGAAAGTATT
TGCCATCTCTTATTATTTTGAATAAAACTCCCGTGAACATTCATGTACAGGAGATTATGT
GCACAAATGTTTTTATTTTTCTTTTGGTTCTTAGAACTGGAATTGGTAGGTCAAATGATA
GATGTTTGTTTGGATTTATAAGAAATCAAGTTTAAAGAATTGCTCGGTCATATGGTTATG
GTTATGTATATAAAAATTACTTTTTTCAAAGTGGTAGTAGCCTTTTATATTTTCACCAGA
GTATTTGATTGGCTGCATATCCTCTCGAGCATGTACTTCCAGGTTTGTTTTCTTTTCTTT
TTAACTTTAAGCCATCTAGTAGGTATGTAGTGGTATCTTAGGGTGGTTTAAGTTTTCATT
TCTTGATGACTACAATGTAGAGCGTCTTCTTTGATGAAGAATCTGTTCAAATCTTTTTCG
CTTTTTTGGTACTGAATTTTTTGTCTATTAGGTAGTAAGAACTGTTTGTTTATTCTGGTA
ATAAGTTCTTTGTTAGTTTTTTGTATTTTTTTATTATGAATACTTTTTCTCATTCTGTGG
CTAAGATTTTTGTAAAAATAAAGGCTTTATTTTATTTCTCCAGATTTTAGTGAGTAAAAT
GGGAGGGTTTTTTTCTTATTACTCCATTACGCCATCTGTACTTGCCCTTTATACAAAGCC
TTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGCT
TAGCTGTTTCACCAGATTACATAGCCCCCAAAGCCTGAAGTGTTATTATGTGACCATTTA
AGAAAGTATTTGCCATCTCTTATTATTTTGAATAAAACTCCCGTGAACATTCATGTACAG
GAGATTATGTGCACAAATGTTTTTATTTTTCTTTTGGTTCTTAGAACTGGAATTGGTAGG
TCAAATGATAGATGTTTGTTTGGATTTATAAGAAATCAAGTTTAAAGAATTGCTCGGTCA
TATGGTTATGGTTATGTATATAAAAATTACTTTTTTCAAAGTGGTAGTAGCCTTTTATAT
TTTCACCAGAGTATTTGATTGGCTGCATATCCTCTCGAGCATGTACTTCCAGGTTTGTTT
TCTTTTCTTTTTAACTTTAAGCCATCTAGTAGGTATGTAGTGGTATCTTAGGGTGGTTTA
AGTTTTCATTTCTTGATGACTACAATGTAGAGCGTCTTCTTTGATGAAGAATCTGTTCAA
ATCTTTTTCGCTTTTTTGGTACTGAATTTTTTGTCTATTAGGTAGTAAGAACTGTTTGTT
TATTCTGGTAATAAGTTCTTTGTTAGTTTTTTGTATTTTTTTATTATGAATACTTTTTCC
CATTCTGTGGCTAAGATTTTTGTAAAAATAAAGGCTTTATTTTATTTCTCCAGTTTTTTA
GTTGAGTAAAATGGGAGGTTTTTTTCTTATTACTCCATTACGCCATCTGTACTTGCCCTT
TATACAAAGCCTTCTCCTTTAGCTAAGATTTTTCTTTTCCCATTCTCGTGTTCCCCATCC
TCTTAATTCTGTTTTTTATAGAACTTTGAATAACATCTCCGAATGTTCAGGTCTCAGCAT
GAAAGTCACATGTCCTGGAAACCATTCGCGGATCCTAAGAAGTTCTGTAGGTACTTTTTA
AATGTTTTTTTGTGGCTTTGTATCATCTCCATGTTTTCATTGTCTTCCACATTTAAAGCT
TTGTCAGGTACAGAGACAGTGGCTTACTTTGTTCATTGCCATATCCCTAGAGGCTGGTGT
AAAGTCTGGCAAAGACTTGGTGTCCAAAAAACTTTTGAATGAATGAATAATTATTTAGAC
TGTCAGTAAGGCATTTATTACCTATAGTCTTTCTGACCACAGATGAGTTTTTACTCTTAT
TTTTAAATTTATGAAAAGCAATCATGCTATATTCTTAAAAAAATTTAAAAGACAAGCAGT
AATGCATTTTACTCTTGCAGTCTTCTAGAAGGTGGGTATTACTCTTGTGCATAAATATTC
AGCATATCATAAAACCACCCCAACAATTGTAATTTGGTCAAGCTTTCAGTTTTGTTTTTG
AAAGTAGCTTGTTCTATAAGTTTCTTAAATATGAAGAGGCAAAAAAAGTTTCTTACAACA
TTTTGTTCTGATCATTTTATAGGTGAACCATGGAGTTCAATGATGATCCTGAGATTAAAG
TTTTGGGGGGCAGTTCTTGTTGTTTTTGACAGATTTTTAATGCTTGCTTTAGAGATTTTC
TGATGTGTGTATATATATATATATCTTTTCTTTCAAGATTGAAGAATGAAAAGGCCTTGC
GTCTTAACCTTATTGGTAAGTGGGTTTACTTACTGAAATTCTGGCTAAAGTGTATGAATT
TATGCCCTCTATCTATTTTTATTTTTATCTTTCTAATGAAGTACTGTGACTTTCTTGCCA
AACTAAATTAAAATGAAACTGGAATAAACAATGTTAGTGATTTCTAGCTCGATTTTCCAG
AAATTGTTTGCTTTATACCTACCTGCCCATCTACACACATGCGTCCAGTATTTATCTATC
TGTCTATAAAGTTTAATTCTAACTCCCTGTCTGTGAGCATTAGGGAAAATTATAGCTTCA
GTATTGTGGAGACAATTCATACTTAATGATATGGATACCTGTAATTTTAACTTTTATCTC
AGCATTGAAATCTCTCAGGTTCAAATTTATTGTTAAGTTTTTACTGATGAGTTTTTTTTT
TTTTTAATTGAGACAGAGTCTCACTTTGTTGCCCTCAGTAGAGTGCTATGACACCACAGC
TCACAGCAACCTCCAGCTCTTGGGCTTAAGTGATTCTTTTGCCTCAGCCTCCTGAGTAGC
TGGGACTACAGGCAACTACCACAATGCCCAGTTATTTTTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTTTTCTTTTTTTTTTTGTAAACTTTATTGGCTGAAA
AGTTTTACCAAAAGACCATTTCTCCCAATTCGTCTCATTTCTAAATCAAATGGGAAGTTT
AATTTCTGATAGACTGTTTATTTAGCTTTGAGGCCCCGTAAGATTTTATATTTAACATTG
AAATAAATTTTGTTCTGTTTTAACACATCCAGTGTTGAGATTGTAATAACACCTCTCTGC
TCAACTGATGGCTTATGTTGCTAAACTATTTTGATACTTCTTATTTCATAGGTGAAAAAC
TTCAGTGGTTTCAAAATTCATCTTGATCCCCCAAAAAGTGAGATATTCCAAAGAAAAGAT
GCTTGTGAATTATTGAAAAGGTAAACCCTGGGTGAAATTATGAACAGTCAGAAAAGGTAC
TTCTCCACCTGATTCTTTAAGAGATTTGCAGAGGAGCAAATGGGCTCAGTTATCAGAAAG
ACTTTAGACTTATATGCTGGCAGAGCCCCTTCAGTAGGTTTGAGCCTCAGAGTATTAACC
CAGTTTCTTTGGATCAGGAAAGACTTCCTAGAGAAATAGCCAAACTTTGGATATTGGCAC
ATGAAGGATGAGGATTAGCAGATCCAGGTAAGATCATTTGAAATGTATCTAGTCAGAGGA
ATATTTAAAAGTCCCTAACAGGAGAGCAAAGAAAACATACCTAATAATGTGCCAGACATT
TAGTGTGACCGAAATAACAAGTTCAGGAAAGAAAGTATAGCAGGTTCAGTAAGCGACAGC
CAGCACCTAAAAGACTTCAGCTATCAATCTCGGAGTTTGGACCTTATCTAAGGAGGTTAG
GAACCACAGGACGCTTTTATAGCAAGCTCCTGAGATGATGATATTTACACTTTAGAAAGG
TCACAGTTGTGAGAATGAGGAAAATGTTCTGAGGGAGACATGGCTCTAGCCAGGAGACCA
CTGAGAGGCTGATGCTGAAATCTAGGCAGGAGGTGATGGTGGCCTCTGCTGGGTTAGGTG
TAGGGTGGTGAAGAGAGAGGAACAGTTCCAGAGATACTGAGAAGGCAGAGGTCTCTGTCT
AGTGCAAGTTTAGGTGGGGAGTGAAGGAGGGAGAGGAGGCCAGGAGTGTGCCTAATTTCT
CACTTGGGCAACTGGATGACTGGTCCTATTTCCTGAGATGGGGAGCCTAAGGGATAGAGT
AATTTGATGGGGGAGGTTGGGGACAGGGTGGTGACAGTTTTGGTTTTGGTGGGCTGAGGA
TGAAGCTGCTAAATGTCTAAATGGAGATAGATGTTCAGTAAGTGGCTGGACATGAGGGTT
TGTGGTTCAGCAGACCCTTGGTAGCAGGCTGTGATTTAGCTGGTGAAATTGAGGAAGTGG
AACAGTTATACAGAGAAGGGTGCAGAATTTTGAGAACCCAAAACATAAACATTAAAGAAC
AGGTGAAGACTGGGGATTAGATTTCCATGAATTTATCTAAGCCAAATAGCTGAGACTTTG
CAACTCATCGTTTTCTTATTTTTCAGGTATTTAAATCGATTCAGCAATGAGCTGGAGCAG
ATCGAGTTACATAACAGCATCAGAGACAGGCAGGGAAGGCGGCACTACTCCCGGGAGACA
GTCATCAAGCAGACGATGGAGCGTGAGCGGCAGCAGTATGAAGGTTATGGCCTTGGTGTG
TTCTCCGTGATTTTTTTTTTTCTTTTAAAAATACATAGTATCAGATTTGTAATTCATTTC
AAAGGTTTTATTTTATTTGTTCTATTAATTTAGCTTGATTTCTAACTTTGATTTCTTTTT
CTGAGTGTTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTACCTATCTTCTATTTCCT
GGTGGTATAACTATTTTTCACTCCATTTATCAAAATTCTTTTTAAAAAACTTTTGTATTT
AATTTACATGTTTTAATACCTAGCCCTTTACAATTTTATTTTCTGAAACTATTATAAAAG
TCAGTAGGCAGTGTATCAGATATGTTTGTTTATCTTCATTACTTGACACTAAATATTGTC
TTGCATTGGTTAGACTCTTTGCCAGTTTCAGTTATTGTACGTGCCTCTTATGTTTCACCA
ATTTAAGTGTGATCATGTGTATTAGTTTATGATGAACTTTCTAATCATGGTAAGGAACTG
CCATACACGGTGTTTATTAAAAATGGGTTTAAATTGTATTGAACTTTATTGAGTACAGAT
TGATTGTAGTATTTAAATTTTTTTCACATTTTGAATAATGTGCTTTTTTAACATTAAATA
ATCCATGCATTCCTCAGATAATTCTACTTGCCAAGGTAAAGTATGTGTTTGAAAAAATTG
TTATTTTTTACCAAGAAAATATAATAACACAATCTGGCATGTTATTTGAGGAGCTTAATA
GTTAGATTTTGCTGGTTCCTTTTTTTTTGAAACAGAGTTTCAGTGTATGGCCCTAGTAGA
GTGTTGTGGCGTCCCAGTTCATAGCAACCTCAGCCTTTTGGGCTTAAGCATTCTCATGCC
TCAGCCTCCCGAGTAGCTGGGACTGTAGCGCGCGCCACAATGCCCGGCTATTTTTTTTTT
TGTAGTTGTCATTGCTGTTTGGCAGGCCCAGGCCGGGTTCGAACCTCCAGGCCCAGTGTA
TTATGACCCGTGCTCTAGCTGTTGAGCGACAGGTGTTGAGCCTGCAGGTTCCTTTAGCAA
ATAAAAAAGAACAGCATTTATTTTATATTAAGTTTTATTTCATAGATTTCTATGTTAGTA
AGTGATTAACCTCTCTCCTAAACTCTTATAAGACTAAGCCCCTTATGAGCTTGCCAAACT
AATACGAAATGCGTTAAATTTCTGTTTTCTGTTGGCTATTCCTGCTGTCACTTTCTGGTT
ATATCTGAAATAATAAATGATGAACCTATAAAATTATTAGAACATCGCCTAATGGATACA
AATTATTCTCTTTTCCAGAAATTCCAGACATTCTGGATGCGAGTAATCTGAGAACTTAGA
GGTGAGGTTGTCTCTTTTGTTGTTTCCTTGTAGCCCTGTGTAAAATACCTGAGACATTAA
CCGTCTTCTCTTTTGAGTCCAGACATCAGAACACTACAGGAAAATCAGAGGTTTCTTCTT
CTAATCTTTTGGGTCTATTCAGGCCTGAATTTTTTGAAGTAGGTCAGTCCAGCACCCCTA
TTAAGGACTTGAAATGCTAAGGACATGGTAGACTTCTGTTTTTGAGAATAGTCAAAGGAG
TTTAGTATAATATTCAAGAGATCTTGTTCTCACTTGTCTTCCCTAGTGCTTTTTTTTTTT
TTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGCAGTTTATTAGCACATGTTTAGC
ATGTACTTGTAATTTAAGTACGTGGAGTTTAAGATTCTTTTTGTACCCTAAATAAAGTAT
TGCTTCTAGAGTTCTTAATTGTCATAGAAAATACAGAACTCGAAAAACTGAAAATTTTCC
CTTATAAGAATAAAAGTTGCTTGATTACTGAAATGTAATTGTGATGTGCCACTGTGTGTG
CAGAGAATGAGCTTTTGTATATTTTGGAGATTTGCTGGGTATAACATAGTTTTGGCTTTA
GAGATTCTTGATCCATATAGCCAATGAGGGGAGATGCTCAATTAGGGAAGGTAAAAGAGT
CTAACAGAGCTTCCTTTCCTAGGATTTTCCTGTTTTGCTTTTGCGGTTTTTAATTTGTGA
GATTTTGCTACTGAAGCTTAATGAGAAAATGTAATAAGTTTGGAAAAAGAAGCCTCAGTC
CTTGTGATGTTGGTTTTTCCCCTGGGGAACTTACATTTCTAGTGTGTTTGAATCTGCTAT
AAACTTGTAACTTTCTTCCACTTTCACATTTTTAAAAATTAACTCTCTTTTGCTTTCGTG
CCTCAAATCCTACCAATACTCTATACTCTTTCCTTTTTCCAGGGAATGGAATTTTGATCT
AAAGAAACTGCCAAACATTAAAATGAGAAAAATTTGTGCTAATGATGCACTTCCCAAGAA
GTGTAAGAGAAAAACTATTATAACTGCAGGCGAAGATTTGGGGGATCTGGAAATAAAAAG
ATGAATCAAGCGACTCTGATGAGGAAATGACTGCAGTGGACTAATTGCCTTGACTTGAAT
TGAAAATAGATAATTTGAGACTTTCAACTTACACTCATTGATTATTTATTATACATGCTG
TCAGATACAAGAGTTTGCTGTTACTCATTCTCTACCTGATGAGAGTTCATTTGCTGTTCA
AATGGGGTTAGGAATTTTATTAAAATATGAAGTTGTTGGGGCCGCGCCTGTGGCTCAAAG
GAGTAGGGCGTTGGCCCCAAATGCCGGAGGTGGCAGGTTCAAACCCAGCCCTGGCCAAAA
ACTGCAAAAAAAAAAAAAAAAAAAAAAGAAGAAGATTGCTTTTCATTTATATTAAATTGC
TAACTTATAAGTGATTTCCAAAAACTATTTAATTTGAATTTTGGGAGGGGGGAGCACTAT
GAGGACAAAAAATGTTTTAATTTTTTCCCTCATGTGCATTTAGGATTATGTAATCTGACA
TTTGGGGAAATGGACAGTAACCTGTTATCTGAAAGTTTCCTGTGGATCCTTCTTGAGCAA
TGATGATAACAAAATAGTCTTTCAGTAATTATGTCACAGTGATTCTCCTCTTAAACATTA
AGCCTATTTTCTTTTATTATAAAATAAAGGAAATTATATACTTTGGAATTTGTATACACT
GATGGATTGTACACTATTACTTTCTGAGCCAGAGTTAAATGGTAAGAAAGTGAACAGTGA
TATTGTTATATTGATCTCTTTCACTTAATCTCTTACATTTTGACAAAGGGATAAATAATT
TCGGGTTAACTCCTTTTGATTGTATATTATTTTCTGCTTTCTTACTGTGCAAAGTGATGT
GTTTTATTTGTGAAGATAGAACTAAAGATTAGAGAATCAGTGTTTTTAATTGTGTTATAT
TTTTCTTCCAAGAGATAGATTGACATTTACCGCAATATTTTGAGTATCATGAAAAATATA
GACATTGTAGAATTGTGTTCTTTGCAGAACTTGTTAAATGCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 4944..5056, 9817..9854, 14151..14176, 14178..14197, 14199..14207, 14210..14239, 15386..15534, 19518..19555, 19559..19560, 24642..24777, 24779..24823
1001..1003, 4944..5056, 9817..9854, 14151..14176, 14178..14197, 14199..14207, 14210..14239, 15386..15534, 19518..19555, 19559..19560, 24642..24777, 24779..24820
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved