Otolemur_garnettii Locus AGPAT9
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii AGPAT9
Otolemur_garnettii
AGPAT9
GeneScaffold_2496
SNORA72
26701..26832
48817
TTATTCATCCACTAGTTTCAATTTACTACTGAGTACATGTGATGCTTATTTTTTATTCT
TGTGATACTTTGCTTAGGAGAATGTCCTCCACATACAAAACATACAAAATCTCCATCTTT
TCATGGATAAACAGCCTTCCATGGCATACACGTACCACAGTTTATTAATCTATGCATGAG
TTGAAGAGTATTTGGGCTGTTTCTACATCTTTGTGACTATGAATTGAGCACAAATGTCCC
TATGGTAAAATGATTTTTTTTCTTTGGGGTAGATACCTAGTAATGGGGTTGCAGGATCAA
ATGGAAGGTCTATTTTTAGTTCTATGAGGAGTCTTCATACTTCTTTCCATAGAGGCTGTG
CTAGTTTGCAGTCCCACCAATAGTGCGTGAGTGTTCCCTTCTCTCCGCATCCACATTGGT
GTCTGTTGCTTTGGAACCTTGGGATGTGGGCTGGGTGATACTCAAAGCAGTTTTGATTTT
CATTTCTCTGAGAATCTCTGAGCATTTTTTCATGTGTTTCTTGGCTATCTGTCAGTTGTT
TTATCCTCACCTCCAGACATATTTCAAAATCCACAGGTCCTGTCTTCTGCGGCAATCACA
AATGCTTTGGAGGCTGGTGACAGCGGAGCTGGTGGGAGAGCCCAAAGAGGGCTTGTTGTC
TTCTTGCTCCACAGCCACTGAACCAGCACAAACACCATCCCAGATGAGCCCCCATGATTG
TTATTCAAACTGCAAGCAGGTTTCAGAGCAGGTTCAGTTACACCCTTCACAAAGATCCAG
TTATTGAAACAACAAAGATTCTTAAGGAAGAAAGTAATTTTTTAATGTGAAAGACATCTC
GTCTGAGAATGAGAGAAGCTACCTCTAGTCTGTCTCTTCTGGGGTATCTCTTTAGTTCAC
ATACTTCCAGGGATTAATGTTTAAATTCACTTCCGTGTAATCATTTTTTCTACATTGTAT
CTGAGGGATAGTTTAAATTGATATTTCTTGTTTTTGAACAGTGGGCCACGATACGAATTG
AAAAAGGAGCGCCAAAGGAGTCGGTTCTTAAAAACTCAGCTTCTGTTGGTAAGTCTTCCT
TTCCATAATGGTTGTTAAAATACTCAGATTGAGCTTACCCAGTTGGAACTTGAAATACGC
GGAGAGCAGTGTGTTCTAGAGGCCTTGGATCTCTCATAATTCTGTCCTTCATGCAAAATA
GAAGCTGCTTGAGTTTTGATTGACATTTTATTGTATAGGTGTGATGTGTATTAGTTCATC
TGTATGTTCTTGCAGGTATTACTTGCTTGTCTAAGGGTCTATTTTAAAGGTGGCTGCCCA
TAGTTTTTAAAGACTAGTCAATGCAAAAACAAACAAACAAAAAAGCTAATTAGAGTATCT
GGGAGTTAAAAGCTATTACTGAAGTTTCATAACACCTCATTTTAACTTCTAACTTGTGGT
TCTCAAAAAGCATGTTCCTCGAAGTGCTCTTTCTTGCTGGAGACCAATTGCTAATACATG
AAATAAAAATAATTTTCCAGTGAAATAGCTTGGGAATCATCACATACTATATTTTCCTTT
TGGGGAGAGCACTACTGCATAGTATTAAAGGTTTGGAAGAATCCTACAGTAAAGAAACAT
TCTTGATTTTACTTAATTTAGTGTTTCTTGAACTTGTTTGACCATGATAGCTTTTTTCCC
TCATGACACCTGTTCCCTTCCAGTAGAAGTGAGCTAACAAATGAATTAACCTAACCCATC
TCTGCCTCAATTTGTGTGCTTTGCCTTTGTTTGAATAAAGCCTTTCACTTGGGGAAGAAT
TTTGAGACTTAAGTCACTGGGTTTATAAGAGGCTAGACTTCCACAGTGATGATGGCTATG
TAGTAAGGAACAAATAAATCTCTAAATTTAATTAAAAGGCTAAGCCTCTTTGTGTTTTTC
AGAAATAGACACCATTTTGTGCTCATCTGATTTAGAATTGAAAATGGTCAAGCCATCAGA
TATTTCACTAGAAAGAATTTATGTTCTGGAGTCTTGTCTAAAAGGAATAGTAGAAATTGT
ATGCTACAGTGAGTTTTGGAAGAAAGGTATTTGACTGAAAACATCTGAGCATGGTTGTAA
AATTGGTTATTATCCTCAAATAATTGAAACAACTAGTAGAGCTTCATAGTATATATACTC
CCCTCAACGAACGCTCTTGCCAGTAGCATTACCAAGGTGGATATTTCAAGTTCTTCATTG
CCAGAAAATATAGAAATCTAATTTTTTAATTTTTCTGAGTACTTTTAAAAATGTGTGTCT
TTATGATTTAAAGTGAGAACAAATGTTTTGCTGGTTTCTGTTGTGCTTGGTGAGATTTTG
TGCTGTCAGATGGCACCTGTGGCTCAAAGAGTAGGGCGCCAGCCCCATATACTGGAGGTG
GCGGGTTTAAACCCAGCCCCGACTAAAAGGCTGCAAAATAAAAAAGATTTTGTGCTGTCA
TTCATTGATCTTGAGTGAAATTCTGTGGGCCTTATGGATTAGAATGGTTGTGGTCTTGGG
CCATGAATTTATTTATTTATTTTTGAAAGTGAGTCTCACTCTGTTGCCCTAGTCTAGAGT
GCCAGGGACATCATAGCTCATAGCAACCTCAATTCTTGGGCTCAAGACATTCTCTTGCCT
CAGCCTCCTACGTACCTGGGACTATAGGTGCCCTCCACAATGCCTGGCTAGTTCTCTTTT
TAGTAGAGGCAGAGTCTTGCTCTTGTTCAGGAGTCTTGAGCTCCTTAGCTTAAGAAATCC
ACATGACTTGCTTTGGAGCCCCAGAGTGCTAGGATTATAGGCATGAGCTCCTGCTCCTGG
CCATGGGCCATGAATTTAAAAGGGCACAAGGTATTTTAATTTGGTTTAAAGAAATTGGGT
TTAGGTGGATTTTTTTAAGCCTATGTGGAATTTAGAACTTAATGAATATTTTCACCTGTG
GGATTATTATTATTTGTCATACATTTGGCTTTTCTGTTTTTTATCTCTGTCTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGAGACAGTGAATCTAATAGCACAGATC
CCTTCTTCATGTAATAGAGAAACGGCATCCTTGTATCCCTTTGCGATCAATGGTATTCTC
TTGATTTAGGTGGGGGAAAATTGATAATGAATTCCAGAAGTTGTCCCTTAAGAGAACAAA
AATAAACACACACATCCCCCCCCCCCCAAAGGAGATTAAGATTGGACAGAGGGTATAGAC
TTTGGCTGTATGTAATTAATAACATTCGTCTACTTTGTAGAAACATGTGAAGTACTTAAA
GTCTTTGCAAGGTGTAAGTATGTGTGGCTTTTTTCCACGCTTGGAAAGCTTTTTGTTTAT
GGGTATCTCCGTCAGTGAATCATTCTTACCATCCTCCTCTTCTGCCTCTGTGATGATGTT
GGTACAGATCTGCTCAAATAGAGTCACATCCTCATCTTCACTGACTCGTGTCCAAATCAC
TGAATTTACATGCCAGTGTCTGCCCAACCCACAGGACCTTCCCACAGACAGATCCCAACA
TGTAGAGTGACCAGGGATTTCAGAATTCCAGCAGGCTCATAAATATGAGCCCACGAGGGC
TAATCGATAGAGAAACATGTGCATTGGGGTTTATGTGAAGGAGAGAAAAACAGGCACTTT
ATAATTGAGGAAGATAAAGGAACTAATATATATATATATATTCTCTTTTTGGGTAAAAAT
AAAAAAGGAGGGTATTGCTTTGCCATTCCACCCTTACCCCCACAGGACAAGCCACCCAGT
GTGGCGCTAGTGGAAGCCTGGTTTAATTTGAGGCGTTCAGAAATGTTATTTCATAAACTT
GGTCTTTTTTTGGTGATTGCTCAAAATCAGTTAAACCTATCCCTATATCATATAGTACGT
GGGATTGGTGGTTCATGAATTTCGAGGAAAGAAAGAAAAGAGAGAAATGTAGTTCTAAAA
GACAGGGTGATTTCAGGGAAAGGGCCCTGGGTGGAGGAAACTATGAGCCGAAAGGGGAGA
GGGTAAGGAGAGCCGAGGTTGTTGTCAGGTGCAAATAAGGCATTTAGGTTGTCTGGAGCT
GAAATGTGAGAGATGAGTTGGGTCAAAGGAGTTGAGATTGGCATTGCCGGTCACATCAAT
CCTGGAAAGACTCGAATTAGTGGCCGGCTAACTTATTATCTCCTCTAAGGAAAAGAGGCA
GAGTTTGGAAAGAAGGAATCGGCACTTTGGGGGAAAGAGTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCATGCCTGAGTAGCCAGGACTTGCGGGGTGTGTGCCCT
GTTGATGGATGCTGTGTTGGTGTCGAGTCATCAGAGAAATGGTGTCACAATCCTGACAGA
GGGTGATGAAACTGCGCACTGGTACATGTGGCTGGTGCAATCTCCAGTCTTCTGAGCATC
ATGTCTGGGTACCACTGCCAGTGGCAGCGCAAGTCAGCGTGCAGCCAGTCAGAGTGTACG
TGAGGGTCGCAGACAGGCGGAGGGCCCCAGGAGCACGGGCACGATTGTGAGTTATTTCTG
AATGACGTGGTTCTGATAATAGATTTGGGGTTGCTGAGAGGGAGAGATGAGCTAAATAGA
GAAAATAGTTATGTTTATATTCTGCACCAAAAAACTTCCTTCTACTACTCTTTTACTCAC
TGAAACACATTCTTTGAATTGCACTTCAGGCCTCTCTCTTTTTTTTTGAGACAGAGTCTC
ACTATGTTGCCCTCGCTAGAATGCTATGGCATCACAGCTGACAGCAACCTCAACTTTTGG
GCTTAAGTGATTCTCTTGCCTCAGGCTCCCGAGTAGCTGGGACTACAGGTGCCCGCCACA
ATGCCTGGCTATTTTTTGGTTGCAGATGTCATTGTTGTTTAGCAGGCCTGGGCTGGGTTC
AAACCCTCCAGCCTTGGTATATGTGGCCTGCATCCTAATCACTGAGCTACGGCCCCAGAG
CCATCTAATGTGCTTTTTTTGAATAAGCCGACTGAGAGCTGAGCCTAGGGGACTAGGCTA
TGGTTAAATGATTCTCTTCTGTCTTAAGCCAGAGTCTACCATTCTACTCTGCTCTTTTAT
TTAAAAGCTGTTTAATTTATTGAGCTTCAGGTATGATCATGAATAAGAGCTTGTTAAGAA
GTCCTAACATTGCACCTTCCTCTTCCAGGCTTACGGGCTTTTCCTCATGATAATACAAAC
ATGAAGATAAATATTTTCTTCCCCTTTAAGTAACTGTGTTATGCTGGCCATTAAACTTCA
GGGGAGAATACAGAGTTACCTTTCTATCCTAGTTTGGTTCCCCAAAAGGAGATGAGCCAG
AGCTGTGAGTAAGAAGGCTAAGAGGAAAGAGAAGGGCAGGGGCTGGGTTGCTTCTTTTCA
TGGCTGAGCTTTTACTGCCCCAGCCATAGGACAAATGCATCTCCTTGACTTTGGGACTTG
GTGTGACTGAGATCTCAGCAACTTTTATTTTAGTTTCTTCTACGGACAAACGATCACTGC
TGAAAACTGCAGCCTATTCTTTAAGTACCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTTTTTTTGTTTTTTGAGATAGAGTCTCACTCTGTCACCCTGGGTAG
AGTGCTCTGGAGTTACAGCTCACAGCAACCTCAAACTCTTGTGCAAGTTCCTCTTGCCTC
AGCCTCCAAGTAGCTGGGACTACAGGTGCCTGGCACAATGGGCTGGCTGATTTTTCTATG
TTTAGTAGAGGTGGGGTCTCACTCTTGCTAAGGCTAGTCTTGAACTCCTGAGGTCAAGCT
ATCCACCTGCCTTGGCCTTCCAGAGTACTAGGATTATAGGCTTGAGCCACTGTGCCTGGC
TTATGCTAGGTTTTTTTTTATGTTAGGTTCGAATCAGTTAATAGTTTTGATTGTAAATAA
TTATGTAATCTTAGTGAGTCAAGATGAATTCCACTCTGATTGTATTTTGATGGTAGGACA
TTTGGAGTGATGACCAACCTGCATTTACCTGAGAGTGAGTCATACACATGACAAACCCAG
AGAGGCTGTGGCTCATCTTTGTGGCGTTCCCTCAGAGTGTGTTGCTGGTCTGACTCAGCA
CTGTTGGCCACAGAGTGTGCAGGATCCACAGCCCTCCAAGCCCTCCACACTGCTCTGCCC
CACAGGTACCCACACTCAAGGTTGTGGTCACACGGCCTGCTGTGAATTTAGCCCCTTTGC
CACATTTCTCTTCTACCTTGTATCTCATGTCCCTCCAGCCCCTTCACCCATCCAAACACT
CGAAAAGGACAGAATGCTAAGGAGAAACCTCTGTGGTTGTACCTATTCAGGAAGAACTCA
GATTGCCTGATTTTTCTTTTAATTTTACTCTTGAAATTTTTTTTGCAAGGCATTTGACTA
ACCATGTTAATATCCCATATACATTGGATTATGTCAACATTAATAAAATCTTCAACATTC
ACAGAAAAGTGGGGGGATTGTCTTTTGGGACTGAAATTTGGGGAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCTTTTTTCCTTCTTCCTTTTTTCCCCCTCCTCTCCCCTCCCTTTTCCTTTTT
TTCCCTTCCCTGTTGAGACAGGTCCCCTTCTTTTACCCAGGCTGGAGTGCAGTGGCCTAA
TTATAGCTCACTGCAACCTCAACTCCTGGGCTCCAGTGATTCCCCTGCCTTGACCTCCCA
AGTAGCCAGGACTTTGGGTGTGAGCCACTGTACCCCATTAATTTTTTTTATGTTTTGTAG
AGATGGGGGTCTCTGTATGTAGCTTAGGCTGGTATTAAACTCCTGGGCTCAAGTGATCCT
TCTGCCTAGGCCTCCCAAAGTACTAGGATTGCAGGCATGAGCTACCATGCCCAGTCCAAA
CTTAATAATTTCTTAATATCATCTAATACACAGTCTATATTTAGATTTCCCGAATAGTTT
TATAACTGATTTATTTGAATTGAGATTCAGTCATGGTCCATGATAATGTTTATTTATTTT
TCCATTGCTTTAATTGGAAATTTGGAAGGTATTGTGAGGGCAGATATACAATTTTTGTTT
TTAGAACAAAAATTACTTAATAGCAAGTGATTCTGAGAAATGAATCTAATAAGAATATTT
ACCATTTGATCAAAGAAACCACACATGAATGCCAAACCATATGGTTGACATTTTCATTGA
ATTGATGGGCTCATTTAACAATGGGTTTTATGAGTGCTTCGGTGTTATGGGAATTCTTGT
TTAATGAAATTAGCTATGTTAAATCAACAGAGTTAATGTGCCTGTCAGCCAAGGCATGGG
TCAACAGTATACTGAGTAGGTGGTTAAAGTGTTAATTGTTAAAATGGAATTCTGCCTGTT
ATTTTCAATGCCTCTGGTTTCTCTGTAGTATTAACTGACAACTGATTGCAGTGTCCACAA
CTCCTCTCTCCATTTGTTCTAAAACACATAGGTAATTCCATGATTAAATTTATATGTGGG
GGATAATATCTTCCCATTTTATAGTCAGTATTAATGATTTATAAGTTTTTGAAGAATTAC
TAGAGTATACCATAATGAAGAAAAAGGGAATAGATTTTCTCATCCACCTGTTTCAACACA
AAAAGTAAATTTCTAGTACTTCTAGTATAATGTTTGGGCTGCTGTAACAAAATACCATAG
ACTGGATGGCTTATAAGCAATAGAAATTTATTTTTCATGGTTCTAGAGGCTGAGAAGTCC
TAGATCAAGGTACCATTTCCTGGAATGTAGAGGGCTTCTGTGATCACCTCACATGTCAGG
AGGGATGAGGGATCTCTCCAAGATTTTCTGGGACCTCTCTTATAAGGGCACTTATCCCAC
TCATGATGGCTCCACCTTTCTTACCTTATTACCTCCCAAAGGCCCCGTGACCAACTACCC
TCACATTGGGGATTAGGCTACAAAATATGACTTTTGGAGGAACACAAATGTTTAGTCTAG
AGTAATAATTTTAATCTTGATAACAGAGAGATACTTACAGAATATTACAATGAAAGGGGG
AGTCAAGTTATTCTATTACAGATATGCAAACTATGAGGGACCTTTATTTCATTAAAGCTG
TTGATTCTATTCTAAGCCTAAATCTCAGGGTTGTCAACAGATCCATTCTGTTGCCTGTTC
CTCTGCCAAGACCCTGGCAAAAATCATGAGTTGACATCTTTGCCGCTGGACTGAGATGTG
GCCTCAGAACTCCTCCTTCCCACAATCTAGCGTATAGCTACTCATGACTCACCGTACCAC
CCTGATCTGGAGAATAGATAGGGGCTCTTATGCTGGAGAGCAGAGGTCACTAAGTGAAAG
GGGGAAACTTGTTGAGTAATTGGGTTTGGCATGGATTTGGTTTTTTGGATTGAGGTTGTA
TTGATGACAGTTGCACATAATTGAAAGTGCAATAAAGTTGATCAAATGCTCTTAGAGTTT
TAAGCAACTTAGGCAACAGGATAGATTTTAAAGTAATCTTGATAGTTTTGATGAATGAGC
CATCAGAAAGCAACTTGGTTTAGGGTTGTTTACCCAAAGATGTTGCTCTAAAACGGGATA
GAAAAACCAGGCCTGGTTGCATGAGAAAGCTTGCCCCAGAACGACAGAGGCAGAGTTTTT
GACAAACGGTGAAACGCAGAGCCTAAAAAGCTGCTCTGGTGTGGCAACCTCAGAGCAGGG
TGCCAGAAGCTCCTGTACGGACTTTCCTGGGCCGGCTGCCGGTTTCCCTGCTTCTCTTCC
TCAAAGCTCTGTTTTCCTGCAGCTTTGCTGGCTAGAGAAGAGCTTTGATCTCTTGCAGGC
TTTTTCAGTTTCTGTAAGATTCCTCAGGGAGCAGAACCAGTAGACCCTGACATCTCCTAT
AATGTCTGGGAGACAGTTGGGAGTGAGGTCAAGAAGCAAGAGTAGGATGTGGCCTGCTTT
TTACCTCTGGAGCCAGGGTGCTCCTCTCTGGGGCTGACTGGCCTTGTCTCCCTGCCCCTC
TGGGATGGTGCTCTGGGCAGCCTGCTCTGCTTATTTCAGCTGGGAAGGTGAGGAGGGGGA
GAACCCCCGAAGCACCAGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGTTCTAAAAGACAG
GGTGATTTCAGGGAAGGGTCCCTGGGTGGAGGAACTATGAGCGAAGGGGAGAGGTTAGGA
GAGCCGAGGTGGTGTCAGGTGCCAAATAATGGATTTAGTTTGGCTGGAGCTGGAATGGGT
AGAGATGAGTTGGGGTGAAAGGAGTTGAGATTGGATATGCAGGGTTACATCAAATCCTGA
AAGACTCTGAGTAAATGTCAGGCTAACATATTAACTCCTCAGAGGAGAAGAGGTCAGAGT
TTGAGAAGATGAATCTGGCAGTTTGGTGGAAGTGGGATTCAGTACGAAGAAGGTGGAGGA
AGGGGAGAAGGAGGGCATGCAGGTGTCACCCCCATAGCTTCACCAGTGGGGAAGTGTATG
TTTAACTTTTGGATTTATGCCGATCTGATAGGCAAGAAGGGGAAACTCAACTTAGTCTTC
ATTTCCATTTCTCTTATAAAGAGTGTGAGTTTGTACACGTTTTCATGTCAAAGGGCCAAT
CCTGTTTGTTCTTCTGGGAACTGTATACTAATATCTTTTGACTATTATTCTACCAGGCTG
TTCTGTTTCTTTGTTTTCTTAGGACGTTTTCATATATTAAGATGATTCGCTTTTGTCTGT
GCTGAGATATTATAAATATTTCTTTCATTTTGCAATTTTTATTTTTTTCCTTTGCTTATC
TTTTTTTTTTTTTTCTTGAGACAGAGTCTCAAGCTGTCACCCTGGGGAGAGTGCCATGGT
GTCATCAGAGCTCACAGCAACCTCAAATTCTAGGGCTCAAGTAATCGTCTTGCCTCAGTT
TTTCTATTTTTAGTAGAGATAGGGTCTTGCTCTCCTTANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAAATG
ACATTTTAAAAGACACATAGTACGCAGTTCATTCAGGCAGGAGTTATCAATAGATGATGG
TAATGTCATGGGTGAAAGTTTGAATATCTAAAGTTTGATATCCTAAATATCTACTGGGAA
CAGAATATTTACATGGTCTCAGAGTATATTCCTTTTGTGAATGCTTACCGATTGTAACTA
CTTCCTAATCATAGGAAAATGCCAGTTTTACATGGAGAATCCTGGAAGCATCACCTTAAA
CTAAGAGATCAGATTTACACATTACCAATCATGGGACCAACCAATATCATGTGCCTCCCG
ATGTGATGTACCAAGAAGGACACAATATCACTTACATGCATCCACTCATGAAGAAATGTT
AGATAAAGCCAAATTAAGAGATATTCTGCAAATATATGGTTTGCACTTAAAAAGTCAATA
TCTTAAAAGACAAAGGAAGGCTGAGGAACTTTTTCATGTTTGAGGAAACTGAAAAGACTT
GATGTATAAACATAAGGTCTAATCCTGGGTTGAGCCCTGGGCCAGGAAAAAAATTGCTTT
CTATTATTGGGACATTTGTCAACATTGGAATAAGGTCTATAGATTAGACCACTAATATAT
TGCCTTAATGTCAGCCTCCTTGATTTTGGTAATTGTGGAGTAGTTAAATAAGTGAATGTC
TGTGTTTGAAGGAAACATATCTGAAATATTTGGGGGTAAAGGGCATGATGTCTACAATGT
ATTCCAAGTGGTTCAGAAAAAAATACTCTTTCATAGACATAGATATAGAAGAATAAAACA
AATGTAGCAGAATATTGGCAGTTAGCAAATCTACATGAAGTGACCTATTGTTTCACCTTT
TCTATATATTAGAAATTATTAGAAAAACATCTTTCTGAATTATACCTGGGAATAGAATTG
TTGGGATCTGAAGTCTTTGAATTCAGTAGACAGCACCGAATTGTTTTCCAGCATACCTGT
GCTAATTACATCCCTAAGTTCTGTGTCTTCACCAACACTTGATAGTTGAAATTTTGATCA
ATCTTATGGATATGAAGTAGCATTTCATTGCGGTTTTAGTTTGCATTTCTCTGATTATGG
CAAGTGTGAACATCTTTTCAAATGCTTAGTCATTAAGGCTGCTCTTTTCTGAATTACTTG
CCATTTTCTTAGCCATTTTTTAATAGTATTCTTTGATATTTTCCTGTTTTTTGTGTGTCT
AAATATTCTTGGAATTAATGCTTTGTTAACTCTATGCATTGCTTTTATCCATGTACTTTT
GAAACATGCTTAACCAAAATAAAAAATTGAGTTATACTTGGAGTCATTCAGAATTCAGTA
GGTAAGGGGGCAGAGAACGTATTACACATCAAGTATGTAGGGGCGGAGGGCTGGCTTCTG
TTTGCAGATCTCTTTTTTCTCATCTCTGTTTGATATGGGGCAACTTGAGCTTGCATCCTT
ATCTCTGGCCCTTCTAAAAAAGATTTTAAGAAGGGCTGTCTGTTGTCCCTAGTGTATTTC
CTTTAGAGATGTACTGAAGAATTTACTCTTCCCTATTGCTCTAGACATAAAAAAATCTGA
AATCTGTGTATTGCTAAATAATGAAACTCTTGCACTGCTAAATGTTGGCCAGCGCTTGGA
TTGAGTAAGCTTCCCTGAGTGGTGTTGCAGGACCTGCAGAGATAATCCACAGGGACGTTA
TCTTGGTTCATCTTCTAACACTAATTAAGCCAGTTATGGAAGATGGTGAAGAAAGGTTAA
ATCTCATAGACTTGACTTCTGAAAAAGATAACCTAATGATTATTTAAGAACTTATTTTAG
GGGTGGCGTTCCTAGCTTAGTGGGTAGGGCGCTGGCCACATATACCAAGGCTGGTGGGTT
TGAACCAGGCCCAGGGCCTATTAAAACAATGACAATTGCAACAACAAAAACACCAACAAA
ATAGCTGGGTGTTGTGGCAGGCACCAGTAGTCCCAGCTGCTCTGGAGGCTGAGATAAGAG
AATCACTTAAGCCCAAGAGTTTGAGGTTGCTGTGAGCTGTGATGCTATGGCACTCTACCG
AGGGTGACAGCTTGAGATTCTGTCTCAAACAAACAAACAAGAAAACCAAACTTATTTTAG
CACTCTTAATTCTTATGGTATTTAGATATTAGCTTTGGATGTGGGGCAAAAATAAGCAAT
CTTGTCCTCACCAAACCCCCCCAAACTTAAAATCACAAATTGTTAGCTTATTTATTTATT
TATTTAGAGAGAGGGTTTGGCGCTGTTGTTCAGACTGGAGTGCAGCAGTGAGATTATAGC
TCATTACTGCCTAGAATTCCTGGGTTCAGGAATCCTTCCCGGCATGTATCACTGTGCCTG
GCTAGTTAAAATTTTTTTTTTGTATAGATGGGTGGGGACGGGGGAATGTCTCAGTATTGC
CTAGGTTGGTCTTGAACTCCTGGCCTCAGGTGATCTTCCTACCTCAGCCTCGCAAAGTGC
TGGGGTTACAGACCTGAGCCACCATACCCAGCCAGTCTCTCCGTTTATAAAAGACACCAG
TCATGGAGTTGGTGGTTATCCTCAACAGAACTTGACTTTCCACTCCAGATTCTCTTTCCT
TTCCCCTCCAGTATATTATTATTTCTTGAAAAAGCCAAAACCCCTGAAATATTACAGCTC
ATTCTACTGATGCACAGAAAAGTTCTCCATGGATAGACAGCACGAAGGACAGCACAACAC
TCACCACTTTCTTCCCTGATTTCCTAGTAAGCTAAAAAGTGAGGAGATCAAGGGATCCTC
TTTCAGGGAATTTAGTGTCTTCATCTCTACCTCAAAAGAAACAATTTTTTGTCATTTAAT
GTTATTAGTAAATTCCTTTGTGACACACCCCAAAGGAACAGATGGATGGTCACGTGACTG
TGCATTTAGCTACTCCTTATTCTTTGAAGATTTTCTCATTTATTATTCATATCTAAATGG
CAAGAACTGGGTGGCAGTAGTCTTTTTTCTTTTCTTTTTGCAGTTTTTGGCTGGGGCTGG
GTTTGAACTGCCACCTCCGGCATATGGGGCCGGAGCCCTACTCCTTTGAGCCACAGGCGC
CACCCATCTTTTTTCTTTAAATATAAAAGTATAAGTTTATTGTATATTAGAGGGAAGAGG
CGAGTGAAGAGATGAAAAAGAGAGAAGGGAGCAGAGAGCAGGGAGTGAGAGGGGAAGATC
GTCATTTTTTAATTTATAAAAATTATGCTGCTTTAAAAGTCTTTGAGTTATTTTCTTTAT
GGAAAATATAATAACAGTATAATGAGGGAAATATAATCCTGTTACCCAGAGACAATTACT
TGATGTTTTCTTCTTGGTATTTTTACTATATGGATGCACTTCATAAAGTTAAACTGTAGC
TTTAGATTTTGTCTTTTCTTGCTTGATGTTAGAGTATTTACAGGGGATGCATCAGATATT
GTCATCCGGATCAATTATAATGAAGAATGCTGCAGCGACCACCCTTGCATACATTTCTAA
TTATTTTCTTATGTTAGATTTCTAGTTAGAATTATTGATTATCAGCAAAACTACATTTGG
TCTTTTCATGTCAAACTGATTTTGACAAAGTTGCCTCTAGGTCCACACTTGTACAGGTTG
GCTATGAGAGTACCTCTGCCATTTCCGTCATTACACAAAAACATTGCCTGTTTGTTAATG
TTACTGGGCTAATCGTTGTCTAATTTATAACTTATTACTAGGGAAAAAGTTTTAACTTAT
GTTGCGTCTATGTACTTTGCTTACTTTTCTGAAGGAACCTGCATTTTTCTTATTAGTTTT
TATATATTGAAAAATCAATTTATGCCATTGTGCGTGATTAATTTTTTTTTTTAAATCAGG
GAGATCAGAATCTGTTTTTACACAGTGTATTAAAAAATCCCCAATCTATACTTGGGAAGA
GGTCATTTCTGTGAGTTCTTTTCCTAATGGGACGTAGGGAGGAAATCCAAGCAAAAGAGT
TACAAAGGACCCAAGTTCCTCAGTAATGATGGAAACCTTTGGGTGGAGTGGTGTCACGCA
GACAGCGGTTTCTTCTCCCTTCCCGCTGCCTCTGTTGATCTCTCCCCTGAAATCTGCCTC
GTGTTACCTGTTAAACTTGCTTGTCTCATGTGTTCCGCACAGTTAAAGTTGCCCCTTTGG
TCACTGTCCCTCTGTCCTCTATGGAATTTTCTCATGTTGTGATGCTTTCTTTTAAGGTAT
TATCCAAAGAGATGAGTCACCCATGGAAAAAGGGCTGTCTGGTCTGCGAGGAAGGGACTT
TGAGCTGTCTGACGTGTTTTATTTCTCCAAGAAGGGATTGGAAGCCATTGTGGAAGATGA
AGTGACCCAGAGGTTTTCCTCAGAGGAGCTGGTGTCATGGAATCTCCTCACAAGAACCAA
TATAAATTTCCACTACATCAGTCTAAGGCTCACTATGGTGTGGGTGCTGGGCGTCATAGT
GCGCTACTGTGTCCTACTGCCTCTGAGGTAAGTCCCGGCCCGTAACTCGACCAGGTCATC
AGCTCAACTTTCTTTTTTAATCGTGCGTAAAGGCCACATGGGAGCACTGTGGTCCTGATT
CCGCGTTTTCCCATTTAGGGAACGCCACCAAGCATGACCTCTGCAGGAATGTATTAAGTA
TCTATTCTCCTTTCACATCTTTTCCTTAATAAAGAGGTGTGTTCAGAATCCAAAACATGT
CTTATAATCTGGATCCACTTTGCTACTGCAGTCATAGATAATTTGAGGATGGATAGACAG
GGAAGTTAGAAAAAGAAGGCAGAGAGATGATTAACAGTTTCCCCTTCACCCCGTGTCAGC
CAGACTACAGTGGCTGACCAGAACGCACTGTCCCCCTTTGCTGGTCTGTAACAATTCTTA
GCTGCATAGGAGGGAGAAAATTCCTGAGAGTGATGCCACGTGGAGAGAGCTATTCAGAAG
TGCATCTGTTCCGTCTGACTTCATTGTGATCGCCGGCTTCTCATCCTATTAGTTCCTCGC
CTGTGTCTCCTTCCTCTGAGCTGGAGTGCCGCCTGATGAGGAAGCCATTTGAAGCCCAGT
TTCGTGGAAGCACAGTGTGGCCCTTGAGTAGAAGACACTGGGCTGTGGGATGAACCCGGC
TGAGATCAGTCTAGCGTGGTGGTGGTGGTAGCAGACATGGGGACCAGCCGCGACATCATT
GTTGGTTGTCTCCCTGGACATGGCCTTGGTGTCCTCTCCACGGAGCTCTCCAGGCACTTG
CTACCAGACAAACAAAATTGGCACATGAGTTGAAACCTCTTAACTGTCCCAAGGGTGTCC
TTTCCTTTCCTCATCCAGATTTATTACAAGGGAAAGCATTGCTTAAGTATAGGCAAATGC
ACATTTCCAAGAAGTTCTTTTGCTCATGTTCTCAGTCCAGATACTGGGGCATGGTATGTC
TTTTGGGGATTATTTCACTTGTGATTAACAAAGCAAAAGACAAGGTTTCACATACACTTT
TCCTTAGACTTTATCTACTGTTCCCAAAGTGGGGTTCATGCACTCTGGGAATGCACAAGA
CTATTCACCACTGTGCAGGAAGGAAATGTTAGAGCTTCTATTTGTTAAACACTTATATCC
TGTTCATAATTAGAACATCCATTTATTCTGTTTTTATTTTTGAAAAGAAACGAAACTTTA
GTAAATATGTGGATCGGTTCTTGCATCCTCACCTGGCCATGGATCAGACACTGTATCCAA
GGTAACCTGAGGGGAGAGTGAGGATTACTCTGAGGGTGACACAGAGTGCTATTGGTTAGC
TTTCACCATGTTGTCCAGAAAATAGGGGTTATGATACCATCGTCTAGTTTTAACTAAATT
AATAATGCTCACAAAATAGATAAGTGGCATAAAAGATTTTTGCAAAGACACCACAAATTG
TGGATAATCTAGTAACATAAGCATCCACTGCTTCTTAGCCTTTTGGCTAAGATTAAGTAT
GGTAATGCATCTAAGAACAAAAAGAAATTTAAAAAGTTAAGACTTGTATTCTTAGTGCAT
ATTAAGAGTATGAAACAGGCTTGGCACCCATAGCTTAGTGATTAGGACTCTGGCCACATA
CACCAGTGCTGGTGGGTTTGAACCTGGCCTGGGCCTGCTAAACAATAATGACAACTGCAA
CAAAAAAATAGCTGGGCATGTGGGCAGGTGCCTATAGTCCCAGCTACTTGGGAGGCTAAG
GCAAGAGAATTTCTTAAGCTCAATGAGCTGTGATGCCACAGTACTCTATTGAGGGCAACA
TAGTGAAACTCTGTCTCAAAAAAACAAAACAAAAGAAAATTTAAAAAATAATAATATGAA
GCAATTTTCTGTCCTGTTAATGTAGTAAATAAAAAATTTTGATAGTTTTGAACCAAATCC
TTAAACATGTTCAAATGCCACCCCCTCTGATTTAGTATGTAGGAACCAGTGATTCTTATT
AGGACAAGATGGAGAACTGTTCATTGACTCTCACTGGATAAAAGATTTAAAATTAAGACA
TGAAACAAGAAAAATTTTAGAAGAGAGTGTGGGGAAAATATTTGACAAAATTGGCCTGGG
AAAAGATTTTATGAATAAGACCCCCTTGGCCATTGCAGCAATGCCAGAAATAAATAAATG
GGACATGATCAAGCTAAAAAGCTTCTGCACAGCTAAGGGCATCACAACTAAAGCAAACAG
GTGGTCTTCAGAATGGCAGAAGATATTTGCATGCTATGAATCTGACAAAGGGCTGATAAC
TAGAATCTACAGAGAACTCAAATCAACAAGAAAAGAGCAAACAACCCCATTTATAAGTGG
GCAAGAGACTTGAACAGAAACTTTTCTGAAGATTGCCAATAAATGAAATGGCCAAAAAAC
ACATGAAAAAAATGCTCATCATCCCTAATCATCACAGAAGTGCAAATGAAAACCACCCTG
AGTGCAAATATTCTCGCTGTTCTGATTTTATAATAATCAGCACAGGCTAAACATTTGCTA
TATAAAAACCAGGCATGTGTCCCCAGACCTAGTTCTTTTCCTAGGTTTGGTTTTATAAAT
GCTGTTGATAAACAAAAAACAAACAAACAAAATAAAGACCAACATGAGGAAGAGGAAGAT
TTGCTCTCTACTAAAAACAGAAAAATTAGACCTGTGGTGTGGTTGGCCCCAGTGTTGCCA
TCCATTTGGGAGGCTGATACAGAAGGTAAGCTGATGCCACAGCACCCTATCCTGGGCAGT
GGGGAGGGAGATTCTGTCTCCAAAAAGAAGTGTGAGAAATGCCATCTAGTTAAATTTCCT
AAAATATTTTAAAAAATAGACTCTAGATTATTTTGCGAAAATGTTTATTATAAATACGAT
AAAGGAATTTTACAAAAAAATTTTTACAAAATTAGGGAAAGAATTTTCAGCTTATAATAT
GAAGCAATACACCATGGTTTATTTCTGAGTTTAATGATAAAATTATCAATAATATATTAA
AAAAAAAGAAAGAAAACCACCCTGAGATATCACCTAACTCTAGTAAGATTAGCCCACGTC
ACAATCTCTTAAATCTGCAGATGCTGGCATGGATGTGGAGAGAAGGGAACATTTTTTACA
TTACTGCTGGGATTGCAGACTAATATAACCTCTATAGAAAGAAGTATGGAGAATTCTCAA
AGACCTGAAAGTTGACCTTCCATTTGCTCCCTCAATCCCATTACTAGCTATTGATTCAGA
AGAAAAAATTCATTTTACCATGGGGATGTTTGCACTAGAATGTTTATTGTAGCTCAATTC
ACAATTGCCAAGATGTAAAAGCAACTCAAGTGCCAATCAACCCATGAATATATCAACAAA
CTGTGGTATATGTATACCATGGAATACTATTCAGTCATAAGAAAACATGGAAACCGTACA
TCTTTTGGGTTTACCTGGATGGAGTTGAAACACATTCTTCTTAGTAAAGTATCGCGAGAA
TGGAAAAGCAAGTTTCCAATGTACTCAGCACTAATATGAAACAACACACCCACACAAAAG
AAAAAACACAAGTATAGTCTAGCAAGAGGGAGGGGAGAGGAGGGAAAGAGGAGGGGAGAG
GAAGAAGGGATATTGGCAAGTTCTCACCAAATGTGCACAATTTGAGGGTATTCAACATGC
CTCTTGGGTGAAGGGCTCAACTACAACTTGACCTTTACATTGGAATTGAAAACAATGTAC
ATAAACATTTGTATCATCATATTAATCTGAAATTTAACAAGAAGAAGAAAGTTTGCATAA
TTGATGGATGAGATTAAAAAGTGATTTAGTTATTGCATTAGTGATGACATGAACATATAG
AGTCTAAAGAATCTAATATTCAAATTACTGTGTCAAAAGATGTTAAACAAAGAGTTAACA
TCTTTTGTTAAACAAGATTTAACATCTTATTAAGATATTTATGCAGATGTATATTCCAAA
AGCTTTATTCTCATTCAAAATATAGTTAATAACAATTATATTAACATCTATTACTACATT
ATATTACTTAAATTATAATTATATAATTAGTAATATGATTATATCGATTATAGAATCATA
AAATTATATTTGTTGGTATGTAATAATATATTTTTGATTATATTTTGAATGAGGACAAAA
TATTTTGCAACATCAATGTATATACTTTTATTTATTTTTGAGATGGAGTCTCACTATGTT
GCCCAGACTGGACTTGAACTCCTGAACTTCAGAGATCCTCCTGTCCCATCCTCCCAAGTA
GCTGGGATTATGGGTGTGTGCCACTGTGCCCAGCTTAATGTATATAATTTTAAAATACTA
TACTTTAAAAAATAAAAACATTTATAAATTTTTCAAAAACCTTTTTTTTTGAGACAGAGT
CTCACTTTGTCACTCACAGTGGTATCACAGCTCACAGCAACATCAAGCTCTTGGGCTCAA
GTGATTCTCTTGCCTCCCAAGTAGCTGGGACTACTGGCCCCCACCACAACGCTTGGCTAT
TTTTTAAAGACGGGGTTTTGCACTTGCTCAGGCTGGTCTCAAACCTGTGAGCTCAGGCAA
TCTACCCGCTTCAGCCTCCCAGAGTGCTATGATTACAGGTGTGAGCCAATGTGCTTGGCC
TAAAAACTTTTTTATATTCTTCATGTTTACAATTTTTTTTCAATATCAGTACAGCAGTGT
ATGTATTTCGCTCTAAACATATTGGGGGTATATTCTCAGATGTATTATTAATGGGGTGTT
TCTCCAACTGGGTTGAGACCCCTGTCTTATTTTTTTGCATTACAAAATGCAAAACTGCTG
TGTTAACCATCATCATCATCTTGAATAACAGTTTCAGAATAATATATGTAATATGATACT
ATTTTCAGAATAACAGTAAACACACACGTGTAAATAGTCTATCTATGCACAGAAAGGAGA
CTACCAATGTTTAGTAGCCTGGATCCTGTACTCAGACTGCCTGAGTTGAAATCCTGGCTC
TGCTGCTTACTGGCTGTGTAACCTTTTCATGCCTCAGTTTCTTCATCTGTAGAATAGGGA
TGATGATGATAATATTACTGTCTCATAAAGTTTTGGGGATGATTAAATGTTAAATATGAA
AAGTACTTAGAATATTGCCTAGTATATAGTGTTAGCTGTTGTTTTATCATCATCTAATAT
AAAACCTGAGATTGGTTAAGATAAACTGGTTTGTGCTCCAAGTGTCTGGTCAGGAGGTAA
AGATTGCTATATGTCAGGAGTCAGCCAGCTTGACCCTGGAGAGTGTTGCTGTTCCTGCCC
GTTGACCTCAGGCAGCCACTTGCAGCTTCCCCAAATCCACAGGATCCTTCTGATGCTGCA
CTGGGCCTCCTTCCAGTCGGCTGCTGAATAAACACCCCTCTCATCCACCAAAATGGGGTA
ATGCTCTTCAGAGAACTGAAGACACAGGTCTGGTTTGATGTGAGAGGGCAGTGAGATAAC
CCACAGCCTCTGCCTTTGCCATTTGACAAAGTAAAATGATTTCAAGAACCTTAGACATAA
TTACACCATTGATTTTTCCTCACTTTTAACTACATCCCATTTTCTTTAAAGACTTAAATA
TTAATCCTTTTTTTGAGTAGTTCTATTTGTATTTCTAAAAGTTAGTATTTTCCTTTTGAA
GACATTGGAATATATATTAAAAATACTTTCCAAAAATGAGAAAATGTTTCTACAGAGATT
AGAGGTAATGTCAGTTACCTTGTTGCTAGTTTCTAAGTTATCTTGAACCCTGCAAAAAGA
CAACAGATTTGCATTGAAGGATTTCTGCCTGGTGATACATTTTGTATATCTCCTTCACGA
GCCCTCTAAACCCTTTGAGGATTATACAGGTTTAACTCAAGAGTTTTATGAACAAATTTC
CAGGCCCTCTCTGTGCATATGTAGACTAATTACACATATGTGCTTATTGTTACTGTGAAA
ATGCTATCATACTTCATATATTATTCTGAAACTACTTTTTTTCCCCCTCAAAATATGTCA
GGAACATTCTTCCATGTCAGAATTCATAGATTTACCAAATTCTTTTGATGGTTGCATCAT
TATTCCATAACGTGGACACCCTACAACTTATTTACAACTTCATCATGTATGAACTTTGAG
GTTACTTTGAGTAACTTTTACCTTTTCTTTTTCTTTTTTATAGGGTTACTTTGGCTTTTA
TTGGGATCAGTTTGCTGGTTATAGGAACCACACTGGTTGGGCAGCTGCCGGACAGCAGGT
GAAACGTTTTCTTCCATCCAGTGTAATAAGTAGGACTGTCCTTTTTCTTAGCTGTGTCCA
CAAAGAGAATATTTGTTTGATTCTTACATATCGTGTTATATTTCTGGTCTCAGTCCCCTA
ATTAGCATTCTGCTCACTTTGTCTTCATAGTCTTTGATTTTCTATCATTTATACTGCCAT
ATAAATTGAAATTAGTTGTTTTTCCAAAGGAGAAATGAAAGGAAGAAAGAAAATGAACTG
AGAAGCCCAAAGGAAAGAGAGAGTCTTACGTTTGGCAGATTCCTGAGACCAAAAGCAGAG
AAGCTTCAGTGTCAGGGATTTATCGTAATAGTGTAGTAGGGTAGGAGCTACTTTCCATTA
GAGTTATGTCCCATTCTCCTGGTAAACTTTTGTCATCTAATAATAAATGCTTCCAGGAGA
CTGTAAGAATTGACCGGTGCTTCTTCCTCAGAATGGAACATAGAATGCTGATGTGAAAGA
GCCCGTTAGAGCTGGTATTGTATTGTTTCTTACGAGTGCTCAGAACTACACAAAAAAACA
TTTTATTTTTTTCCTTTAGTTTCAAAAACTGGCTGAGTGAACTGGTCCATCTGACTTGCT
GCCGAATCTGTGTGCGAGCCCTCTCTGGCACCATTCATTATCACAACAAGTGAGTGTCTG
CTGGCCCCTGGCCTGCCTTTCTCTAGGTAAATCCAGCTTGAGGTTGACAGGAGAGCTTGG
GAAGTGAGTAGGAGGAAGTAGGTGGAGCCAGAGTATTTCCAGGGTTCATCCCTGCTTCTG
AGGGTGTCACGTAAGGCACAGAAATACTTACTGGACAGTGGTCTGTTTGCAAAAGGAAGG
TAGTAATAAGCATATGGTTGTGCTTAGTGAGTCTACGGTGTACAGGCCAGACCATGGGCT
TCTGATAGGTCACCTCTCTGTGAAAGACACTGTTATCCCACTTTACAGGGAGGAAATGGA
GCTCTGGGATTAGTTGTTAAGGTTACTCAGTGAATACATAGCCCTGTTAGGTTTTGAGCT
GGGTCTGTCTGATGTAAAAAAAATAACGATGCTGACGGGCCTTGTAGCAGGTGAAAGGAA
GACTGGACTTGGAGTCTGTAGCCTGGTTTCTGGTCTCAGTGCTGCTGCTTCTGAAATCCA
CATCTGAGCCTTAAAACAAAACTCTGCTCTTCTCATAACTAGTCGTGGAGGTGACTTACC
ATCTCTAGCCAAAGAAAGTTATTAGCTACGTAAGAGTGATTTTCATTGCTTTTGAATGTC
TTTTCTGTTACATCAGTTTTATTTTTTTACACTTAACATCATCATTTTAAAAGTTCAGCA
CAAGCCTCTCTTGTTTCATCTGACTGGATCTTTCTGTCGCATATGTAGAAGAGAAACATT
TTGTCATTTGGCTGACCATCTGTTACCAACATAAGAGGCTCCTTTAAAAGTTTTAAATTC
TGTGATGCTGCGATTGGACTATGAGGTTTGAATAAGGAGAAGACATTGCTCTGGCAGGAG
TGTGATCAGAGGAGACACTTTCTGTAGAAAGGACACTCTAAGTACATAGGGAGGACTTAA
TAACAAAATGGACTCTGATTTTAAGGAAAATATGCTAAAATAGCTATGTATTTGGTTCCC
TTCCTTCTCTGTGTAGATAGGCTCAGACAAAACTACTTTGCTTTATTGGTGTCAAATACA
GATTTAACTTCAGGACAGAGACCAGCAAACTAAGCCACAGGTCTGAAGTCCAAATCTGAT
CTGCCATCTGTTTTTTGTAAATAAAGTTTTATTGGAACATTAGCCATGCTCATTGATTTA
CACATTGTCTGTGACTGCCTTTGTGTTACAACAACAGCATCAAGTAGTCATGACAGGGAT
TGTCTGGCCTGCAAAACCTAAAGTATTTACTGTCTGGCCTTGATAGGAAAAGGTTTATAG
ACAGACCTCTGTTCTATTTAAGAGGCTGAGAGGGAGGAAACTATGATAAATTTCCTTGTG
GATCATCATGAAGCCACTGAAAGTGATCTTTATGAAGATCAAAAAAAGTATGAAAATACC
TAATGAAAATATTTTAAATTAAATAAGCAAAACTATGTATTATAAATGGAAAGTCATGGG
CCCTTACTCTACTCCCGTCATACCACCTAGAGGTAACCTTTTAAAGATAGGCCCATGTAC
TGCCCAACTTTATTTTTAAAAACATGCTTAAAAAATAAGTTTCTCCATGCTGTCCTGCAG
CATAGTGACTATTTTTCAAGGGTTAGCATTTACCATTGTTTGTAATTAATTGCAGGCAGT
ACAGACCCCAGAAGGGAGGCATTTGTGTCGCCAACCATACCTCTCCGATAGATGTTTTAA
TCTTGACAACGGATGGATGCTATGCAATGGTAAGAGCAGCTTGTTGATACTGCAATAGTT
GCATGTTTTATGGATGGCTCAAACTTTTAATTTATCTTGGCACAAATTGGAAAGTTAGTT
TAATGTCAGAAATTTGGCTGGGTTTACTGTAGCCATGTATATATTGTATGGCACATAGTA
TGTTGTCCTTACATGTCATATACTTACTTATATGAGAAACATGTAGCATAAGAAAAGGAA
ATAGTGCGGTCGGATCCCGGCAGCCGTGGCAGAACCTCCTCTTCTCTGCTTCTCCTTGCC
ATCACTCTTTTGCTTCTGGAAACATGGCCTCTGGTGTGGCTGTCCCTGATGGCATCATTA
AGGTGTTCAATGACATGGAGGTGTGCAAGTCTTCAACGCCAGAGGAGGTGAAGAAGCGCA
AGGAGGCAGTGCTCTCCTGCCTGAGTGAGGGCGAGAAGAAATCATCCTAGAGGAGGGCAA
GGAGATCCTGGTAGGTGATGTGGGCCAGACTGTGGGTGATCCCTACGCCACCTTTGTCAA
GATGCTTCCAGACAAGGACTGCCGCTATGCCCTCTATGATGCAACCTATGAGACCAAGGA
GGGCAAGAAGGAGGACCTAGTGTTTGGTTTTTGGGCTCCTGAGTGGGCACCCCTTAAGAG
CAAAATGATTTATGCCAGCTCCAAGGACGCCATCAAGAAGAAGCTGACAGGGATCACGCA
TGAATTACAAGCAAACTGCTACGAGGAGGTCAAGGACCGCTGCACTCTGGCTGAGAAGCT
GGGGGGCAGTGCTGTCATCTCCTGGAGGGGAAGCCTTTGTGAGTTCCCTCCTGCCCCCTG
CCTGGAGCATCTGGCAGGCCCAGACCTGCCCTGGGGGTTGCAGGCTGCCCCCTTCCTGCC
AGACCGGAGGGGCTGGGGGGATCCCAGCAGGGGGAGGGCAATCCTTTTACCCCAGTTGCC
AAACAGCCCCCCCACCCCTGGATTTTCCTCCTCCCTCCGTCCCTGATGGTTCTGGCCTTC
CCAAACTGCTTTTGATCTTCTGATTCTTTTTGGGTTGAAGCAGACCACGTTCCCCCCGGA
ACCCCAGTTGAGGGGAGCCTGTACTTTTTTTAACAACACCCCTACACCTCACCTGTTCCA
TCTCTTCCCATGCTGCCAACTTCTAACTGCAATGGTGACTCTGTGCTTGTCTGTTTAGTT
CTGTGTATAAATGGAGTGTTGTGGAGATGACCCCTCCCTTTTCCCCTGGTCTCTGCCGCT
CATGGAAGCAGGACCAGTAAGGGACCTTCGATTAACAAAACAAAACAAAACAAAACACAC
ACACTCACACACAAAGAAAAAAGAAAAGGAAATAGCCATTGTATTTATGGCAGTAAAAAA
ACTAACTTACTGAAATGAAATGTGTACACACTTGATCTCAAAGGACTTTGTAAAGTTCTG
TTTTTTTTTTTTTTTTTGGTAAAATCCCTGCCAATGTTTAACAATGTTTTGCAAATGACA
TTCTTCCTCCTTAGAGTTGTACAAATCCCCTGGCCAGCCAATTAGTTCTCTCTTCCTTCA
GGGAGTTGTGTGCAATTAAAACAAATCTAGCTCTTTAATGAGGATCTAGCAAGAAAGGCA
AATATTTACATGATGTCGTCTCTCTCGGTTCTTGCGCACAACCTCAAAGAAAAGAGAATC
CAACAACAAAGTCCAAAGCCCACAGTGAAACCTAACAACTCAATGCCTTTGAGTGGGTAG
ATGTTTTTTTCTAGCATTTTTTTCAAATGTGTGTTTTCTATTGCCCTTATGCTTTTGCCA
AGATTCCCTGCGTCTCCTGTATGTGTCAGGCAATTCTGGAGGATAATCGAAGGGGTATGA
TGCTCTAAGTTAGTGTGTGGAACAGAATGACTGGGAGGGCCCAGGGGATCTTCTTGTTCT
ATTCTCATGGTGGTGGGTTGGGCTTCAGGAAGAGCAGGTGACTTACGGTCTCCAGTCATC
ATAGTCATGGTCTGGTCGGCCGGTGAAGGCATTTGAAGGGAGCCTTTATTGGTTGCTGCA
GGAAGGAGGGTGGGGAGGGCTGGCACAGGTGTAGGTATTTGACTATCTATAGGTTGGTTA
TACAGTCATGGAGGGGTTTTTAAAGGCCTTTGTAAACATTTCTATTTATTTATTGCCATA
TGTTTATCTAAAATACACATGTGTTCAGATACATAACTCTTGGACAACTTCATTTTAACA
CATTATTAAATTTCTCTAAATAATAGAGTTCTTATGAATCTAAAGGAGCTTTAGCCACTT
TTATAAAAAGACTTATGGGAATGGTGGTTATTAATATTTTTAGGTTAGGAATAGTTGATA
GTTTTGTACCTTTTTTTAAAAGACAAAATCATCATAGGCTAGGTGCTGTGGTTCACATCT
GTAACCATAGCACTCTGGGAGGCTGAGGCAGGTAGATTGCTTGAGCTCAGGAGTTCAAGA
CCAGGCTGAGCAAGAGTGAGATCCCATCTCTAAAAATAGCTGGTGATTGTGGTAGGTTCC
TGTATTCACAACTATTTGGGAGGCTAAGGCAAGAGGATTGCTTGAACCCAAGAGTTTGGA
GTGCTGTGAGCTGTGATGCCATGACACACTACTGAGGGTGACAAGGTGATACTCTGTCTA
AAAAAAAAAAAAAAAGAAAAGAAAAGAAAAAAATCATCATGTAGGATGATAAACCACATG
TATGTGTATCAAACAAACACAGTGTTGTGTATAATTTCAAGGCATTGTGGACTCCCTCCT
ATAGAAGGACCCTCTTATTAACAACCCTCAAGAGATGCCCAGTCTTTTTCTGGATATATA
ATAATCATTATGTTTATGTGGAAAAGCACTTTCATCTATTATACTGTATTTTACCTTCCT
GTAATCTAATGCGGTTAGGACCAAGGAAGCAGAGGTTCGGGCAGCCAACCCTCCTGCTGC
CGTAACAGAACACCACAGACTGGGTAATTTATTTATTTATTTATTTATTTTTTGAGACAG
AGTCTCAAGCTGTCACCCTGGGTAAGATGCGTGGTGTCATAGCTCACAGCAATTTCCAAT
TCTTGGGCTCAAGAGATCCTCTTGCTTCAGTTTTTCAATTTCAGTAGAGGTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCAATTACATTATTGGCCAGGTTTAGAAAAGCATGATACTACA
AAGTATCCAGTGGGTTGAATGGTAGAAAGCTAAACCAATAGAATTTATTCTTTATTCTTT
TTTTTTTTAAGCCCCAAATTGAAGACATTGCCCAGTTGAATTTAAATCCGAGATGGCACT
AGGTAGAAGTGAGGGTGAGACTGTACTGAAAGCCTCCGGAGTTCATAAATGGCCTTTCTG
GCTAAATGTAAACTGTGTGTCTGAAAAACATTAATGATCTCTTATCAATGACTTTTCTTT
TTTAAAAAATATTTTTTAGTTGACAAATAAAAATTGTATAGGTTAGGTGTGGTGGCTCAC
TCCTGTAATCCTAGCACTCTGGGAAGCCAAGGTGGGAGGATTGCTTGAGCTCAGGAGTTG
GAGACTATCCTTGGCAAGAGCAAGACCCTATTGCTATCAAAAAGTAGAAAAATTAGCTAG
GCAGGGTGGCATGTGACTATAGTCCCAGTTACTCAGGAGGCTGAGGCAGGAGGATCAATT
GAGCCCAGGAGTTTGAGGCTGCAGTGAGCTGTGATAACCGCCCCTGCCTTTTAGCCTGGG
GGACAAAGTGAGGCTCCATCTCAGAAACAAAAACAGAAACAACCCCCGCCCCCAAATCCC
CAAACAAACACACACACACAAAACCCCCAAAACAAATTTATGGTGTATAACATGATGTTT
TGATGGGTGTGCACATTCTGGAGTGACTAAATCAAACTAATTAATGCATCTATTACTTAA
TGACTTCTCTAAAATGTTTTTGTTATTGAAAGTCTGAATGTACACCAATACTTTCAACTC
AGAGTAAGGTTCTTTCTTGCTTTCCTCCAATCCATATTTCCATCTCCCTTATTTACTGTG
AAAACCGTGTCTTCCAACAATATCAACATATTTACTCATTTTCTCAGTTCTATCAAATAT
CTAAAATCCTTTCAGCATTGTGGGCAGTGCCTGTGGCTCAAGGAGTAGGGTGCTGGCCCT
ATATACTGGGGGTGGCAGGTTCAAGCCTGGCCCTGGCCAAAACTGCAAAAAAAAAAAATC
CTTTCAGCATTGCTTTATCTGTTTTGCTACAATAAAACACATGTAGTAAGAGTTCAGGAC
TGTTGTGATTCCTGCTACCCCATCTACGATGGATGGTATGAGGTCAAATTCTGTATCAGT
AAGTTTCTTGGGTGTTCTCTTCTTCCCTCACCACTGTTCTTTTATTTATTTGAAATACAG
TTGGGTTCAATTGCTGTAGCTTGGATTCAGTTTCTTATTCTCACCCTTGTTGATTAAATT
TTATTTTTTGAATATGTAGGACATCAACATACTTCTAAATGTCAACGATCATAAAAAGGA
AGTGCCCCTCCCTCCCATGTTCCTTCTACCCCTTTCCTTCTTTGGTTCCCACCTTCATTG
GTTTGCATTGTCTTTTCTATACATGTCTCTTTTTGTAGAGATGAAGAAGTATATGCATAG
AATGTCCCCTCAGTCTTACACACAAGGAAGTATGCTGTATTTGTTCTTTTGCTTTTTTCA
CTTAATAATATCTTCTAGAAATCACTTGTTTTCTGTCATAGAGATCAACCTTGCTCTTTT
CTCAGCTGCGTAGTACTCCATTCTGTGTATATGCCATTGTCTATTCATTGAATTTCCCAT
ATTTGCACATTTAGGTTTCTAATGTTTTGTAATAACAAGTAATATTGTAATTTTTAACCT
TGCATATATGTCTTCTCATTTTGTCAGAGGTATATGTCTTTAGGGTAAATTCCTAGAAGA
AGAATTATGAAGGGCAAATATATATGTAATCATTTCCTTTTTTTTTGGAGACAGACTCTC
ACTCTGTTGCTCTGGATAGAGTGCTGTGGCATCATAGCTCAGAGCAATCTTAGATTCTTG
GACTCAAGGGATTTTCTTGCCTCAGCCTCCCAAGTAGCTGGAACTACAGGCACCGCCACC
ATACCCAGCTAGTTTTTCCATTTTTAGTAGAGACAGGGTCTTGCTCTTGTTCAGGCAGAT
TTCAAACTCCTGAGCTCATCCACTGGCCTCAGCATCCCAGAGTGCTAGGATTATAGGCAT
GAGCCACTGTGCCGGGCCTGTACATTGTAATCTTGATAAATGTTGTCATATTTCCCTCTA
TTGGTCATATAATCCTTTCTCCCTTCCCCCAGACAATGTATAGAGTTACAGTTTCACATA
GCCGTGCATCAGAGTTTATCATCAAGTTTCTAGATCTTTGTTAATTAATAGGGGTTTGAA
ATGGTATTAAAGTGTAGTTTTAATTTGTATTTTTCTAACCTTGACTAAGCTGAAGAACCT
TTACTTATTCCAGCTGGAGGATAGCTCGTTCATCAATGTAACTTGAAAGGTGCTACGATG
GAATTCCTCTTGTTTTCATTTGACAGTTTCAAGTCCTTTCATGAGACTAAACAATCATTG
AGTACAAGGCCAATCTTATTTTCTGAGTGGGAAATAGGAATTTATTGGGATTTTATAAAA
AACCCTTTCTCTGGGTAACTATAACCTTTTACACTTTTTCTCATATTGTCATGGTACTAT
CTAAGTTGGTTCCGGTTCACGGGGGGGATGATGGGAAATTAATTCTAAAAACCCATGGGT
CAAAGGTTTGTCCCAACTGTACTGGTTTTAAAGCTCTAAAAAATATGGATCTACACTCTA
ATTTACTAAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTTAAGGAAAGGATC
AACTTGAGTTTATTTCATTGACTTATAGCTTACTTTCTTCTTATTGCTTTAAAATTTTAT
TTATGCTAGTAAATTATAAAGAATACTGAAAAGAACTTACTCCTATCTCTTTTCAAAGGC
AAAATGTTGATCCTTTATTTTTCTTCACAGACTAAAAGAACATATTGCTGATAAGAAAAA
ATTACCCATATTAATCTTTCCTGAAGGTGAGAACGGGACTGCCTACCAAGCTTTAGTTGG
TAACAACAAACCACCAAAAGTGTATGATGAATAAAATTGTTCTAGAATTGGTGTTCTTAG
TCTAAATCTCTGCTGTCCTATAGGAATGCAATACTTTCTCTGGAATATTAATTCCTGGCT
TTCTTTGGAAATTTGATGGAAGTCATCCTATCTTTTTTATTTCAAATGTCATTTCTGGAT
AATAAACCCAGGAACATTATTGTCCATGACTTTATTTATTTTTTAGTCAGCATCCCACTC
TGTCACCCAGGCTAGAGTGCTGCAGTGTCAGTCTAGTACACAATCTCAAATTCCTCAGTT
CAAGCTATCTTACTGCCTCAGCCTTCTATGTAGCTGGGACTTCAGGCAACTGCTACCATG
CCTGGCTGATTTTTCTGTTTTTAGTAGAAATGGCTTTTTACTCTTGCTCAAACTGGTCTC
CAACTCCTGAGCTCAAGTGATCCTCTCAGGCTGGGTGTGGTGGCTCACACCTGTAAGCAC
TTTGGAAGGACTCCCAGAACTTTGGGAGGCTGAGATGGGCAGATGGCCTGAGCTCAAGAG
TTCGAGACCAGCCTGAGCTAGAGTGAGACCCTGTCTCTAAAATAATAGCCAGGTGTTGTG
GTGGGCACCTGTAGTCTTAGCTACTCAAGAGGCTGAGGGAAAAAAATTGCTTGAGCCCAA
GAGTTTGAGGTTGCTGTGATCTAGGATGCCATAGCACTCTACAAAGAGGGACTAAGTAAG
ACTCTTGTCTCAAAAAGAAAAAAAGAAGTAAAAGTTTGTTATTAAGCTTGCTTAGAAGTG
TCAGATTACTACTTAAGCAAGGGTTGATTTGTGAAATGATAGTGTAATGTCTGTAATTTT
GATATTTAAAGTTTTTAAAATTAAAATAATTTCTCTAAAATGTATTTAAAAAATGATGCC
CGGCAGCCCATGTGTGTAATTTCCTCACTCTGGGAGGCCGGAGCCAGGTGGATTTCCTTG
AGCTCAGGAGTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAT
AAAGTAAATTATAATTAGGCCCATTAGGAGATTACGCCACTAGAGTATGGATAAAACATT
TCAACAATCTTCCTGACTGCAGTAAATCTATGGGAATGTGGCCTGTCTCTCCAAATATCT
AATTTCTTCAGACCCCAATTGATTATAGGAAATTGAAACCATGGGAAAGCAAAGTCATGG
ATAAGGGAAGATGGCGGGGGGAGAGGAGGGTCACTGTACCCATCAACTGTGTGGCTTAAA
CAACAGAAATTTATTTTTCTCCCCAGTTCTAAAGGCTGCAAATTTGAGATTAGGGTTTCA
GCATGGTCAGTTTGGGGTAAGGGTCTTTCCCCTTGTGTTGCACATGGCTGATTTCCCTCA
TGTGCTCACATGACCTCTTCTTTGTGCAAGCACTGAGAGAGAGTGCAAGGTCTCTGGTGC
CTCTTCTTAGAAGGGCACTAATTTCATCATGAGGGCCCCACCCACAGGCCTTCGTCTAAC
CCTGATTCCCTCCTCAAAACCATGACATTAGGAGTTAGAGCTTTAACACATGAATTTTAG
AGGGGACAAAAACATTCATTCTGTAACAGTGACTGTTACCCATACCTGCATTATCTTAGA
TGATCAAATTCTTGCATGCGTAGAGACATTATAATAGTAAGCTGTCACAAAGCAGTCTAT
ACTTCAAGTCCAAAAAGTTCCACAAAGTCCCTGCTGTCTCTTTTGGTGTTTCAAAAACAT
TTTACATGAAAAATCATTTGAGGCATTTGTAGCAGTGTTCTAGGAATAGTATTGGGCCAA
CTGAGTCAGGCTATCAGCCAGATAACCAACAACCTTCCAAACCAGCAAAAGGACCCAGGA
CTGTTCAGAGTATATGCCTCTAAGAAGAAGGGCTATCTGGATCCTTCCACAGCAAGCCCT
CAGTTAGTGTCGGTAATTGGTTCTGGAAAATACTTTAAGCAAAGTGACTTACAATAGGTC
TTTGAGGAATATCATTTTGTTTAATGTTGCTTTGTTATAATGTTGAAGATAAAAAAATTG
TTTTGTTATATAAGATGTAGTTTTGTGTAAATAACCTACTAATGACATTGAGTGAGGACT
TACCTGTACTCCTTTATACAAGGGTGGGGAAGATCACGGAAATGTTTTCTGTATTTGCAT
ATTGTGACTAGAGCTAATTTTACCCAGGAAAGCCTGTTTCTGGCATCTATTACTCTAATT
AACAAGCTACTAATTTCTACATGAGAACCTATTTCTAAGACTTACTAGGCTAATTAACAA
AGCTTGGAAATTGATGAGTGATATAAATGAACATAGCCAAAGCTATGTAAGCACACTTCA
GGAAGGTGGCCTTCTGATTAAATGCTGCTGACCACCCCTGGAGTCTGACGTCTTGCATAG
GGCAGCTTACTAGCCCTGAGATACAGGCTAACGATTAATGATTTGTATTATACGATCTAA
ATTGGAATATGTTGAACTAAATGACAGATATAATAAAAATTACCGGTTTCCCTTAGTCCA
CAAATGACATAGTGATCCATGTTCATATGTGCAGCTGGCTTCCTTTTCATTTTTTAGAAA
AACTTAAAAAAGAAACAAACCTATTTTCTCATCCTCCTTCTTTCCTGACCTCCAGCTCTC
TTGCTCCTACCCTGAAGCCTGGAGCTTTGGATCCATCTGTAGCCTTGGACACAGGGAAAA
GCAAAAGACTTGAGAGATAAAAGCAGCCTAGAGGGGTCAGCCAGGGACAGACCGGATATC
TGATTGGTTTAGCTGAATTTGATCCTCGGAATTTTTAAATTTCATTTGATCAGGCCATAT
GCAATTTTATAATAAAAGATTGCTTTTAATTACCTAGCCTCTTTTATAAAAAGAAAATAG
CCTCATTGTCTTTCCAGATATATTTGTCATCTAGATTGCTTTTCTCATAGCATAAGTGAA
AATGTAGTTGAATGGTCTTAAACTGGTTCTTCTGTATGGTGCTGCTTTTCTTAAGAACTA
AGATCTGCCACCATTAGAAAGAGGAATTGGGTAAAACTTTGAAGTCTCTAGAAGCAGTTG
GGGTGCTTACAGCAAGCAGCACAAAGTTTTCTGGGCCTCTGGGAAGGAGAATTATACAAA
AATAATGTCAGGTTGCTAATGTGGTATTTTTGCCTGGACCTCAGGAAAGAAGAAAGGCCT
TTCTTACTTCCCTTTCATCGCTTTCTTAGTTCTTACCACTCAGAATTCAGGTAAATGTTG
TGAATAGTTAGAGGCAGCTCATTTGGATAAAAGAGGCTTATGTGGGCAGTGCTGAGGACC
TAATCTTGTTTCATGAAAATGTCCCACAAGTGACCCCCAGGTGTGGATCACAGTCTCTTT
TTAAGTTGAGAACTTGCTGGTGAGCTATGCCTTAGATTTGATGCTAGAAGCCAGAACCTC
CCAGTGGTCTCAGGCAGGCGTCTGTATGGAGGTCAAGTTCTGTCCTCATGGCATTGAGTT
TACTGGCTAACCTACAACCATCCATCATCATCAGAAGCACTCGCTAATCATTACTACTTA
ACTGGGTTAAAATTAAACAGTCACAGTATAAAGTAAGCAATTTCTCAGTCCTTACTCTCC
TAGGAGTTTAAAACATTAGATTAGGAGGGAGATAATGGCCCTCAAGTTCCAATCTCCTTC
CAGCTCTTCCAGTTTGTAACTCCTCAGTGTAGTCCATACAAGGAAAGGCATGCAGAGCCC
CAGCATCAGGCAGGTCTGTGTTTCCACCACCCTGGAGAGAGTTCAGAGATTTACGGGCTC
CAAATGAAGGAATGCTGCTTACACAGGCCCTCACCTCTGGGTGAATGTAATGTGTGATTT
TGTTGTTTGTTTGATTCTGAGTCAGTTTTGTTACAAGGAAGATTATAAATACTGGAAATA
CAGTGCTTTGAATGAAAATGCAACTCCTTAAGCATAGGGTTAGATTTGAGTAATGCTTAA
CCCATTTATCTTTAAGAAATTTACCTATCCGTATATAGCACCCTTAGCATTTCTTAAGTG
TATATTTAAAATTTTCCATACAGTTTTCTAGGAAGCTATAGGTAGGTGAAAAACCGATAT
TTTGTTTTCCTTGGGGAAAAATATAGAGAAATAACTTTAGTTTTAATAATCCTTATTTTG
ATCCAAGTATTTTATATATATAGCTCCCTTCTGTTGTAATAAGAAGTGGAGAGGAGCTAT
TGTTTCTTATTTTAACCAAACTTGAGAGAGATGGTTCTTTCCCCCAAAGTAACAGAAATC
TGGTTCTTCCTGCTTCCAAATCCAGTGTTCCTGGCCCCATTGCTGACCAGCTGCCCCAGG
GTCGTGACTCTATATGGCATGACAAGACTCTGCATCATTGCTGGGGATTGTCTTTTATGT
TTGTCTTTCCATTCCCAGGGATGGAGGGCTGAAGAGAGCAAAGGTGAAGGACACCTTTAA
GGAAGAGCAGCAGAAGAACTACAGCAAGATGATCGTGGGCAACGGAGCTCTCGACTCTAA
GTTGGACTGAGGCCGCCTGTAGATCAACTTGGCTTTCCGGAGCTCGCCCTTAGGAAGGGA
ATGTTTTTGTGAGGGGGGAGAGGGCCTCGTTTTGTTTTTTTTTTTATTGTTGATCTTTTC
TACAGAATGATCGTCTCTACCTCTTTATGCCAGAGGCAGAACCTACAGGTGTCCTTTTGG
CTTTGTGGTGGTTGTGATACTAGCCCCATGAACGACAAGGTTGTTTGCTGAGGTAGGACA
GATAACTGCCTTTTGTTATGTGTCATTATTGATCGAACGAAATGTTTGTACAGGAGAAAT
GCTTCTAAAGTGTGTTTGGAACTTGCTGATATGGTAATTTTCGAAGAATACTCTAAACTC
TCTTGTCCTAATTAGCACTTTGCCACTCCCTTCCGTTACGTGGTGGAATTGCACATCTGT
GCGAGGTGACTCTTGTGGTTTTGTTCTACCGCAAGATTGAAAACAAAAAGGGAGGAATTA
TATTCAGGAAAAAGGACAACTTTTGTGGCGACTTGATCTGAAGGTCTGAAGGAAATGTAA
ATAATTTTTTACTAGTACTTTGAAAGATAAATACAATCTGGTAAGCTTCACCAAAGAGCA
GTGAGTCAAAGATAATGTGTGTGCGTTTCCATGTAGGCAACTCCAAAGCACATGGTAGCC
AGCAGCTGGTGATCAAGAGCTTTGTAGGTTTTCCTTGTTCTTTAGTGAAGCCCTATACCT
TATTCCCCTCCTATCTACTGATTTGTTTGTTTTTGTAACTAAACACATTTTCAAATAGAA
GGAGCCTTTAAAAAAAAAAGTCACATTGAGTAGCTTCAGTATGATTGAGTGAAAGTGTGT
GCAGCCACCCCTCACCCTCCATCCCTAACTTTCCCAGTCTCATAAACAGAAAATAACTGG
TATAATTACCTTTTGGAAACTGAGCCTTACATTTTTTAAAGGGGGAAATGAGTTTTCTCC
AACTCACACAGCATATGTAATGTTTGATAGCAATATAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 23996..24266, 30403..30477, 31039..31126, 32759..32848, 38944..38948, 38950..38966, 38968..38976, 38979..38984, 38986..38997, 39000..39015, 39017..39019, 39021..39027, 39031..39035, 39037..39057, 39060..39070, 39073..39073, 40650..40705, 42778..42863, 42964..43092, 43193..43272, 47718..47817
1001..1067, 23996..24266, 30403..30477, 31039..31126, 32759..32848, 38944..38948, 38950..38966, 38968..38976, 38979..38984, 38986..38997, 39000..39015, 39017..39019, 39021..39027, 39031..39035, 39037..39057, 39060..39070, 39073..39073, 40650..40705, 42778..42863, 42964..43092, 43193..43272, 47718..47817
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved