Otolemur_garnettii Locus WDR43
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii WDR43
Otolemur_garnettii
WDR43
GeneScaffold_4180
SNORD92, SNORD53, SNORD53
61223..61310, 69388..69464, 70212..70287
92096
AGCTACTATTAAAGTGTCTGGAATTGCTCAACCTATATCATTTTTTAAATTGTGTCTCT
CTCTTGTAGGAGGAGAGCTTTTATCAACCTGATACAATGAAAGGCACTAATCTGGAAAGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATCGCGCGTCCCGAGGCGA
GGATTTGCGACATAGCGACCCGGCTTCATCGAAGAGCACAAGCCCAAGGCTCACAGGAAA
GAATTAGTCCCGACTCCTAACCGCTCCGGAAGCACAGCAACCCCAGCAGGGGGCCGCGGC
ACCCCCGCCAGCCTCGTGTCCCGCGCAGGCGCAGTCGTAGACAAGTGACGTAAGGGGAGG
CGAGGGCCCCTCCCTCAATTCCCAGAACGCAGAGGTAGTAACTGTCGCTGTCGCGGGATC
GCCTGGAGCGGTGGGGCTCATTTTCCCTTTTCAAATGTAGGCAAGGCAAAGAATTTACCG
CTGACAAATTTCCGCCAGCCTCACCTGGGACCAGGAGGATTAAGGACAAAACTTGCCAAA
GCAAAGTCCCCCGCTCACTCCCAAGATGCATAAGTAAAATCAGCTCCGAGCTGACCGGCT
CAGCTGATCTGTCATCTTGCCCTGGGCCTCAGCAAGTCCCTTTTGACAGGGCTGTGACTC
CCTGCCTGCCCCCATCCCCAGTCCCAAAGAGAGTTTAGGTGTCAATTAAACTGGGTAACC
ACCCTGTGCTTATGTAACAGATTTTGGGGAGGGGGGGCTGAGTTTGAACCCACCACCTCC
GGCATATGTGGCCGGCGCCCTACTCCTTTGAGCCACAGGCGCTGCCCGTAACAGATTTTT
TTTAATAGTTAAAACATAACAGTTAACTGTTTTACCCTCCCCCAAACTAAATAGAAGCGT
CTTAAAATAGGAAAAGATATCTTTGGAGTCCAAAATTATTTAAGTTTATCCCTAGCTTAA
TTACTTAATTTTAGTTAATTTGGCATAAGTTTATGGAGGGTCTGCCAATATCAGGGATGT
TAAATACTTATTTAAATTTTCAACACCTCTGTTAGAAATAAGTATTCACGGCTTGGCGCC
TGTGGCTCAGGTGGCTAAGGCGCCAGCCACATACACCTAAGGTGGCAGGTTCAAATCCAG
CCCGGCCCGCCAAAAACAACAATGACAGCTGCAACCAAAAAATAGCTGGGTGTTGTGGTG
GGCGCCTGTGGTCCCAGCTACTTGGGAGGCAGAGGCAGGAGACTCGCTTGAGCCCAGGAG
TTGGAGGTTGCTGTGAGCTGTGATGTCACAGCACTCTACCCAGAGGGACAGCTTGAGGCT
CTGTCTCAACAAAAAAAAGAAATAAGTATTCCCATTTTACTCATAAGGAAACTGACCCAG
GATAATCAAATGATTTGGGCAAGTTAACAAGTGGCATGCCACTGTTTCCTATCTAGGTCT
ATCTGGCTCAACAAGCCATACTCTTTCTACTGTAAAACCTTTTTAAAAGACTGGTCAGCA
GTACAATTGAACATAAAGTCAAAGTATGTTCAAAGGGCTATAAATTCGGTGTAAATTTGA
TAAATACTGTTACTACTAATTTTGAAGACAATTCTTTCTTTCTTGCCTTTCTTTCTTTTT
CTTTCTTGTCAGAGTCTCACTTTGTTGCCCTTGGTAGAATGCTGGGGTGTCATACCTCAC
AGCAACTTCAAAATCCTGGGCTCAAGCGATTCTCTTGCCTCAGCCTCCCACATAGCTGGG
GCTACAGGAGGAGCCCCATAACACCAGGCTATTTTTAGAAATGGGGTCTTGCTCTAGTAT
AGGCTGGTCTCAAACCCCTAAGCTCAAGCAATCCCCCCCCCGTGGCCTCCCAGAGGGCTA
GCTGGCTTATCCTGATGTTATATTGAACGGCCAGTACTTTCTAATTTATACTTTANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCCACGTTACTACCTACATTTTTAACTCAAGGAAATTACCTTTACGTAGGCCACC
TACATCCCAGGTGATCTAAAACCATTTGGTTTTATTATCTCAGATTTATCAGTCTATAGT
TTACTAATGAAATGCTTTAATTCCAGGATGTTTTTTGAAATGTAACTCCAGCTACAAGTC
ATCATGTTCTCAGGGGTAAAAATTAATATTAATAGCAACATAAGTTAAATAACTAGAAAA
GGGAATTATGGAGGAAAAAGATGTTCATTACATAGGACAGTAGCAATAATTTATTGATCA
CTTGTGGTTTGGGATTATTCACTCCATGACACTCACTCTTTTTTTTTTTATTTTTGAGAC
AGGAGCCTCAAGCTCCTTTTCCTTAGTATCTTTTTTTTTGAGACAGAGTCTCTCTTTGTC
ACCCTTGGTAGAGTGCCATGGCATTTCAGCTCACAGCAACCTCCAACTTCTGGGCTCAAG
CAAGTCTCTTGCCTCAGCTTCCCAAGTAGCTGGGACCACAGGCGCCCGGCCACAAAGGCC
CGGTTATTTTTTGATTGCGGCCATCATTGTTGTTTGGCGGGGGCCAGGCTGGATTCAAAA
CTGCCACCTTTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCAGTTCTCCTTTTACAGTTTTGT
GGACCAGGTTTTAGGTAGATTGCCAGTGTGTGTTTTTTGTAAGGATTTACGCAGGAAATA
AATTATGCCTTTTTCACCTGCCAGCCCACCTGGGTTGCCCCTGGGGAGCCAGCAGCCCAT
ACAGGCCTATTCTTTTGGGGTAATCCTGGTAGATTCTTTGTGGGGCTGGGGGCCCATGCT
GCCAGCCCCAGGTGCGGCCTCTCTTGAGGACAGTGAGAGAGGCCGCAGCTCTAGCTGGCC
GACCGTGGACCTGAGCCTCTACTGGCGGGCTCCATGTGGTGTGCGCCCGGTTGTCTCCAG
GCCGCCATGTTCGCCGAGCCCCCGGGGCCCCGAGGGGCGGATTCCTTCTGCCGGGCCACG
TTATGCGTTTATTTGTGCCTTGGGTTTTGACAGAGCCCCATCTTGGGTCACTACTGTTCT
CGGTCTCTGAACCAGCGCATGGGCCTCGTCGTGGGCAGTTGGACAGAACAAGTCTGTACT
TGCTTCCGGACACTGCCCCCCCTCACCCCCCCACCCCCGCCTTGGGTGCCGGTTCACCAC
GTGTTCTCTTTCACGTCCACGTCGTGGAACTTTCACTGTTGAGACTTTAAACTTTCCTAA
GTTCCTTTGCATTCTCAGCATTTTGAATCTCCTTACTTTTTAAACTTTTTGCTTGGCCCT
CACATTTCAATCCCCCACCCTCCAAGTTTGAAGTCTGCATTAGGGTATGGAGGTAAAGTG
AAGAAGTACCTTAACTTACCGTGATATGCGTGTCCAGGTGAAGTTTCCCCTAGGTGGGAC
ACTGCCCGGAGAGGGAAAGCTTTTCAGTGTTAGGGACCACTCTCCGGGTAAATGCCAATC
ACTGTTGAGTCACTCGACTACATCTCTAAACTCATCACGCACGTGGTTACTGCAGTTACA
GAATAGTCAAACTAATTCACTCCAATGTGATTTGGAAGCCTATGGTGTCCTAAGATGTGC
GGTCTTGAGCTGTAGCTATGAGCAAAACTTCAGAATCTTATATTTAGAATAGATCTTACT
CTTATCTACCTACCTGTGGAGATTTCTGCTAAAGTTTTTGTGTTAAAATAAGGACTACAT
CCAGCTTGCTTTGCTTTGGGTGAGTATGTTTAGATAGTTTTCAGATTTTAAGTTACATTT
TCATAGTTTTTCCTGTTTAATAAAAGAAACCTATCTAGGCTTCTAAGTCACAAAAACTTG
GACTTGTATAAATACTGATCAGAGGTGTCATTTAAATACAGCCCAGGTATTTTTTTATTT
TATTTTTTTTTGAGACAGAAGCTTAAGCTATCTTCCTGGGTAGAGTGTGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCATTGTTATTTGGTAGGCCCGGGCTGGAT
TTGAACCCACCACCTTAGGTGTATATGGCTGGTGCCTTAGCCACTTGAGCCACAGGCACC
GAGCCATATTTTTTATTTTCAAAGTAGTTTTCTATGTTTGTGTTAAACAGTCTTGTACAA
TAGTAGTAATAATACAGGAGCAGAAATACAGAGCAATAGTCAAGTGGGTGCATGGACCCA
AGTTGTACTACCCACGTTTGAATCCAGGTTCTGTTTCATAGAATTGTGCCCCATTCGTCA
GTTACAAAATGGAGATAATAGTACCTCCTTCATAGAGGGGTTGTGAAGATTAATATACTT
AATGATGCAGAAAGCACTTACAGTAGTTTTTTTATATGTAAACGTTAGGTTTTTTTTATT
GTTTGAAATTCAATGAGGGTACAAAGAATTAGGTTAAAATGTTAAGTGTTACTATTAATA
TCTTAAATTTGTGTGGTTAGTCCTATAACATTGACTAGGAACTTTTTGCCTTGTTTGAGA
AGAGACAAAAACTCTGGAAAACTAAGCAATTTGTATAAAGTCAAAAATGGAACCAGGATC
GGAACTCTCATCTTTAGAGTTCAGTTCTTGGTTATACACAACAAATAGTTATTGTTAAGT
TGACAAAAACTTGTTTCCAGTTTGCTTTGCTTTTCTGTTGACTTTTTTTTGGAGACAGAG
TCTCACTTTATGGCCCTCTGTAGAGTGCTTTGGTGTCACAGCTCACAGCAACCTCCAACT
CCTGGGCTTAGGCAATTCTCTTGCCTCAGCCTCCCGAGTAGCTGGGACCACAGGTGCCTG
CCACAATACCTGACTATTTTTTGCAGTTTGCAGTTTGGCTGGGGCCTGCTTCGAACCCAC
CACCCTTGGTATATGGGGCCAGTGCCCTGCCCACTCACTGAGCCACAGGCACTGCCCCTG
TTGTCTTTTTGTTTTTTTGGAGATGGAATCTCACTATGTCGCAGTGACATTACAGCTCAC
AGCAACTTCCAACTCTTGGCCTTAAGCGATTCTCTTGCCTCAGTCTCCCAAGTAGCTGGG
ACTACAGGTGCCTGCCACAATGCCTGGCTGTTTTTTTGGTCGTAGTTGTCGTTGTTTGGC
AGGCCTGGGCTGGATTTGAACCCACCAGCTCTGGTGTACGTGACTGGTGCCCTAGCTGCT
GAGCTACAGGCGCTGAGCCTTTTCCGTTGACTTTCAATTACATTGTTCAAGAATGAAACA
TTTTTCTAGTCTGAAGTTAAAAGTCATAGTTTGGATTATATAAAACAGTGTGATACATTA
GAAAAATAACTGGATTCAGTTTCTTTTTTTTTTTTTTGAGACAGAGCCTCCAGCTGTCCC
CCTGGGCAGAGTGCTGTGGCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCG
AGTTTCCTGCCTCCGCCTCCCAAGTAGCTGGGACCACAGGTGCCCGCCACAACGCCCGGC
TATTTTTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCG
CCACCTTAGGTGTACGTGGCTGGCGCCTTAGCCTGTTGAGCTATAGGTGCCGAGCCTGGA
TTCAGTTTCTTAACCAGGATTTACTTTCAAACTTGTTTTTATATTGCACAAGTTGCTTTA
ACTTTGGGGACCTCGTTGACAAGTGAGAGTTGGGCTATATCAAACAAAACGAAGGTTTTA
TAGGTTTCAATGTCTTTTTACCTGCACTATGTCTTTTAGCTCACAAGTATGAAGTGTCCT
GAAATTACGGGATTAAAAAAACAGAATCAGAGCTAAGGAAAGGTAAATGACTTGATCAAA
ACCTAATAACGTAATAAAGAGTGTGGCCACTAGAGTACAGGTACCCTGATTCCTGGTCCT
GCACCCTTAACACGGTTGCCCTCAGTCATGTTTTTTTTTTTTTATTTAAAATATCCTTGG
TTTGAAACCTTCAATTTTTAGTCACAGAACTGAGATGTGGAAGAAATGTAGCGGCGTCCA
GTCTCCTATGTAGGGACTTGTACTCCGGGAACATCTTTTTACTTGAAATTTAGGGAGAGA
CAGTTTTCTTATATTATGTATAATAAACTTTGTACATATATCATGGGATGGAATTTAAAA
GTCACATGATTTTTAAAGTCAAAAGAACATAAGCATTTGTAGTAGCTGCTTTAACCTCTC
TGTTCCTAGGTCCTTGTGCTAAATTCCTGGCACTTAAGTTTTAACATGCTTTTACCATAT
TAAACATTGAGATGTGAGGCTGTTATTCTGAAGTCCATGCTCCATGCATTTTGTCAAGGT
CCTGGCATATGACATATAATATTCTCATTCTCTAACATGAAATCGAGATAATGCCACCCA
CCTTTTAAAGATTCCTCAGAGGGTTAAATTAGGCACTGTATGTGGCTGCTGTAGGATGCC
CTGGCATGTAGTAAGTGCTCAATAAATGTCAGCTGTTACTATTATATGAATCAGTGAGTC
TGGACTTTATCATTTAATGGTGCATTCCCCAATGTAAGTCCTTTTGTAAGAGTATCCTGT
ATTTTGTTTAATAACTGGCGGTTTGTTACTAACTGACAAAAATATGGTGATCACTTATCA
ATGGAGAAAGATTAGTTAATGCTGGGTTTCTTGGGATAACAGGAATTAAGGGTAGTGGTT
TATAAGTGTTTAGGAAATTAGATTGTGCTTTTTGTTTTTGGTAACGGAATAATTACAATA
CTTGATATTTATGCCACGTTAGTTTCGGGAGGTTTTTGTACATGTCGTATAGCTGAGCAT
TTGGTTGATAGAGGGTGGGGGAAGGGGACCTCTAATGATGACAAGAAAGTATTCTAGGAA
AGTGCAAAAAGAACAGATTGATGAACTCTAGATGGATGCTATTTTTAGAATTCCGTAGAT
TTATGTGTGTAAACTGATCTTCCCAAGCCACTCAGTGAGTGGGTGGCTTAGTCTAGGAAC
TGACCCTGCTATTTCACTGACCCCTTAACTTCTCAGATTTTTCCACTTTTCCTTCCCTAA
CTGCTGTCAAGCCCTGGAGACCTGGTCTACTATTGGCTATCATAGTAAATGTCTTTATGT
TGCTTTGCTGTCATTGCAGTTAAAGTGACTATTCAGATTGGTACTGGGTTGATGAAGCAC
ATGGCATTTCAGACAAGCCTGGTAGCATTAAGGAAGGATGTTTCTAGGAAAAATCTGAAC
TGAGTGTCCACATTGCCATCCCGTAAAAGTTGTAGCACAGTTTAGATGTGTTCCTGTACA
GTGCTCTGACTTCAGGGCTCACCAAAATTTAAACTTCCAACTAAAGTTTGTAGATTAGAT
CCAATTTGACAGTAATAGTTTCTGTGTATTAGAATTTAGTTGTTTTATAGTTTTATGTAA
AAAGCACACATTTTTGTTCATTGTTATCCATGAAACTTCGCGCGCGTGAGGGACTGAAAG
AAAAAAGGCAAGAAATGGGATATGAGCTGAGTGTGCAGCAAGAAAGATGTAGAAGAAGCA
TAAAATTTTGAAAAGATCTCGGGTTTATTTACAGTGTCTGGCGATTTACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTATTATGAGCTATATAATTCTTTTAGA
AAAATTTGCCATAAATTCTAGCTCCCTGTGTCCACATATTTCTGTGACTAAGTTTTTCTT
ACAAAATAGTAACCGTTGATGCTACTTGTTTTTATGGGCCTGAGGAAAAAACAGGTCCTG
CCATCTTTTGAAGCCTTTAAAAGAAGTTTCATTTTTAGGTATTGTTTAAAATGGGCCAAT
AAAAGGATATATTCCTCTGTAAAACAAATAAACAAAAACTTGGGTATAATTTTCAGTGTG
TAGAAGTCAGTATTTTTCAAAAGTAGATTTTGATCCATTAATGGATTCTGAAAAGATTTA
GTGGGCATGATGGCATTTAAAAATAAAATAGAATGGAAAATATCAATTACACATGGTACT
TTATTTTTTTGTGAAACTTGATTTAATTATCTATACATACATATATATATATATATATAA
TTATTATTATGGGTGTGTGCGTGGTCTCCAGGGAAACTCTTCTTACTGTGGGAACTCAGT
CTAAAAAGTCATTGCTTAATTACTTATTAAGTTCAGACTTTTCATCACTTGGATATGCTT
TTTTTTTTCCTGTTTTCACCTCATCCGTACAGTTCTTACTTTTATAAGTCTTGCACATAG
GCCATTCAGACTTTATCTTCTGGATTAAAAGCTGATAAATTTTACCAGATGGGATTTTGT
GTTTATTGCTTAGTTCAATCTGCCCTTCATGTGGGAAAAGACTCCTTAGTCTAGGAAATT
GCATCCTTTTGGGAGTCATTCCTGTGGCTTCAGCAAGTGAGATTTTTCCAGTTACAAATA
TGTGAACTAAATTATTAGTCTGGCTTTTTATTACTTTGTATATTTACATGTAGGGTCGTT
GGTGCATTGTACAAAGGAGCTTCAGAGGGAACAAAAGTGAGTGTGACTAAGATGTAAAAG
AAGAGTTAAAGACAATTCACATTCAGATTGACCATTTCCGTAACGTGTGGAGTCTGACTT
GTGCCTTAAGAGAGAAATTTCTATGGAGGAGATATTTGAGGTGGGCCTTACAGCATGGAT
AGGATTTTTAAACAATAAAAACTGAGATGAGTAGGAAAAATCCCTTCCAAGAGAATGGAA
AAACAAACAAAATGAGTGTTTCAGCAGTGTAATGTGAGGGTGGAATTGGAGAGGGGCTGG
GAAAGGTGGGTTAAAGGCAAATTGTGGATGCTTTTGAATGTCGTAGAATTGTTTATATTG
TTATAGTCTTCTCTGGGGAGTTATTGAAGTTTTTCAGTTACAGAAATGACATGTTCAGAT
AGTAAAGTGTGTGTCCTAATCTATGATGAAATATTTGGTAGGGAGTAAAACTTAATATAC
TAGATTTTGTTAAAGTGTACACTGGTTATATAAACTTATGATCTGGATGATGTGTTACAT
GTTTGGACATGCTTATTCTGCTGAATGAGAAGTTATTTTTAAAAGGACCATCCAGTTCTG
AAAAACATGAGTCAAGAGTTCTTTGAGATTAAATTAAGTGAATTACCATTCAGATTTAGA
TCAGTGATCCTTAAATTTGGGCATAAATCCTGTGGATCTTCCACCTGCCTCTGCTTGCTT
CTACAAAAAATATAGAGATTTTGCAGATAAGAAAAATTAAGGTTTTGGTTATGTTAATGT
TTAATTTCTAGAATTCTTTGTGCTTTTTTTTTTTTTTTCCCCAGTTTTTGGCCAGGGCTG
GGTTTGAACTCACCACCTCCAGTATATGGGACTGGCACCCTACTCCTTGAGCCACAGGCG
CTGCCCTCTTTGTGCTTTTGATACAAATTAAAATCTGAAGTAAAACCTATTCCTATTTGG
ACCAGTCTTTGTTTCACACATTGAGAAACTTCAGTGTAGATCATTTTGATTTGATTTGGG
AAACCCATAAGTAGAAGAAATATTTTGTGAAATCTTGGAAAGAATTTTCTGATTAGGTAG
TAGTGGGCTAACATAACACGTATTCCCCTGCCCTTCCCCCACACAGTCCTTCCTTGAAAT
AGGTATTTGTGTTTATAACCTTATACAGAAGTCATATTTACCCTCTGGGGTCATTTACAT
GTAGCTTTAGAAATGCATGTAGTAATTGAAGGAGCGGTGAGGACCGCCTAATGCTAAGGT
TTCAATGTTTCAAGCAAATTAAATGTTACTAATGAGACCCTCGGACTTTTTATACTTTGG
CTTTTAATTGTAACTGCTCTTTTGGGTTTATTAATTTAGATACATTTCTAAGTATTTCAA
AATGTGTATTTTTTCTTTAAGAAGTTATAATCATTTTGCTTTTCATCATGTGACATCCTC
CCTGAGATAACTAAATGAAAAAGAAAATGCTTTTTCTGATACTCTTTATGCACTGGTAAC
ATTGTTGTCATTGGTGGTTCTTGTATTATGCAGATTTTTATGTATTCCAGGCTCCTCCCC
CTTTTTTGGTGCTGCGAAGATCCTACACTATTAGGAAATGTTCTCCTTTCTACGTATTGG
TTTGTTTTACACTAAAAGAATGCTAAAACATAAAGGCTGGTGAACTCAAATGACAAAAAA
CTCCACCCATGGAAGAGAAGTTCTAAAATAATACATTTTCAGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCTCTACTAAAAATAGAAAAACTGATGCAAGAGGATT
GCTTGAGCCTGAGTTAGAGGTTGCTGTGAGCTATGACTCAATGGCACTACCCAGGGCGAT
AGCTTGAGACTCAAGTCTCAAAAAAAAAATCTTTTTTTTCCAAGCATTATAAACTCTGAT
GTAGTACTCTTAACAGACATGAGCTGTTACATCACTTCTGACGTGAATCAAAGAATTCTT
GTGATATTTGCCACTAGAAAGAAACTTGGGCCTCTTAAGTTATTAGAATCACCAAGCCAG
CATGGAACTCCCAGACTAGTGTTTGACCAGTCATTGAACAACTTCTCTAGTGTGTGCTCT
GAGCTTCTGTTACAGTTCAAACTATTTGTTGACTCAAATGGAAGTTAATTGTGTATTTAT
ACATATAAAAATGCTTGAGTCCCTTTTCCTGAAAGCTAAGCTAGAATTTGAGGAAATATT
AGGAGTGGGGAGGGAAGAATTCGCTACTTGGGTGTGGATTTATGGATTCATAGATCCTTG
GGTATATATCTGCTTGGGGAATGGAAATTTCACTTGGGTTGGACCTCTCAGGACAGGTGG
TCGGTTTCAGAGCAGTGGAAACAGCGCTGAGGTTACTGGGCCCTGTTAGGTGAATACCCC
AAAATACCAGGTTTTCCTATCTGCTGCGTTTCTTCCCAAGGGTAGGAGGCAGGAAGGCAG
AAGTATGAGCTTCCCTTTCTATTGGAGGGATTTTTTTTTTTTAAGTAATAAGAAAAAAAT
CACCTGAGACCTTCTTTCCCCCTGCCCTCTTTCCAAGTATCTTTTTGGGGTGGTGTATGT
TTGTATTTGTGTATAAATGATGTTTTAGTGTTTGAAATACTAAATAGAAACATTTTTCTT
TTTTTCTTTACAGGAAAGTCCCCAAAGGAAAAAAAGGAAATCAGAAGCCGTAGGAACAAG
TGACCAGGTTGATCTGTTGGCTCTTGGAACAGCAGTTGGTAGCATTTTATTATACAGTAC
AGTAAAAGGAGAATTACACAGTAAATTAATAGTAAGTGTGTATATAAATATATTATGTAA
AAGTGGTATGAGATGGAAAGTGGTCATAGAGATTGTTAAAAAATAACTTTTAGGTGTGTG
ATGGGATCTGTGTAGTTTTCTGTCCTTTCTGCATTTAGAGAGCTGAATAGTGATATTTGA
TAAAAGCTGTGATAGGTAACATAGTCCTTCCTGTGGGTTAGAGCATGAGGCATTATTAAC
TAGGTTTAAGATAAGAAAGGGTTAAGAGTGCTTAAGGTATCACAGGTAGCAACTGCAGGA
AGCAGCTCCCCACCTCTTGGATTAAGGGAATAAAGGAGGCAGTTGGAATTACTGCTGAAA
CAGATCTTTTGGCAACAGGTGTTGCTATGTTTTTGCTGTTCTCTCTTATGGAGGAGTGGC
CGCAAGGGCATGAGGTCTAGACTTCAAGCTGAGGAGGGGGCTCCAGCTGCCCAGAATGGG
TGTCTCTGAAGGGAGGTGGTGAGACTGGTTGGTTCTCCCAGTATTGGAAAAATTGCATAT
TGGGTTCAGCTGCTGCTGGAGGGAATTCCCATCACTGTGGTGAAGAAACAAAGTGATGAC
AAACAAGGGAGACCTGAAGGAACAAGTCCTATGTCCTCCCTCCAGGTGTGTCTCCTCTAG
CACCCCCTGTTGGTAGAGCTTACAGATCCAGTTGGCAAAGCAGAGGCCAGCTTATGGAAG
GGTAGATTTAGTACTGGAAGATAGTAACTTAACTGGCATAATTTGTGCAGACAGTATCTA
TTGCAGGGTATTTTTGCTGTTCACTGTACATCTGTATGTGTATATGGGGATGCTTTTTGT
ATGTATAAATAAAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTATTTCT
TTGCTTTATGCATATATTTAAAAAATATAGTTCCTTCTGTTCATCTATTTTGATTTTGTA
TCTTGATTTTTTCATTAAATTACAATATAAGCAGTGAAGGAAGATCAGTACCTATATTTC
AGCTGTGTTATTGCCCCTACTGCATATCTCATTAAAATAGCAATGTCAATGAAAACCCCC
CAGCTAATCTGGTAGATTTAAAATTTTATGATTTTAAATCTGAATTTAGTAATCGGTTCT
AATATTAAAGATGATAGGCAAAATGTACAACTAAAAAAACTAAAAAGTATGAAGATCTGT
ACAGCAAAAAGGTACTGTCCCTTTATTCTCTCCTCCTTTAAGTCTGTTGTGGTCCTCAAG
TGATCTCTTAGCTCTGTTATAGTTAGGAGCCTATCCTTTGATTTGATCAGTCCTTTGTGG
CCAGTAGTTAGTTGCTCAGCTACTGTGGCTGGCAGGCGTGATGCTGATAGAGCCTGGAAC
TGCTTCTAAAATGAATTTATCAAAAAGGAGCCAAGAGGGGTCTGGGGTGAGGGGGGGGGT
GTTGGGGCTAGTGTGAAGTAGAAAAGGACCTGGCTTTGGAGCTATTCTTTCTGGAGGTTG
AATTCTATTAGTGTGATCATGGATAAATAGTTTAACTTCTCACCTCTTAAATGGGTCTTA
AACAACCTACCTCACATGACTTGGTTGGGACTTAGATATAATATTATTAATGTATTGAAA
GTGCCTGGACCGTAAGTGATATGAAGCAAAATGTTTGTTGGATGAATAAGGGACACATAG
CCAAGTTGCTTTCCAAAAGGGCATGCTAATTTTCACTGCCCCAGTAGTATATTGTCCTTT
TATTATAATCAACCAGTGTATTGTAATTTTTATTGTAATCCCGGCAGCATGGGCCTTAGT
AATGCAGATCAAATTGCTAGATGAACAGACTAAAATATGTCTTTGTTTTGGTTTGTATTT
TTTTGATTACTAACAAGGTTGAATATTTAATTTTTTTGCTAAGTTCTTTCTATGGAATTA
TCTGTATCTTTTAATTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTGGGGCCGGGTTT
GAACCCTCCATCTCTAGTATATGGAGCCAGCACCCTACTTCTTGAGCCACAGGTGCTGCC
CCATATCCTTTAATTCTTCACATGTAGTATAGGACTTAGTTCTTTGAGTAGAGAGCTGAT
AAGAAGGGAAGAAAGTAACTGAACTTAACATTTTAAGATATTTTTCTTTTGAAGTGGGAG
CAGTATTACTTGGAAGTGGCTTCAGTGATTTTGAATAATTATTTTTATTCTTAGATAGGT
AGTGGTGGTTCATAGTGTATTTCCTTTCTGTGAATTCAGGTAGAAAGAGTGTCACACTCG
GAGTGAGTTTGGCCTGAAATGCTTGTAAGACATTCTCTTCACAGTGAATCTTCTCTGTTC
CTTCCTGCGCCTGAGTGAGCAGGCATCGTGGGATGCTGTGTATGTTTAAAGTATTGTTGA
TTTTGTGTGTTCCATAAGACAAGGAGACAGTTAGTGTTAACTAATGTTAACTACATTTTT
TAAGTGAGATTTTCCCAGGATGTTTTTAACTACATTTGCTTTTTTTTTTTCTTCCCTCCC
CCAGTTTTTGACCGGGATTGGGTTTGACCAGCGCCCTGCTCCTTTGAGCCACAGGCGCTA
CTAAGTGGTGATTCTGGACCCTATGTTTTGCCACTGTTTATTAATAGAGTATTCTGTCAT
ACTTTGACTTAGGGTATAAAGTAGGTGTTTCTTTTTTTTTTAGACAGTCTCACTATGTCA
CCCTTAGTAGAGTGCTGTGATGTCACAGCTCACAGCAACTTCATACTATTGAGCTTAAGC
GATTCTCTTGCCTTAGCCTCCTAGGTAGCTGGGACTACAGGTGCCTGCCACAGCACCTGG
CTAGTTTTTGTTGCAGTTGTCATTGTTTAGGTGGCTTGGGCTGAGTTTGAACCTGCCAGT
CTTGGTGTATGTGGCTGGTGCTGTAAGCACTGGACTACAGTCACCCAGCCAAAGTAGGTT
TTTTTCTTAACAGAGGAGAAAGGAAAGTTTAACATTTGAAGGTCTAACTGGCATATCTCA
TTTTTGAAGCTGGAAAACTAAAATGGATAAATGTAGGTTAAGGCTTAACATTTTAGTTAA
CTATTGAGTAATTACTCTAGGGTTTATATTATCATATTATAGAAAACAAGTTTTATTTTT
CTTTAATATTTTCTTTAATCTGCAGAGTGGTGGACATGACAACAGAGTCAATTGTTTGCA
GTGGCATCAAGACAGTGGCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGGTTAGGCTTACCCATTAATTAACCTTTGGGGTTACTGC
CTCTGGGGCTCTATTTCATATCTAAGAAAACACGTTTTATTTTCTCCTCATATTTCTTTT
TATATCTTCATGAGTGTGTGACATTGGCCATCAGAGTCCATTGCTTTGCAGTGCGATCAA
AGCAAGTGGCTGGTTAAAATAATGTGGTCAGGATGATAACACCCTGTGGGATGGAATGTA
CAGCCATGCAAGTTAAGTGGTGAGTAACATTGATGGCTGTGCTGTATTGGAGGGGTTGAT
CACTGCTTGAAATGCAGCAGAGATTGGACAAATGACTCCTTGACATGTGGGCTGTATAGA
TAAAATAAGGTTTTAGAGTCTGTTCTTAAGGGTCTTTTAATAAGATTGGACACATGAGGT
TTTTTTTTCCTTTGAGACAGAGTCTCACTTTGTTGCCCTCAGTAGAGTGTCGTAGTGTCA
TAGCTCACAGCAACCTCAAACTCTTGGGCTCAAGTGATTCTTTTGTGTCAGCCTCCCAAG
TAGCTGGGACTACAGGTGCCTGCCACAATGCCCAGCTGTTTTTTTTTGTTGCAGTTGTCA
TTGTTGTTTAGGTGACCCTGGCTGGGTTCAAACCTGCCAGCCTCAGTGTATGTGGCTGGC
GCCCTACCCACTGAGTTACGGGTGCTACCAGAATGTGAGATTTTAATGTGTAAAAGCTAA
AAATGGTGCAGGAGTAAAGTAACTGTGTCAGAGAGGACACGAGGTAACATGTGATTCCTT
GTCAGATATGTAGGGTAGTGTTGGAAAGGTGTGGCAGAAGAGAAGGGCTTTCAGTTAATC
TAGGAGGTAAAATTTGAATAGGGAAGGATGGGAGAATCCTTTCAAGGGTCCAGAAAGGCA
GGTGGGGAGACGGCAGGAGCAAAGGCTAGGAGACAGGAAAGTGAAAGACGTAACTCCAGT
GAGTGAACGCATTTGGGGGGGGGGTAGTACTAGGGAACAATGGATGGTAGGTGATATGGG
CCAGAATCTCTTAGAAGCCAGGCCTTAACGGTCATAGATGAAAATCACAGATAAACTGTT
GTGTTCAAGCACCTATTCCTATGATTGGCTGTATAGTAGATTCTTAGTAAGCGTGGACTA
CTAGATACATATTTTACCATGTAGGTGGGGACTCTGAAGAGGATAATGATGCTCATGGGT
CCACAGCTAATAAGTGGCAGATAAGGGATTCTAATCTTATTCTTTTGAGTTCTGGCACTA
TGTTTTCCTACTATTAAAGATCTATGTTAAAAGTTTAGATTCTATCTGGTAAGAGCGAGA
GAGCTACTGTAGGTCAGTGTCATGTGAGTTGTAATAATGCATTAGGAAAAAGCAGTCTGT
CAGCCATGTGTACACTTAGGGTCAGCAGCTAGTTTAACGATAGACATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCATCATTGCTGCATTTCTTTGATTAC
TAGTAAGTTGAGTGTTTCATGTTTATCAACGATGTGTATTTGTATGAATTACCTGTTTAT
ATCCTTTGTCTATTTTCATTTTGAGCTATTTTTTTCTTAATTGAGATAAAAGAGCTATGT
ATGTCTGAGTATTAATTTTTTGTTAGTAATACATATTTTTGATATTTGCTCTTAACCTTT
TACTTGTATTTTAATTCTATGACTTATTTTTGGCACATAAGTTTTATGTAATTAAATCAG
GTCATCTTTTCCTTTATTTCTGATTGATAATTATATTAGAAGGCTTTTTCTACTTCAAGA
TTATATCAATAAATACATTCTGGTATTTTAATACTTTTTAATCAGTTAATGATTTTTATG
TGTATGGCATAATGTCTTAATCTTTTTTGTTTTTCCAAATGACTTAATTTGACATAGTCC
AATATGACTGACAGAACAACACATTTTCATCTACTTTAAAATTCTGCAACAAAAAAATAG
CCAGGGGTTGTGGCGGGCACCTGTAGTCCCAGCTACTCCAGAGGCTGAGGCAAGAGAATC
GCCTAAACACAGGAGTTGGAGGTTGCTGTGAGCTATGTGACGCCACGGCACTCTGCCGAG
AGTGATAAAGTGCGACTCTTGTCTCTTAAAAAAAAAAGCATTAATGTGTGTAACAAACTG
CAAAAACTCATGCTTATACTCGTATTTGAGGTATGGAAAGGAATCATTATGTACCTGACT
ATTTTACCTATCACATGGAGGTTCATTGCTGTAGATTTTTTTTTTTTTTTTTGACAGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTAGAGCCTCAAGCTATT
GCCCTGGGTAGAGTGCTGTGGCATCACAGCTCATAGCAACCTCCAACTCCTGGGCCCAAG
TGATTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACTATAGGCGCCCGCCACAACGCCTG
GCTATTTTTTTGGTTGCAGCCGTCATTGTTTGGCAAGTCCGGGCTGGATTCAAACCTGCC
AGCTCAGGTGTATGTGGCTGGCGCTTTAGCCGCTTGAGCCACAGGCATGAAGCCAGTATT
TTTGTATTTTAATTATCTTTAGTAATCTAAAATTTTATGTTCTTTTTAGAATTAATGAAT
TGAATTAGCAGTTGATGGGATCAGTTAGCTTAGAAATTTGTGTTCTGCATTTTTCTTATG
TTATTATTTATTTGATAACTTCATTGTCTGGTTTTGCATGTGTGTGCATTCATGCTTTTG
ATCTTTCTCTAGTACTATATTCTGCATCTAGATCCTGCATCTCTTGAACGGATACTTTAA
ATTTCTGACATTTTCTTTTCCATTTTATCTTTTTCTTATGTTACCTATGAGATTTTCTTA
ATTTCATTTTCTAAACCTGGTGAATTTTAAATTTTTCTTGCCTTTTTTTTTTTCTTTAAG
AGACAGAGTCTCACTTTGTTGCCCTCAGTAGAGTGCTGTGGTGTCACAGCTCACAGCAAT
CTCCAGCTCTTGGGTTTAGGCGATTCTCTTGCCTCAGCCTACTGAGTGACTGGGACTACA
GACGCCTACCACAACGCCCAGCTGTTTTTTTGGCTGGGGCCAGGGTTTGAACCCACCACC
TTGCTATATGGGGCCAGCCCCCGACTCATTGAGCCACAGACACCACCCTTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCCTGGGTAGAGTGCCGTAGTATCATAG
CTCACAGCAACCTCAAACTTTTAGGCTCAAGTGATTCTATTGCCTCAGCTTCCCAAGTAG
CTGAGACTATAGGTCTTAGCCACAACACTTAGCCTTTTTTTTTAGAGGCAGGATCTCGCT
CTTGCTCAGGTTGGTCTTGAACTTAAGAGCTCAGGCAGTCCACCCTCCTTGGCCTCCCAG
AGTGCTAGGATTACTGGTGTGAGCTACCATGCCTGATGCCTGGCCCCATTGCTATAAATT
TGGGATAGAAACAGTGTTTTGGGCTGCAACTCAAGAAGTCATTTGTGTTGTAAAGGGAAT
TAATTAAAGGCCAACCTTCCAGAGAAACAGGCATTGTGATGTGGGGATATGATGGACTCA
TGGCTGTCCAGCCAGTGCATACTTTCCCGAACATCAGCAATGTCCATCTTTATAAGTCAT
AGGATAATGATAATACAACTACCAATTTTATTTTACCTTCTTATAAGTCTCACCCGTGTT
GTGTGGTACCTCTAGAGAATCTTTCTCTTGTGCCTGCCCGAGGAAGGTCAGACTGTTTGA
GGGAGCCCTGTGAATGAGGCATCCCTGTAGGGGCATGTCTAGGGATTATCTGATGTAGCC
TGTGGGGAATGCAAAGGTGGTATTTTTAATGCTTGATTTGTTTTCTTATTTAATCTTATG
CTGTGAGTAAAGTTTTCCCTCGTTTATTGAGCTGCTTTGATTCTCTTCCACAATACAGCA
AATGGAAAGGTGACAATAGCAGTGTCAGTTCCCTGTGTATCAGCCCAGATGGAAAGATGC
TGCTTTCAGCGGGTCGAACAATAAAGCTGTGGGTTTTGGAGACCAAAGAAGTCTACCGAG
TGAGTGAATCAAATTATTTGTAAGCATATGAGTCATTGAGTATTTGTGGAGAAAGGCAGA
AGTTTGAGCCATAGAATATGGGGGGGGGGGGGGTTGTTTGTTTTTTTAAAGAATGAGGTC
TTGCTCTGTCTTCTGGGCTGGAGTGTAATGGAATGATCATAACTTACTGCAGTCTTGATC
CCTGGGTTCAAGTGATCCTCCTGCCTCAGCTGTGTGAGTAACTAGGACTACAGTTGTGTT
CCATCAGGCCTGGATGATTTAAAAAAATTTTTTTTTTTCCTTTAGAAATGGGGTCTTGCT
ATGCTGTCCAGGCTGGTCTTAAACTCCTAGGCTCAGATATTCTTCCTTCCTTGGCCTCTT
AAAGCACTGGGATTATAGGTGTGAGCCATGATGCCTGGTCAGGATATTATTGTTTTAAGA
ATACAAATTCTTTATTTTCAAATACATCATATAGTAGAATTGATGAGAAAAAATAACCTC
CAAATCTGATTTATTGCTGTCATATAGGTTAGACATGTCTACCTAATGTGTTTTAGAAAA
ACAAATAGAACAAAATGCTTTTTTAAGAAGGGTTTTTGAATAGAAAAAATCTGTACTATG
CAATGATCATGGTAATTTTGTTTTTTAGCTTGCATCTATCATTTTGTCTGTGGTATTTAA
CAGTGGATATCTAGTATATTTTCCTTTTTTTTTTTTTTTTGAGGAAGAAAAAATAGTTAT
GCAGAGGGGGGTTACTGAACATTTGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGAC
TCACTGAGAGTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACCCCACCACCC
CTTAAAATGGATAGAATTAAGTGAATCTTTATTTCAAAAATGGAAGAAATATAAGTATGG
GGTGGTAGGGTCATGGAAGGTAGAAGGGGCATCTTAATTTTCAGTATTTTCAGAAAGATT
TTTTAAGAAGTGAAGGATAATAGTATAAATAATCTTACTTCCTTAGAAGTAAATTTGTTA
CTTCATCAGGGAGCTTTGCCTTCAGATAGGTATCGCATATGGCTTGCTTATGATTTATAT
GGACTGCTAATTTTGTCACTGCTTTGAATCCATACTCTTTTAACTGAGATTTAACTTTCT
CTAGCACTTTACAGGACATGCAACACCAGTTTCATCACTTAGGTTCACTACCATCAGACC
TCCTAATGAGAGCCAACCTTGTGATGGGATTACAGGTCTTTATTCTTATCTGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTATTACAT
AATGGTCTCCTCTATGCTAGTGAAAAAGAATAGAGGATGTTTTATATTACTCATTACTTA
AATTTGCCACAAATGTGTAATGCTTTCCTAAGCAACAATGTTACCTGGTAGTGAGATGAG
TGCTTTCTTCAGTCAGCTTATTGAGCTTTCAGAAGATGAAAAAGGCCAAGGGGAGTTGAA
TACTGTGATCCACTCACCCATTAGGTGTTTGCCTTTAAAAAAAAACAATTAAATCTATCT
TACTGTCTAATTGCTGGTTTTGTTATTTAGGCAGGTCCGGTCAGAAAACAAAGAAAAGAA
TGCAGTGATGTCTTTCACAGTTACAGATGAACCTGTCTGCATTGACTTGACTTTGTCAGA
AAACAAAGAAGAGGTAAGTGCCTTGATTTTTGACAATTTGTTTTTGAATTTTGTTTTTTA
AAACGCAGGTTTTAATGATTTAATGACTCGGGAAAGAGGATACAGACAAATGGGAGGAAC
AACAAAATGTATGAAAAATCTTTAGACTATTGGAAATAATTGAAATCAATGATAAGCTCT
TATGACGGGAAGGGAAAATTTTGTATATAAAGTTAGTACATTTTGGGAATTAAATTATTG
AGGTGGGTTTTGTTCATAGGAATAGGAGTGTATGTATGATTTCTCTATCAGGTGCATTTT
TTGGGGGAGGGGGATGATTTCACTTTGTTGCCCTTGGTAGAATGCTCTGGCGTCATAGGT
TATAGCAACCTCAAAATCTTGGGCTCAAGTGATATTCTTGTCTCAGCCTCCCAAGTAGCT
GGGACTACAGGTGCCCTCCACAATGCCTGGCTACTTTTAAGAGGCGGCGTCTTGCACTTG
CTCAGGCTTATCTTAAACCTGTGAGCTTTGGCAATCCACCCCCCCTCGGCCTCCCAGAGT
GCTGAGATTATAGATGTGAGCCACTGCGCCTGGCTGTGATGCATGTTTTTGGTTATAAAA
TCTTTTATAGTTCCTAACTAAAGTGTATTTTGTTACTAGAGTAACTCCTCTTGTTTGCTA
TTTTTAAAAATACTTAATTTTTCATATAAAAATTAGGGATTGATATTAACACATCTTAAT
TATTGAATAAACCTGATGTCGTTGAAGTACTTGATGTTTCTGTTTGACTACAATTACATA
GGATTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCTCCCATGGGTAGAGTGCTGTGGCAT
CACAGCTCACAGCAACCTCCAACTCTTGGGCTCAAGCGAGTCTCCTGCCTCAGCCTCTCA
AGTAGCTGGGACGACAGGTGCCTGCCACAACACCCTGCTTTTTTTTTTTGGTTGCAGCCG
TCATTATTGTTTGGCGGGCCCGGGCTGGATTCTAGTCCACTACCTTAGGTGTATGTGGCT
GGCACCTTAGCCACTTGAGCCACAAGCACTGAGCCTAAAGTTTTTTTTTTTTTTTTTTTT
TTTTTGCAGTTTTTGGCCAGGATTGGGTTTGAACCCACTACCTCCGGTATATGGGTCTGG
CACCCTACTCCTTGAGCCACAGATGCCACCAGTTACATAGGATTTTTGATTTGCACAGAA
TCTTGCTTCTTTAATGAAAGCTAAGGATGTTTCACTTTTTTTTTTTTTTTGAGACAGAGC
CTCAAGCTACCCCCTGGGTAGAGTGCTGTGGCATCACAGCTCACAGCAACCTCCAACTCC
TGGGCTCAAGCGAGTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACCACAGGCGCCCACC
ACAACACCCGGCTAATTTTTTGGTTGCAGCCGACATTGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGCTCAAGTGGCTAA
GCGCCAGCCACATACATCTAAGGTGGCGGGTTTGAAATCCAGCCCAGACCCGCCAAACAA
CAATGGTGGCTGCAACCAAAAAAATAGCCAGGCGTTGTGGCGGGCGCCTGTGGTCCCAGC
TACTTGAGAGGCTGAGGCAGGAGACTTGCTTCAGCCCAGGAGCTGGAGGTTCCTGTGAGC
TGTGATGCCATGGTACTCTACCCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAGAAAAA
AAAAAAAACAAGGGTGGTGAGGAGAGTTGAGTTTTCATAAGTTAGATTGGGGACTAAAGC
ATATTATCTTATAATTAATCAGTTATTTTTTTCTTTTAGCCTGTCAAGTTAGCTGTTGTT
TGCAAAGATGGTCAAGTGCATCTTTTTGAACACATATTAAATGGGTAAGTAAGAATTTTT
CAAGTCATAAATTTCTCTTTTTTTACTTTGTCATACTCCTCCCTCATTATTCTTTGTATC
TTATTGTTTTAGATGGTTTTGAATGTATTCTCCTTTATCCGTGTGACTACATACATGCCT
AATGAGAGCTCAGAGTTTTAGAGTCATAGGCTATTTCTTTCTATATTTGTGATTATGAGA
GTGGATTTTTATGTTATGCTTATTTAGTAAATGATAAATTTATCTAATGATAAGTTTCAA
AAAAAAAGCAGTTCAGTTGGAGAGATTTGCTTGTGAATTATGGTGATGCCTATTTGTCTT
TACTTCCCTCTGACAGCATTGTTCTGTTCAGACGGGGAGGATTGCTGTAGTAGTCATGGA
GCAGGGGTCAGCAAACTTTGGCTGGCAAGTAGATTCAGTAGAAACCATAAGGGGCCTGAA
AATGAGGAAGTATTTACTGTCTAGCTCTTTTTATAAGAAGTTTGCTAACCTCTGTTAGAA
CTGTCTGAAACTCAGTTATTACACAATTGCATTAAACGTTAAAATGATTCTTTTAAAATA
TTAGTATAGGAATTTAAATGTAAACAAATCAGGAAAGTAATATGTGCTTATTTATAAAAC
ATTCATGGTGCACAGACACTTGATTATAAAATTTGAGTCTCACTCCATTGTTCTACTCCT
AGAGTGAATTTAACATTTCATATATAAAATTTGAGGTTTTTACTAACATAGTGATAAAAG
TACATAGAGGATATACTTGAAAGGGTGACAGGGAGCCACTGAAACCTTTAAGAAATGTAG
GAGAGTGACCAAGAGAGATCACTGGATGGTAGCAGGCTAGAGAAATAGCCAGTATTCAGG
TGACAACAGTTCAGAGGCTTTGGTGACAAAATAGAGACAGACTGTTGTCTTGAATTGTGA
GTGAAGGACAAGGAAAGCACTTTAAATCATGTCTAATGCCCATGGCACAAAGGGTGTGGG
ATAGAAAACAGCTACAACTGGTCAGGCTGCAGAATAGAGCCAGAAGGGGCAGAGCGCCCT
GAGAGAGACATGGAAGACAACTTGCCTGCTGAAACTCCGTTCCAGGGGTTGTGGTGAGGG
TTTGAGGGATTAGTAGTGACTGGAGATGGGGCTGGTGGCAGTAAGGCACATACAGAACCA
CTGGGGAGGGGGAGCTGAAGCTCAGGGTGGTGAGAAATCATTTGGGAACTTGGTTCTTTT
TCTTGGGTCCTGACAAAATGGAGTTGAGGGGCAGGTGGATCTCAAGGCCATTTTGGTGGT
GAGGTTTTGAGTTGGTTGGGATAGGTGAAGTCTTGGAAAGAGTACTTGTGCTAGGGGTTG
TTGCATTTTATGATTTGATGTCAGCTTCAGAGAATTAGTATGAGATGTTATTTTAAATTC
TCTGATCTCATTTTTTCTTCTATTTCTAGATACTGCAAAAAACCTTTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTAATTTATTATGGAAGTTACTGTTTC
TTCAGCTTGCGTTTATATTAATTTAATGCATATTGTTTACTTTTTAAAAAGAAGAATGCT
AAGCTATAAATATGAGTCCTTGGCATGTGTGAATCTCCCTCTCTGGATGTGGCCACTGTT
ACCTGTTTGTTCTTTGTCCTGGCAGATATTTATTACTTGTGTAGACATGTGGAATTATGT
AGAAACAAACCTTTTTCAGTACCTATGTAGTTTGCTGCACCTGACTCCCCAACTCCCCAC
TTCAGTCATGCCAGGACATACAGCTCTGCCTGAGAGCATTTTGTTAATCAACAGTGTTAC
CTTTGATTTGCTTGTGGAAAGGATAATTGAAATTATAGGGGAGGACCATTTATTTTCAGC
ACAGATTATTCCATATAAGGCTGATGAACTGGTGTGTTTTCTTTAAAACCTGTTACAGCT
TAAAACTCTATTGGCTTTTACAAACCATAAATGCAGACAATTCAAGCAGTTCAAAACTGA
GGAAAGGAAACATTTCCCAGTGTCCTCATAGTTTACCCGTGTTCTCTAACTGCCATCAAT
CTGCGTGGTAACTGCAGCTAACAGCTTTAGTGTGCAAGCCTTCCACACTTTTTAAAATTG
TTGTAAAAATGCGTAAGTAGTAATTTGTTTATCATTTGTCCCAATATCTGGTTCTTTGAC
ACTGTCTTTATCTCTCTTTTTCTCCCTTCGCTTTTCCCCTTCTTTTAAATATATATTCCC
AGGCCCTAAACTCCAAAGAACCTCATATGTGTTTAATAAGAGATATTTCGAACTGCTGGG
CCCCAAAAGTAGAAACAGCTATTACAAAGGTGAGCACATGACAAATTTAAAGTTAAGGAA
AAAGAGTTTTCTTTGGATGAATTGGGTGACTTGAATTGTTACGTGATATGTTTAAACTGA
CTTTTTATGCATATCTTTTCATTCTTTAATATACTGTGTCCTTATAAATTTTGTGGGATT
ATGGTTTTAGATACAAAGGTGGTAAAATGTGGTTATTTCTATACTCTTAGAGTGAATGAG
TGAATAGATGACCAGCAGTTGAAGACCTTGAATTTAGTTCTTCCCCTGCCCACCATGCAT
GATTGTGTGGGCAAGGAAGTATGCAGGAATAAGTAGCAGTATCATATTTATCAATACATT
ATTTTTATCAATCTCAGTACCTAAAAGAGCATAACTTTGAGAGGAATGCTGTGTTTCAGG
TTGTAATAAAGTGATGGTGTGGGCTGGAATTTACTACCATGCTTAGGCATAAGGGTATCA
CTGTGGTGCCTTGTTTTGAATAAAACTGGGTATCTAAATGTAGATATTGTGTATTTGGTG
ATTTAATGAGAAGAGGAAAGCCAAAATAATGCTGTGATGACATCCAAATGGTTTCGCTAC
TGGCTGAGTTTCAGAGATGACACCTTCTCTTGGCTGTCTGAGCATTTCTGGCAAAGATTG
AATTCTGAGGTAGTCATAAAATGTGTAACGTAACTCTGTACCATTGTTGAAGTCAGTGTA
TCCTTGTGTCGTCTGTAGACTTTGTATTTCTTGATTTTTACTCTTAATGTGATGTTACAA
ACTTTAAAACCATGAACTTTTCAGATTATAATTTTAAAACTTGATACGTGAGAATTAAGG
CATGATTTTCCTTTCCATCCCTGCTATTCCTGTTTAACAGGTGAGAACGCCAGTGATGAA
TTCTGAAGCAAAAGTCCTGGTGCCTGGGATTCCTGGTCATCATGCAGCTGTCAAGCCTGC
TTCTCCACAAACTAAGCAAGTAGAGAATAAGAGGAAATTAGAGGGAGATGAGGTAAAACA
CCTTTACCATATATTTGAATTTGATACTTAAGTTTACTTGCAAATAACAATAAGAACATT
GTGTAGGACCAGAGTCAAATCTTTAAAAATTTTTTGCAGGTTTTTTTTTTTTTTGGCTGG
GGCTAGGTTTAAACCCGCCACCTCCAGTATATGGGGCTGGTGCCCTACTCCTTTGAGCCA
CAGGTGCCGCCCCAAATCTTTAGAAATTTAACTGAGGTTTCTCTTTTATCCCTGCCACCA
TAGATCCTAAAATTCTAGATTGTCACCTTTATAAGGCTTATTTAGCCTCTGTTCAGTAGA
AAAGATGGACCTTTTATAAGTAGCTATTGTTAATAGCTGGGTAACTTACAGCTAAATAAA
TCAAGCCTGGATTTGCTGTGATGACTTTCATTGGTTTCGCATGTTGCTGAGGTCCAGTGA
TGCTCTTTTCTCTTGGCTGTCTGAGCAGTCATGGCTGATTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAG
CTTTGAGCTCTGTCTCAAAAAAACAAAAAATTTCACACATGTGCTCCTTGCATAGTGGCT
TTTCACTGGAGTCTGGAAGCTTGGAGTATAGATATTTCCTTTGTCTACAACATAGCATTA
TGGTAATGAGATTCACTTGGAATGAGAGTGGACATATTTGTGTTTTTCAGGGTTGAAGTG
TAAATCAGCTGTGTTTTTTGTCTCCAAACTACTTTAGGCCTTCTCTGGTAACATTAATGG
ATCATTGCTGTTCTACAGGTTAGCATTGAAGACCGCCTGGGAGCAATGCAGATAGATACA
AAAAAAGGAAAGGATGAACTTCTCCAGACGAACAGTTTTCCAGTTCTTCTTACACAGGGC
TTAGAAAGCAATGATTTGGAAATGCTAAACGTAAGTATTATGACAGTTTATAAATGAATT
TAGGTGTTCAATTTTTCTTAGAAAGTTACTGATGTAGTGCATTCACGGAGTGAATAGCCA
TGTTTTATGAGTTTAGTTAAACATATCATTTGGTGTCACACAGTCACCCACCTACAAAGA
CTTGCTTTGAATTATCTTAAACCTGGAATGCATTTTCTCATAGAAATATTGTTGTGAATT
ATAGGTTCTTAGGCTTTAGTTCACAAAAGCCTTATAAACATAGTATAGCTGAATATAATT
CTCAGCATTCTAGATCACAATTTATATTTTTTTCTGTAGGAAAATGCGTTCCTGAGTTTT
TACTCTGGATTCCAGAAACTTATTTCCCCCTGGCCGTGAGAGGGGGCTGTGAGGTGGAAC
CTTGGCAATGGGTAGGAGGTTTGGGGGAAAAATTCAAGAGGGTTGGGGGTTATGTTATAA
AATATTTAGAGGTGAAGTGCTAGAAACTTTATATAAGGGAAGCATTTATGATTTGTGGGT
AAGTTGGTGACTGCTTGTATGAAGTTATTCAATTTGGTCCTTTTAAATTCCAAAACTTGA
CTGTGGTTTATCTAGAAAATTTAAGAGTGAAAAACAGTTGGGTTCAAGCATTGTTGGTCA
GATTAAAGCAGTGGTTCTTAACCTTCCTAATGCCGCAAACCTTTAATACAGTCCAAAGGG
GTCATGAACTACATACAGGTTGAGAACTGCTGGATTAAAGTAATTTCCATTTGTTAAGTA
CATTCATTCTTACTGACTGATAGCAGTGTTACGGTTTCAGTTAGTATAAATGTGACTTTT
AATCTGTAACCTGTGGAAAGTGTCTCAGATTTTATTTGCTTTAAATGGGAATATCATTTT
TCTTTTGAGACAGAGTCTCACTATGTCACCTTTGGTAGAGTGTTGTGGTGTCACAGCTCA
CAGCAACCCGCAAACTCTTGGGCTTAAGTGATTCTCTTGCCTCAGCTTCCCAAGTAGCTG
GGACTACAGGTCCCTACCACAATGCCCGGCTATTTTTGTTGTTGTTGTTGTTGCAGTTGT
CGTTGTTGTTTAGCTGGTCTGGGTCTGGTTCGTACCTGCCATCCTTGGTGCATGTGGCTG
GCACTGTATGTAACCATTGTGGTATTGGCGCTGAGCCTAAATGGGAATATCTTATATTTG
TATCTAAGTTGATTTTCCACAAGAGTGGAAACCAATTAGGTCTATAAACCTAAAATTACT
TTAAAATAGCTTGTGAATGTATGTATTTTGGAAGGTAGATTTTAGTTAACTGTGGTGTAG
AAACCTAGGTGAGGATTTGGTGAAATGGAGTAATGACTTATGTGCCCTCATTGCCTACTT
AACTAAGCTTTGAAACCTTCCTCAGTAGGCACAAATGAATTAGGTACCCATTTTTTTAAA
AAGAAATATTTCAAAACATTTAGAATAGTGCACCATGAATCCATTACCCAGTTTCAAAAA
TTATCAGCACTAGCCAGTCTAGCACTGATTCAGCTGTTCTACTTGTCTTGCAAGAGGTTA
TAGTGAGGCAAACCTCAGAAATGATCAAGTAATGTATCCATCAGTACATCCCTATTCAAC
CTAAAAACTCCTTTCAAAAAAACCTATTGTACTTTAAAAAACAGTAATTCTTGAAAATTA
TCAAAATGTTAGTGTTTATATTTCCCTGTTTGTCTATTTATAAACTTTTTATTTTCAGTT
TTTTGCTTTCTTTAACACAGTATTCTACTAGAGTTCACAGTATACAAGTATTTTGTTGGT
ACATTCTCCTCTCTCTCTCTCAATTTATTATTTGAAGAAGGTAGGTTATTTGCTCAGTAG
ACAGTCTCACGTTCTGGATTTTGCCTCCTGCATCTCTAGTGTCATTTTTTTTTTTTTTTT
TTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCTGTGGCATTGCAGCTCA
CAGCAACCTCCAACGCCTGGGCTCAAGCGAGTCTCCTGCCTCTGCCTCCCAAGTAGCTGG
GATCACAGGCACCCGCCACAATGCCTGGGCTATTTTTTGGTGCAGCCATNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGGAGAGTCCTTGGCGTCTTTACCTTTACCAACAGCCACTGCACTCCAGCCTGGGCAAC
ACAGCAGTTCCTCGGCTCTTACATAGAAAGTGATACATCATTTAAAGCTTGCTGTAAAAG
AATGGGTACAAATTGTTAAAAAAAATTAGGCCTAGAGGTAAAGTGGATTCTTTGTCATTA
GAAATTGTACTTTTGATTACATTTGTCTAATGTGCTGCTGAAGTATTTTGTGAGAATAGT
TTTGGTATTAATAGTGTGGGCTGGTTTACTGTTATTGGTATTGGAAACTTCTGTTTTTAA
AAAAGCAGTGTCAGGGCGGTGCCTGTGGCTCAAAGGAGTAAGGCCCTGGCCCCATATGCC
AGAGGTGTGGTGGGTTCAAACCCAGCCCTGGCCAAAAAAAAAAAAAAAAAAGGCAGTGTG
TCTTGTATTAGAAAACGCTGGTCATTTGTTTTTGGAATATTTACTTTAAAATAAAATTTG
CCTAACCTTGATTTTTGTATTTATATTAAAAAAATTGAAATGTAACTAATGTACCATAAA
GTTCATCCCTTTAAAGTTTAGTGTTTTTAGTATGTTAACAGATTATTGTGCACTTATACC
CCCAAAAGACAGTTACTAACCATTGTCTACTGTCCCTTCCTCCCAGTTCTTGGCAGTCAC
TAATCTATTTTCCATCTCAATAGATTTGCCTATTCTGGACATTTCATTCATATACATGCT
AGCCTAGATTTTTATTAGGTAATTGTCTGATTGTGGGGATATAATCATAGAATATATTTA
TATTTGTTTCAAAATAGATTACTAAATGGAAAAATGATTTCTTAAGGATAGTCATTGTAT
TGTGGGAATTAATGAATGGAGATTGGTTGCTCTTGAAGTGCTGTTGCTAATGGTGTTTTT
CTCTTCCTTAGCTTACAAAGAGGTTGCAAGGACATCATAATAGGTAAGATATTTTTGCAA
ATTTAAATTGCTTTGTTTTTTATAACTAGATTAGGGGGTGGTTATTAAAAACAAAAACTA
TGACAGCATGAAATTAAATTCTAACTAATAAAACTATTTTAAGTGTCATATATTACTCTT
GTCCTTAGTTGAATGATTCTTATTTTTATAACCTTTTATCACAGTTTTCTTTCAGAAACT
CCTATGTAGTGGGCATATCAGCTATATTAACAGGCCATTTAAAAAAATTAGTCTTATTTT
GTTTAATGATTTAATCTTAATCAGGCTACGTAAAATTGCATTTTTAGAACTTGTCCAACT
TCTGGTAGCTGCTTAAGATTAAACATGTAAATCTCAAAGTTGGTATCTTCAAGAGCCTGA
GCTTGAATATTATTATCAGTATCTATGTAGTTAAAAATACAGGTTTTCTGTATAAATTTT
TTCCCCTGAAAGACTGCATTAACCTTAATTAGGACTGGCTTTTGTGCATTTTCGGCCTAT
ATTTGCCTTTCAATGCTAGAGTGGAAGACTTTGATGTTTGTTCCAGAGCATAGAAGATGA
GTTCTGTCTTTTTTTACGTTTATCATGAACATGAAATGCAAAATCAGTTGAATTCAGCTT
GGATGACGATTACTGCCCTGGTATCAGTTAATTATGAAGTAAAGCATTGGTTGTGTTCTT
GAATTGGTTTACAGGAAGGAAGTTTTGTCCTGTTTTCTGGTGTGTACCCCCCTCCCTCTT
CAGATATCAGACTCAGTGAAAGAATGAAAGGACTGTGGTAGTCACAGTGATGTATTTATA
GTCATCGTCACAGAGCACAATTTCTAGATCTTCTGTCACCTGTTTGGGTTTTTCTAATTT
TATAGCTCAGTTAAGTTTAATTTTGAACTCGTGAACATTAGTTTACTTGGATTTTTCTTT
CTTTTCTTTTAGTGCTGTTGTAATGGTTCAGTGGCTAAAATGTGTGTTAACGGTTCACGC
ATCATACCTATCCACAGTGAGTCTTTTCAGCTACAGTTGCTGAGTATGAGTAGTTTGGCT
TTGATAAGGATGGCTGACCAAAACCATCTCCTATCTGTCAACTGTTAGATGCTCCTGTTA
GAGATTTTGTTTTACCCCTCAGTGCAGTGATGTGAGCCTTTTCATAATATCGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCAGTGGTCTCAGCATCCTAATG
CCGTGATGTATTTCATTGTTACAAAGGGGGTTGTGACCCATTGAGTCACTGCTCTAGGGG
ACAAATAAAAGAACTTTCTGCTTTCATTTCTTAAGCATGCTTCAGAGGATTCATTACAAT
AGGTTCAGAATGCTGTCACATCAACTTTGTACTCTATCACCTTGTCCTACTAGTCTCTGG
GAGGTGGGAAAAACTTGATCTAGCTCCTTGGGGTCTCATGATAAGGGTAGATAATGTGCT
GTCAGCGAGGGTAAGAGTCAGAGGAAAGCACGCCCTTCAGCCTGGAGATGTATGGTAGGG
GCATTTTTGAAAACCTTGAGTATTTATACCTAGAATGTTTTGATCAATACAGAGAAGTCC
TAACCTGGAGTTGGTCCTACCTTGGAGTTTCTCCCTCTTAACTTTGTATCATTATTATTA
TAAAACTATTGTTTTTTCCCATCATGTGGCCTTCCGTGAAAATTTGTGATCTTGCCAGGC
TGTGTTGCAAGGATCCCTTACCACTGGAAGTACTCGTGAGCTTAGGCTTGTGGTGCAGTG
AAGCATCACTGATCATGATTTGTATGTTTTGTCATCTCAATAACGTGGTAATAATATCAA
ACTGTCATCTGTTTTTCTAGTTACCTGACTTGGTACCCCAGCTGGGGACACTCTACCAGT
TAATGGAAAGCAGAGTCAAGACGTTTCAGAAACTCTCACACCTTCATGGAAAGCTTATTC
TTCTAATAACACAAGTGAGTAGAGCAAATTGTTCTAAGTTCACACTTAGGGCTGTGTTAG
GACCGAAGAGAGGAATAAGGATCATTGCCCTGGCATTCAGAACTCCCTATTTCAGTACGA
AGTCCAGTCTTGCACTTGGAAATACGTTTGTATGTTAGAGTGTAGTTATGCCTGTTTCAA
TTTTGACTCAGACTTTTTTCTTCCCATTGTATTTCAAACATTAATATAGTCAACAAGTTA
AAGAACATTTTTATGGTTAAAATATTGACACAGAAAGGTATTCTAATCACCTCAGAGAGT
TTTTGAGCTTTTAAAGAGTAATTGTTTTCTTCCTGAAGAATCTTTGCCTGTATTTGATCC
ACATTGTATTAAGGTCATCCGTTATAACAGTGGAAGGATGAGTCAGCCAGTGGCGGAGAA
GGTGGGATGTGGTGGTGATTGTGGTACTTGGGATATGCTTATCCTTTTTAGAATAGTATT
TTATCTTCTTTCAGGTTACAGCGTCAGAGAAAGCAAAGGGAATGACTTCGCCTGAACAGA
AGGCAAAGTTGGTGTATGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1009, 1011..1022, 2615..2905, 49453..49590, 52885..52941, 54133..54138, 54142..54156, 54159..54188, 54191..54198, 60358..60478, 61624..61719, 61722..61730, 61833..61868, 62254..62352, 65799..65863, 67289..67460, 68762..68848, 69700..69831, 71658..71789, 86214..86300, 87311..87342, 88272..88335, 90440..90553, 91034..91096
1001..1009, 1011..1022, 2615..2905, 49453..49590, 52885..52941, 54133..54138, 54142..54156, 54159..54188, 54191..54198, 60358..60478, 61624..61719, 61722..61730, 61833..61868, 62254..62352, 65799..65863, 67289..67460, 68762..68848, 69700..69831, 71658..71789, 86214..86300, 87311..87342, 88272..88335, 90440..90553, 91034..91096
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved