Otolemur_garnettii Locus RPL30
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPL30
Otolemur_garnettii
RPL30
GeneScaffold_3295
SNORA72
3251..3383
4553
TAAATGACGTAGTTTAGTTACTAGCATAGCACGCGTGGAGCAGGCAGCGAGGTTCCTCT
CCTTTCTGTCCTTCTCCAGGGCAAGATGACGCGCGAAATAACTTACCTAAAGGTCTGATT
TTACTTTTTCTCTCTTTCGTTGCTTTTTTTTTTTTAAGGTGGTGACGGGGTGGCGACTTT
CAGTGCCAAATATTTTGAATGACCTATCACTAGACCAAGATCCAACATTAACAGCAAAAA
TACATATTTTTTAATTAGACCTGTTAATCACGCCCTCTATTCTAACTCGGCTCACAAATT
CACGTTAACCCAGCCACAAAAGTCAGTTACGGGGAGCTCAAGCGAGGGGCCACCGTTCTC
AAAGACACCAGCAACCTGGGCAAGTGCCGGGAGTGGACGCATCTGCTTCTGCTTTTGCTC
AGTATAGGGTGGAAGCGGGAACTGCGACGCACCGCAGTCCTTCCCCAGCTGCCCTACAGC
CGCGCCTTTCAGCAAAGATGAGCTCGGCGGTATTAAGACCGTGATCACGGTCGCAGCCGC
AGCCACCGTCTCTCCTCACCGACCCGCCCACCTCGCCGAGTCAGGCTCTCCACCTCCCGC
TGGGTTTGGTCCACTTCTAAGTCCGCAGCTCTCTGCAAAAGAGCAACACAAAGCTGGCAA
GCATAAGGCCCACAGCTGGAAAAAGCTGACATCTTTGCCACGGTTCTAATCAGCAGTACC
ACCAGCAACCGGGCCGCTACCTTCCACTTCTCCTTCCGCTTGCGATTTGCTTCCGCTTCC
GGTTTGCTCCGTCGGGAGGCGCTTTGCATTGTGGGAACTCCTTCCTTTCTGGCTCCCCGG
CCATCTTGGCGGTTGGTTCTGGTGAGTGGGCTCTACCGTACCGAGGTTTAAGCCCCGCGG
GTAGCCTTGTAGGCTGCCGTTTGGAACTTCGGATCCTAAACTTACTGTCTTGTCCTTCGT
ATGTTCTAGGTTGGGGGCCGTCCCGCATCTAGGGCAGGAAGATGGTGGCCGCAAAGAAGA
CGGTGAGGTGGAAGGCCGATTCACGTGGGGGAAAGACTATGGGCCGGGGCGGGCAGGCGT
CAGCCCTTTGGGGCAACAGACTGACATTTGGAGGGTCTCAGAGGGAACCTGAAAGGTCAG
CTCAATGTCTTGCGGCCCTCGACTTCGGAAGTTTTATTAAGGGGCTGGAATCCAGAAAGC
TGGATCTAGTTTTGAGGTAGTTGCAAACCAGGCCTTTAAGTCCCTCTTTAATGTTTGCTT
TGTAGAAAAAGTCGCTGGAGTCGATCAACTCGAGGCTCCAGCTCGTTATGAAAAGTGGAA
AGTATGTGCTGGGGTACAAGCAGACTTTGAAGATGATCAGACAAGGCAAAGCGAAATTGG
TCATCCTCGCCAACAACTGCCCAGCTTTGAGGTAATTGAAGGAACCTGAGCTTGCGTCGC
CCGCTGCAAACTCATCGTGAGCCAATATCCAGTACTGTAAACTTGTGATTTGGATGGCAT
AAACTCGATTTTATGTGAAGTTTATTTTCCACCCGAACGCTTACAGGAAAATTACTAGAT
TCTTATTGTGGTATTTGGATCTTGATTTCACTACACGCCCCATCATGTGCTTTCCCTCTG
TAAGCTTGTCTTGGTGGAGAAATGTATCAGGAGAGGTAGAAACAGCGGAACGTCAAAGAA
AGGTTGAGGCTGGATTGTGGAATTGCAGGGTATTAAAGAGTCAACCTGTTCTATCAACTT
TTTGAGGCAAGATTTCTGCCCACCTCATGGGTTGGAAGTCGAACTTGGTATTGTAAATAA
GCAGAAAAAACTTGGACCTTGCAGAAATGAATCATGTGATTAGTCCCCTACCCTGCTTGA
TTTTCTGTAGTAATCCATAATTCGCACACAGCATTTTGTGCGTCGTTTAATTTATCTGTA
CTTACTGGCAGAGTTGGTACTGCTCTCTCCAACCCATTCCCATAGTTTGGTTGTATTCCA
AGTCATTCTTTCAAGCTTTCCTTAAAGCTTACTACTTTTTATAGGAGTGCTTCTGAAAGG
TAGCTGTGCAAAGAAGTCACATAGGCTATTTTGTTGAAATGCTGGTTCTGGGGCGGCACC
TGTGGCTTAAAAAAGTAGGGCGCCAGCCCCATATGCCAGAGGTGGTGGGTTGAAACCCAG
CCCTGGCCAAAAAAGAAATGCTGGTTCTGACTCTGGATCTGGCACCGGGCTTGAGATGAC
TTTAGCGCTGAAATGTTAAGTCTTTGAGTTAAAAATGTATCACTCAGGTAGGATTCAGAG
CACTAGTGGGTGATACAAATGGCTTATTTTTTAAAGATAACTTGAGTTTGGGTTCTGGAT
CTGCCAGTTGTTATTCTGTTCTTTGATTTCTTCGTGAGCTTAAAAAGTGTATAATACCTG
CTTCAGTGGTCATGGGAATTATGTAAAGTGTCTAGCAGTTAATGCTAAGCAAATAATGCT
TTGCTTTAATTTATTTTGCATTCTGCTCTGTTCTATGAACATAGGTACCGTTGTAAACAT
AGTAGGTGTTCAGTAGGTGTGGTTGTCCCATCACTTGTGATGGACTCAAGGGTTGGCATG
TGTGGTTAATGGATGTGGTACTGTGTTTTTAATAGTAGTAAGTGGTTTTGCTACTGTTTA
GAGGCCTCACCTTTGTTAAAACTACTTAGTCTGTCATTCACTTGGTATGAGCTTTATTTA
TTTATTTTGTTCCCAAAGGAAATCTGAAATAGAGTATTATGCCATGTTAGCCAAAACTGG
TGTTCATCACTACAGTGGCAATAATATTGAATTGGGCACAGCATGTGGAAAATACTACAG
AGTATGTACACTGGCCATCATTGATCCAGGTATGTATTTTAAATCATAAAATCACTTTTT
CCTTTCTAGTGTAGTATCTACGTATGTTTTCCTTGCTATGCAAATATCTTTGGCTTCGGA
GCTCAGATAGTAAGGATTTAGATGGATATAGCAAAGTATATATTTTTTGTGTTATGTAGA
GAACTGGCAGTGAATGTCAATACTTTATAATTGGCTTTATTACAACATTTTTTGTTCTGA
GATTGTGAATTGTTTAGTAATTAGACACTTAAGTAATGTCTTAGAAACTTGGGAAAGGGT
GAAATTTATAAGTGGGAATAATCAGGTAAAATAGAAGATAGTAATTGAAAGCTGTCTGAA
AACAGGTAAAATTAGGTTTTAAAAAGTGCCTACAAATAAACATATCATGAATTTTAGTTA
ATTACTAAATACTGCGAATATTCTCGCTGTTCTGATTTTATAATAATCAGCACAGGCTAA
ACATTCGCTATATAAAAACCATGCATGTGTCCCCCAGACCTAGTTCTTTTCCTAGGTTTG
GTTTTATAAATGCTGGTGATAAATGAAGTCTGATTTATTACATGATCAGTTTGTGTGATT
GTACAATGGCTGTGATTCTAGGTTATCTTTGGTCACAAGTCATCTTTAAGTGAATTGTAA
AATTACTGTATTTTTATTTTCTAGGTGACTCTGATATCATTAGAAGCATGCCAGAACAGA
CTGGTGAAAAGTAAATCATGTACATTTTTTCTTTAATAAAACTTGCTAGAGCTTGTTTTA
AAACAGTGTATCCATTTTATTTATGTCTTTGTTTTAGTACACTTGTCTGCAGGTAGTTTT
TGAGAGAATGGGATGGCTGAATGTGGTGGCCAAACTTTCCAGAGAAGAGTTAAACATTAC
AGTTTCCATTGTTCCATCTTAGTAAAGGGAGTACACTGAGTTTCCTTTCTAGTTTTTAAG
AGACTTAATTTGTGTAATTCCAATCTCAGGGCATTGTTTGCATTTTATATTTTGAATATT
TTTGAGAGGCATTAAGGTTAAATGCCCAAAATTTAACCAGAAGTACATCTTGCCAAGTTT
GTAGCAAAAAGGATTAAGTGAAATTGTTTCCTCACCCAAAATGCTATCAGGCTGAGAAAA
GTTTTGTTGAACCTTACTGAAGAGAGGTCTTTCCATAAGGTTGTATACTGGATGTACTTG
GATGACTTCAAAATAATCATTACCCAAGTATGTTTTATATCATATGTCCTGAAAGATGTA
CTGTGACGTATATTTGGTGTTTAAGATTTTTGGAAACTGCATCTTGCATTTCCCAAGAGT
ACAAGTTGTCCCCAAGTTACAAACATCCGACTGACATACAACTTCTGCTTGTGAATGCAG
GCTATTATGGTAAGTCTCCAAGTTAACAAACATCTGACTGGTGTATGGCTCATACTTACA
AGTGGAAGCTATTATAGGTTAGAGGTAAATGTAACTGTTTCAACTTAAGAACCTATCTTA
TTTGGAACCTGGTGACTAGCTATAACTCTTCCCCATATGTGTTAACATCCTTTGGAACAT
TCAAAGGAATCGGTCTGGGGGTGTTGAATGGTGCTGGTAGGGTATACCCCCTGCAGTCTG
CTGATCTTTGAGGGAGGCTACAGAAGTATCAGAAATGGTAGTGTATTTGGGTTTTAGAAT
CAGTCTCTCTTCCACCTACTTTCTCTCAATCAATTTGGATGGTAGATGAATGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1265..1410, 2718..2848, 3504..3553
1001..1021, 1265..1410, 2718..2848, 3504..3550
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved