Otolemur_garnettii Locus HAO2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii HAO2
Otolemur_garnettii
HAO2
GeneScaffold_1571
SNORA72
1286..1428
14231
GTCCAATCTTGCAAGCAGGGCTTTTGAAGAACAGCATTTTGGGGTCTGCAGTGTTAACT
CTTTTAAGCACACAGAGATAATAAGCAATTGCAATACAGTAGGATAAATGTGATGACTAA
TTCATTTGCTCAAGGCAGTGATTTTCAATCTGTGTGCTGTGGCACACTGGTGTGCCGCGA
GAAGATTTTAGTTGTGCCACGAACATTTTTAAAGATCATCAATTAACTTATTTTCCAAAG
AAATTCAAGGCACGGTAAGTATATTCCCTTTTTTTTACTTATTTTTCTTGATCAACATAA
TTTAAGTGTGCCACAGAAAATAACTATAAGTTCAAGTGTGCCATGAGATAAAAAAAGGTT
GAAAAACACTGGACTAAGCTTTATTGACCCTTTGAAGAGTAGGGTACAAATGAATAAATT
ACAGATGGTGGCTAATTTGTCACACTCAACTCAGCATCGCAATAGCTCCCTTCCCACCCA
CTGACAAGCGACTTTTTCTTCAAAAAGCTCTGTAGCTGGGCTCCAAATTCCTCACCTTAG
CCCCATCCAGAACCTACTGTACATGAGAGCTGTGCTTTCCATCGGGCATATAATTTCTTC
CTGCTCAGCCCCTTAGGCAAGTGTTATGGGCTACTTCTCTGCTTGATGTGGCCAGATTCT
GGCTTGGCTCCAGATGCAATTTGACCTGTTCTGCCCCTCCCTACCTCAGCCACAATTCCC
AGCACCCACATTTCATCTGGCCCCTTAGACCCCCTGTCCACTAGAGGGGGCCACATCTTT
CCTGGATGAACCCTGGTTACTTGGGCTTATCCCCTTCCCTCTGTCAATGACTTCAAAGCC
ATGCTGTTTCCACCCTGGAGCCAATTGCCTGGAGCTGGTCAGAGTTTGAACTTCAGGTTT
CTCCACCTTTCCTTCTGGAATCTTTGCATGCAGGAGCTCGATGTGCTGCACATTGTAAGT
CAAGGGGCAGACTTGGATTTTAGGAAGATCCCAGGCAGGTGGAAGGGGACAAGGTGGGGA
GTAAGTCTGGAGGCAAGAAACAAAAATAAGAATTTTTTGTGATAATCTTTTAAGAGGTCA
GAGGGCTTTACCTAGAACCAAGGCAGTGCGTGTTGAGTGGAGGAGACAGATATGAGGAAT
ATTAGGAAAAACAAACCATTAGGACTTCAGATCAGGGGAGGGGTAACACCGGAGTGGAGC
AAGACTCCCTGGCCTCTGGCACTCAGGGATCAACAGCTTTGACAGAAGCCCTATTAAGGT
AAGTTTCAAAACTATTAAGAATACACCTGCGAATATTCTCGCCGTTCTGATTTTGTAATA
ATCAGCACAGGCTAAACATTCGCTATATAAAAACCATGCATGTGGTTTCTATATAGTTCT
AGACCTAGTTCTTTTCCTAGGTTTGGTTTTATAAATGCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCCTCAGACTTTACCTTATAAATGCAAACAATGTAACCTAATTATATGTA
CCCTTAAGTAAATCTGAAATTTAAAAAAAAAACAGTAAAGAGCACCGAGGATTGATGTTG
AATCTAAATGACTTTAGACCATGGCTTCCCCTTCACCTTTTCCTCTCTACCTGAAGTGTT
CTCCTTAGGGTTTGTTTTGTTTTTTCCTTTGAAGATCCAGAAATGCCCTTGGTGTGCTTG
ACGGACTTTGAGGTGCAGGCGCGAGAGCAGCTGTCTAAGACATCTTGGGATTTTATCAAT
GGAGGAGCTGACGAAGGCATCACCAGGGAGGACAACATCGCAGCATTTAAAAAGTTTGGT
CTCCCGTAGCCTTATGTTGTTAAGCTTAAGTTGCACTGGCTGAAACATACTTGGGCAACA
GTAGTTCTGGTTTCCGCCTCCAAAAAATACTCCAAATAATAATGTGGCTTTGTTGGGACC
AAAATTCACCGCTGAGAGACCACCACGCACATGCAAAGACAATGAAGTGCTTTATTTGCA
AACATATGCCTGGGTCACTCCACCCTAGAGCATAGCCAGTGGAAGGGCGACCCCAAAATG
AAGCAAGGGGAGGTTTTTAAAGTGTATAGAGGAATTTCATTGGGCGTTTTGTCGGGAGGC
GTTGCCATTGGCTGAGCTGTTGTCCAGGGATGCTTGGCACCACCTGATACACCAGAGGTG
CTATAGGGTGGGTTTAAGGTTAGGGACTTTCCAGAGGAGGGTTGCCTGTTCACTTCTGAT
AGACTGGCTCCCTCTCGGCTGATTGAGCTTGTCCAGAAATGTGGAGGTGGGGGTGGGGGA
AGCCGGTCCCCTGCAGACTGGCTGCCAAGGAGTGCAGAGGAGGGAGCCAGTCTCTTTTCG
ATAGACTGATTCCTCCTGGGCAACTTTGGCGTCACAGCTCACAGCAACCTCAAACCCTTG
GGCATAAGTGATTCTCTTGCCTCAGCCTCCCAAGTAAGTGTGACTACAGGCAACTGCCAC
AACACCCAGCTATTTTGTTGTTATTGTTGTTGTTGTTACAGTTGTCATTGTTGTTTAGCT
GGCCTGGGCTGTGTTCAAACCCACCAGTGTATGTGGTTGGTGCCCTACCCACTGAACTAC
TGGCACCACCCCCAGTACTAATTTTCATACAACCCACAAGCTAAGGATAGTTTTCATTTT
TAAGTGGTTGATGGGAAGGGAGAGGGGAGGCAAAAGAAGAATTATTTCTGGCATGTAAAA
ATTTTATGAAATTCAATATGTTTATATGGATACATATACAATACATGTATATTTTTTTTA
GATAAGGTCTTGCCCTGGGTGGACAGTGGTCCAGTCAGAGCTCACTACAGCCTTGAATTC
CTATGCTCAAGAGATCCTCTCACTTCAGCCTCCCAAGTAGCTGGGACAATAGGCACACAC
CACCATGCCCAGCTTATTTTTTGTTATTCCTGTTTTTATAGAGATGGTGTCTCACTGATT
GCCCAGGCTGGTCTTGAACTTTTGGTCTCCTGCCTTGGCCTCTCAAGTGCTGAGATTACA
GGCTTGAGCCACCGTGCCGAGCCTGAAATTTAAATTTTAAAATCCATAAATAATGTTTTA
TTGGCACACTGCCATGCTCACAGTCATTTACTATTATTTATGGGTACTTTTGTGCTGCAA
GAGTAGAACTGAGCAGTTGTTAAAAAAAAAAAAAATTGACCAATTGTGACAAAGACTAGA
ATATTTACCATCTGAGCCTTTATGCAAAAAATCTGCTGACTCTTATAATAGAGAAGACAG
GGGAAACCTGAAAACGGTATGGAAAGCAGGCACTGTATTCTACACGTTTGTGCTGCACTA
GCACTGTGCGAGGCACTTTGACTGACTCATCTAATTTTGTTTTCACGAAGCTGTTAGGAA
ATTTGGATTATAATTCCTACTTCACAGATGAAATAACAGAGGCTACCTTACTCCAGTTTG
CACAATTAATATTTTCAGAAAATGTTTCTAAGTTTGTGCCCAGAAATAATATTTATTTTG
TGGAAAACAGAAATATTTTGACCCTCACACTAAGGTATCTGTTTGTCTTTTAAAAAATGT
GTTTTACATATTTATCATTTGTGAGTTCTCTTACTTTCTTTTAAAGCAGTACTTCTTTTT
TTTTTTGAGACAGAGTCTTACTCTGTAGCCCTGGGTAGATGGCAGGGTGTCACGGCTCAC
AGCAACCTCAAACTATTGGGCTCAAGCAATACTCTTGCCTCAGCCTCCCGCATAACTGGG
GCTACAGGCATCCATCACAATGCCCAGCTAGTTTTTTTTATTTTTAGTGGAGAAGGGGAT
CTCACTCTTGTTTAAGCTGGCCTTGAACTCTTGAGCTCAAGCAATTCACCGCCTCAGCCT
CCTAGAGTGCTGGGATCATGGGTGAGCCATCACGCCCAGCCTAAAGTGGTATTTTTTAAG
TCAAATCTTAAAATGAATGAGCTGCTAGACCAAAGGTCATGATCACTCCTGGGACTTGTC
CTCTTTCAGTAGCCTTTTCTTACTTTCTGGACACTTGTTTTTGACTGGAGAAGAAACTTC
TTCCTACCTATTCTTTTCCTTTCCAGTCCTTTTTGGAAGGACTCAAATTGTCCAAGTGCT
GAAAGTCTAGTGAAAGAGGCAAAGACACAGACCCTGACAGAGCCAGGCTGGGACAGTGGG
GAGGTTCCCAGAAAGCTGGTGAATGTGGAAGAGCTGCTGGGAGTGGCTTCCAGGGGCCGA
GCCTCTGGCGGGGGTCCACGCTGCTCATTCAACTCTCAGCCAACTGAGCCCACCAGGGTT
TCATGGGACCCAGTCTAGCCTAGACCTGCACCAGGAATCAGGGGTTCTAGCTCCCGAGCA
GCACCTCCCAGCTGGAGAGGCATGCCACCAATACCAGATCTGTTTGCTGCCTAGCACAGA
ATCCGCCTCCGTCCCCGATACCTGAGAGACGTGTCTGAGGTGGACACCAGGACCACGATC
CTGGGGGAGGAGATCAGTGCCCCCATCGGCATCTCACCCACTGGATTCCACACCATTGCC
TGCCCTGATGGGGAAATGAGCACAGCAAGAGGTACGAGCCAGCCGGGCAGAGCCCCTTTC
CCGAAAGTGGGGGGTGGGGGGGGTGCCTTCTGCATAGCAGGGCCTGGGAGCCCCAGCGTT
TCTTTCTAGAAGGGCCTTACAGACAGCAATCTGGTTGACATTAAGGAAAGTGGGAAAGGG
AGGGCTTAAAGCTATGTTTGTACAACATTTCACCTAAGACTGAGACAAAAATACACTTTT
CATAATGAAGACTCATGAGAGTGGGAAAGTGGCCACAGATGAATAGGAAGGTGTCAGAAT
CCCACCAAGTCACCCCTCGGATGGGGGCTGCCAGCCCCTCAGACTCATACAGTCTGTGGG
GAAGTGGATACTTAATGTAGCCCCAAGGTTAGGACTCTCCTGGGCCCCTATGGGCCAGGC
CTAGGGCTGAATGGTGAGTCTCTGAATTTAGAATGAGGCAAAATTCACAACATCAAGTCT
TAACACAAGACCCTCACAATTGCTCTTGCCCGCATATTCCATTTACTTTCTTGGCTGACC
TCGTCATCGTGTTTGACAGGAGGTGTCTCCTTAGTAAATAAACGTCATCCTCTCCCCACA
TACACCACAACCACCACTAATAATAGTTATAATTATAGAAGAGAAGGGGTGGGGCTGAAA
GTACTCTAGAGACTCCTCTGTTGTCTTCACTCTGGCTCAAATCTGTTTCTGTGAGTTCCC
CAGGTCTTCCCTGGGGTCCTTTCCTTTGACTCCACAATGAAGGAAGCAATGAATTCAAGG
ATTCTAGAGCTGAATGTGACATCTATCTGTTTGGCTTAGGAGCTGGTTCTGTCTAGGTTG
AACTCGGAATAGCCTATGTGAATATTTACTATATTTCACAGCTGAATACCTTGTTTGAGG
GGAGGGGAGAAAATAGGGTATGAATTGAAAATATTAATTTTCTTTTTTCTTTTTTTTTTT
TTTGAGACAGAGCCTCACTTTGTCGCCCTTGGTAGAGTGTCGTGGCGTCATAGCCCACAG
TAACCTTCAACTCTTGGGCTTAAGTGATTCTCTTGCCTCAGCCTCCCGCCACAACATTCA
GCTATCTTTTGTTGCAGTTCTCATTGCTGTTTTAGCTAGCCAGAGCCAGGATCAAACCCT
TCACCCTCAGTATATGGGGCCAGCACCCTACCCACTAAGCCACAGGTGCTGCCCCTAGAA
ATATTAATTTTCGATTAGACCAAATTCTCTGCTCATGGGTTGTACCATGGCAGTGACAAT
GACGTGGGGAATCTCGATGGAATGATTAAAGTAGGAAACAAGGACCTCGCAAGTGTGCAG
CAGCAGCAGCCACAGACAATCCCCACCACCCTCATTACCCCCAGCATCCCTACCGTGCAG
AATTGGCAGTTTAAAGAATGCTTTGGCATCTAGTGTCTTATTCAATCTCCCCACAACCCT
AAAGTGAGGTTCTCACATGTAGAACTCACATCTGGAACTCACATCTACTTCATGGCACCC
TATTTTACAGATAAGGAAATGAGAGTCTCAGGGACACGTAGCACGGCAGTGGTAGAGCTA
GCTAGCATTCTTCTAATCACAGATGCCACACTGTCTCCACTACCACGTCCAGGCTTCTCC
GTGGGGACTTCACTCCCTCATCCTCTGCCCTCTCTAACTCCTTCCTGCTTCAGTAGGTAT
TCATAAGAGGCCCACTTTCCTATCTGAAGGCTGCAACACAGCCAATGTGGCTCTGGAGAC
TACACAACATCTCTAGCTGGAAGTATTTTATTCGGAGTACATGATCTGTATACAGAGGGG
GACCCAAACTGCGTTAGACTTCTCAGTCTGGCCAAACACCTCCCATCCCAGCCCTACAGG
AAAGTAGAATATAAGTTAAGCTTTATCTGCAGTAACAGGGCAAGCTGGCCAGAAACCACT
CAGGCTCCCAGGGCTTCCCACCCTGGTCCAGATGCCTCTGCCCTCCGACCTGAGGGGTGT
TTTTGCTTTGCAGCTGCCCAAGCAGCCGGTGTCTGCTACATCACCAGCACGTTTGCCAGC
TGTAGCTTTGAAGATATTGTCGCTGCTGCCCCAGGAGGCCTCCGGTGCTTCCAGCTCTAT
GTGCAGTCAGACCAGCAGCTGAACAAACAGCTGGTCCAGAGGGTGAGTCCTTTGGTTTCA
AAGCTTTGGTAGTCACCGTGATGCTCCTGTAGTTGGAACAGGCGACACGACATCGAAACG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTAGCAAACGAGGCAGAG
TCTGTGGGAGGCCTCCCAGGAGCCCGGTTCCTCCTGCCCGCTTCTCTTTTCCTCCCTTCC
TCCTTTCACATATTTGTACTGAGTGGCTGCCAGTGCTATGCCAGACACTGGGGACACAAC
TGTTCAAAACGCAGATCTGCTTTCTGCTCCCCAGAGCTTCCCGATAAACAGAACATAAGA
CCAATTATCCTCACCCCTGAGGCTGCCCAGCCTCTGCCCTGAAGTGTTCTGCCAGAGCTG
GACACTGAGAAACGGGAAAGCCATAGAGAGGATTTTTGCATGAATAGGTGCGTAAACTAA
AACATCCAGCATTTTCTACTTCATGGCACACTTAGAAAATGCTCATTTTGGATGGTGCAG
GTAGATAAGCTAGCAATGAAGGAGGTACTCAACAGCCATGGCAACTGGCCACCTGTCCAG
CCAGCCCAGGTGCCACCCTGCTAAGATGGAGGGATCAGTATCTCTTCACATCTAGAACTC
AGCTCTGGATCAGCAGGGTACTGGACACATCTGTTTGGAATCCCTGAACTAGGTGACTAC
AAGGGCACTTTCTCCACTAAAATCCTACAATTGCATGGCATGGAGTGCCTGAGAGAGAGA
AAGACACGGTAAACTTAAGCCCTTGCCTATAGTAGAGATAGTAATGTCAGCCTTTTCAAC
CAACAGGCAGCTGTGCTACCCAATCAAGTGCTATTCAACAATGCTACTCACTAACCACAA
ACTGGCCTTGGGGTGCTCCAATATCATTATCCAAAGTCTAGAGAATAAATATTTGGTGAG
CATAATGAGCCAAGGGTAAACATTGGGTAAGATTACTGAAGTATTACTTAGTTCTCAACA
TTCTGCTCGTAACTGGACCCTCACACAGCACAGTGACCTGCAGATGTGTTTGGTCACCTG
TCAGTACACTGCACTCTGAATTCTTTTAAAGAAATGACTGTGGGGTGGCGCCTGTGGTTT
AGTGAGTAGGGTGCCGGCCCCATATACCAAGGGTGGTGGGTTCAAACCCATCCCCCAGCC
AAACTGCAACAACAACAACAACAACAATAAAATATAGCCGAGCGTTGTGGTGGGCGCCTG
TAGTCCCAGCTACTTGGGAGACTGAGGCAAGAGAACCACCTAAGCCCAAGAGCTGGAGGT
TGCTGTGAGCTGTGACGCCACGGTATTCTACTGAGGGTAACAAAGTGAGACTCTGCCTCT
ATTTAAAATATATATATAGAGAGAGAGAGAAATGACTGTGTGGCCTTGGGCATGATGGCT
TACGGCTGTAACCCCAGCACTCTGGGAACCTGAGGTGGCAGGGCAGGAGTTTGAGATCAG
CCTGAGCAAACCAAGACCCCATCTCTTCTAAAACTAGAAAAACTAGCCAGGTATTGTGGC
AGGTGCCCGTCGTCTGGGCTAATGGGGCGGCCAAGACAGAAAGATCACTTGAGCCCAGGA
GTTTGAGGTTGCTGTGAGCAAGGCTGATGCCACGGCACTCTAACATGGGAAACAGAGTGA
GACTCTGTCTCAAACAGGAAAAAAAAAAAAAAGACTGTATCTTGTTTGTCTTTGTGTCCT
CAGATCTTGGCATAATTATTGAGTAGTCACATGATTAATGGCTGATGAATAAGCAATTAA
AGTAGAAATCCTTTTCTACAAAATTTTGTTAAGAAAAAAAGCCAGAAAAAAAAAAAAAAA
AAAAAGAAAAGAAAAAAAGCCAGAAGCATTGCTGGTTTCCTTCGCTTCTCTCTCAGGCTT
ATAAATGGTAGTTCTTCAAATGGGAGTCCTCTTCAGAATGGGTCAAGCAGCCTTGTAGAA
GTCCGGGACTAAAGCTCCCTTTTTATTTCCTACAGAGAAATTCAATACCTTCTCTCCAGA
CGTCGGCCCCTAGCCCATATTTCAGCTGGAATGATCTCTCCTGGTTTCAGAGCCTAACCC
GATTGCCCATCATCCTTAAAGGGATCCTGACAAAGGAGGATGCAGAGTTGGCTGTGAAGC
ACAATGTCCAAGGCATCGTGGTTTCCAACCATGGTGGGAGGCAGCTTGATGAGGTTCCCT
CTTCCGTAAGTAGGAGGTCATGAGAGGGGGGTGAATGGAGAGCAAGGAGCGCCCTTCACT
GGGCTCTCTGATTATAAAGCTTCCTACTTCCCAGCCCAACTCCTATAGTCACTTTTCACA
CACCCAGCACCTTTCACACACCTGGTAATTGGCAGAGGGGAGAATGTAAAGAGTGCAGGT
CAGAGTGGGCCCTGAGGCATCCCAACCACTCCGACCAGGTAAGAGCAGAAAGCAGCACTG
AGCTGCCTCCAGCACTCAGCAATCAGGCTCTGAAAAGAAAACTAATCCAGGGGGAAACCT
GTGGCTCAAAGGAATAGGAAGCAGGCCCCAATATGCTGGAGGTGGCGGGTTCAAGCCCAG
CCCCGGTCAAAAACTGCAAAAAAAGAAAGAAAGAAAACTAATCCATATGTAAATCCAAGA
AGGGAGGTGGGTGAGAAGGGGTATCCACTCTCCTATCTACTGGGCACCACACAGGGGTAC
AAGCACACCTCCTGGGTGAAGGGCTCAACTGCAACTTGAACTTTATCTAACAAAGGCAAA
CAATGTAACCTAACGGTATGGACCCTCATATTAATCTGAAATTTTAAAAATACCAAAAAA
GAAAAGAAAACTAACAAAAACAGTATGCAGTAGGTGTCAGGCTTTTAGTAATCAATTTAG
CTTGTCCTGCTCCCTTGAGAGGGCTGAGTAGTAAGTGGAGAAAGAGGAAAACTAATTCCC
CCACGCGCTTCCTCCACAGAGAGTATTGGCCCAAGGGCCTGAGAGAGGGGATTTCTCCTA
TGTCTTTATGCTTATTGTTTTCCCAAGTCATTTGGCAAAACTTCCAAACCCAAGAGCACC
CTGGAATCATCCAAGTTTAGTGCCAGGATTAGTAAGGTTCTTTCTTGCCTTGGAGCTCAA
AAGTTAAGAAGGTGCCAAGAAAAACTTAGTAAGGTAAATATTATAATATTTTTGTGCATT
ATTTTAAAAATGAAAATTAAAACAAAAATCCGTGGTAACAAAATGTCAACATTTTAAATA
AAGATAGGACCCACCCTTGCAATTTGTATAACCCTGCTTCACCTCAGCTTAGTTCTGGCC
CTGGGTCCAATAAAACTTTATTTACAAAAACAAGTCCCAACTCACAGGTCAGAATTCACC
ACCTGATTTTTTAAAATCGTTACATTTGAATATCATTTCTATGAGTTTTGAACCACCCCC
TAAATTTTGAGGCTCAGGTAAGTGCCTCACCTCCCTCAGGCTGGTGTCAGCCTTGTAAGG
GGTGAAACTTTCTGAAAGAAGCCCCCAACTCTATGAGGTTTCATTCCCACATTGCCTTTG
TGTTTCCTCCTGGGACCAGGGGAAAGGATAAGTCAGCTGTTGTCCCCAGAAGACTCTAGT
AATGTTCTATTCCAATCTATTAAAAATAAACTCTGGGGCAGTGCCTGTGGCTCAAGGAAT
AAGGTGCTGGCCCCATATAACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGCTTAAAATTTCAGGCTTGAAATTCCACTCCATTGCTCTGGCTTCCTCAAAATGT
TGGTCCTCTCTGCTGTCCCAGTATGGTTCACAAAAACAGTATGGACAAATATCCTTTTTA
ACCACACCGGTGAGGATATTTCTTTTCTTCTTTTTTTAGGATATCATAGTCTAAGTTTAT
CTTCTAGTAGAGAGAGGGAAGAGAGTGGGCCAAGGGATGAGAAAGAGAGAGAGAAGAGAG
CAGAGAGTGAGAGAAGGAAAGATGGGGGGTGGGGAGCCCAGAGAATGGCATGGGACCCTA
AAGAAAGGAAGGTAGAATGCCAGCCCATGAACATATTTCAAATAATACCCTGCTGGGATT
ATAAAATACCCCTTATTTTGGACCTGAATGCCCTCCAGTTATTACATCTAAATTCAGAAC
AGTCAATTTCACCTGTAAATTAATTCTTTTTTTCCCCCAAGAGCTGGTGTCACAGTACAT
CTATACATGAAAGTACAAAATTCTTTCCTCCAAGTTTCTTATTCTGCTCAGTCGCAGCCA
AAGGATCTCATTCAGGTAGAATTCTGATGAATTCCTTTGACAACAAAAGGTCCCCTATGG
CCCAATTTCAACTCCTCCTCGGGCCATCCCTCAGAGAAGCACAGGGAAGAATGCAGAGGC
AGTTCCAGAATTCCCTACATCACTCCTCTTTACAGTCTGGGAGGCGCCCAGAGCATGGGC
TGGCCTGGAGCACCTGGGGTGGTCAAAGTCTATTGGAATTACAAAAGCAAGATAAGAGAG
AACCCAGAGTGAGATCAGGTCAAAGTTATTTTGCCCCGTAAGGACTGAAACTTTACAGTG
TTGTTGCTCCTGTCCTATCTCATTGAGCAAATAAACCACAGGGGGACTCAGGGACTCGCT
GGTCATGTGGTGCTTAAGAGGTAACAGGCAGGCCAGTCTCCCAAGGCAGGAGAGCCTCCC
GCAGTGGAGAGCTGTTCCTAGCTGAGCCACCCTGGAGGCAGAGATGATAGAAGAAAATAG
AAGGCAAAATGTTGTCTGAGAAAAAGAACGCTGAAGTACACATTATAAATGAAAAATGTC
CCCTTTAGGATGTAAAGAGGAACCAGTTCTTCCAACCTGTACATAATTGAGTTAGAAGCT
GGACTAGAGCCAGAGCAGAAAGCTGTAGGAGGGACAGCTGAGAAGACCCCAGGACCCCCA
CCTCCTACCCCCCTACCCCCACAGTGTGCCCACAGCAGCTGCTGATGCAGGTGCCAGCTA
TCTCCAGTCTGGGAAGGAAGAGACTGTCCACGGAATGGACTCCGAGTTCATGTTCGGGAC
TCCTATCCCACGTTCAGAAAACCTCCCAGCCTGGGTGCATCTCCTTTCTAGATAGACGCT
TTGACAGAAGTGGTGACTGCTGTAAACGGGAAACTTGAAGTGTACCTGGACGGCGGGGTC
CGGACTGGCAATGACGTGCTGAAGGCTCTGGCCCTGGGTGCGAAGTGCGTCTTTCTTGGC
AGACCAATCCTATGGGGTCTTGCCTGCAAGGTGAGAGTGGAAAGCAGGAACCACCTGGAA
GATACAGATTCTTGTCTGTTTCCCTGCTTTTCTGTGGCTCACCCTCCAAGCTTAGCCATG
CTTGGAGGTGCCACAAATAGCTGCAGGATAGTCACACCACACCCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAGATGTTTTGAACATTTTAA
AAAATGAACTCCACACTTCCATGGCCCTTACAGGTAAGGATTTAAATTTTTTTCCTGATT
TGGACCTTTAAATAAGAGACCTAAAGAGCAGGACCGGCAGCCTTTGCCCCAGCTGAGCCT
TTCTCAGCTTGGTAGCTGTCCAGAGGGTGGAAACGGGGAAATACATCTGAGTCAAAGATT
AAGCAATCTCTGGGTTCAGTGGAAAGAAACCCAGTGTTCTGCTCAAGGTCATTGTCTGTT
CCGGGGAGGCTCGCCCACCTCCAGCTCTGAATTCCTGCTCTTGCCAAATTGACTTATCCC
ATGTCTGCTGTTTCTGTCCACTCCAAACAACGCAGACATGAAACTCAACGCTTTCCTATC
TTTCCGCTTTAGGAGAAGACCCTCTCGTGAGTTATGTTTATTCAGTAATACATTCCACCC
AAGTTGTGGTGCATCAACACAAATATGGAAAGAGCTTCCATTTAACATTACACATCCTGT
TATTAAATTCTTTCAGCCCTTCTCCATGCCTGCTCGGGCCCATGACGCCTCAGCTAGCTC
TTCTTTCTCCCTTCCCTTTTTACTTTCTTTCTTTCTTTTTTTTTTTTTTTGAGACAGAGT
CTCACTCAGTCATCCTGGGGTTGAGTACCCTGGCATCATAGCTCACAGCAACTTCAAATT
CTCAGACTCAAGTGATTCTCTTGCCTCAGCCTCCCGAGTAGCTAGGACTACAAGCACCCA
CCACAATGCCTGGCTATTTTTAGAGAGAGGGTCTCCCTCTTGCCCAGGCTGGTCTTGAAC
TCCTAAGGTCAAGCAATTCACCCAGCTGGGGTTCCCAGAGTGCTAGGATTACAGGCGTGA
GCTACCGTGCCTGGCCCTTCTCTTTTTACTTTCTATCTGGAGTTACTCCCACAATCCCTG
TATCCAATCTTAGCTACAGTCTTCATCATTTTGGATGTTAATTAAGATCTTCTACTGAAG
TTCTGTCTTTACCCTTGACAGAACTTTTCCTTAGAGGGCAGGTATTATGTGGAATATTCA
CTCATCTCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 2494..2632, 5219..5370, 7333..7481, 7484..7516, 7519..7533, 7536..7550, 7553..7558, 7560..7605, 7660..7661, 9515..9724, 12651..12809, 13163..13231
1001..1031, 2494..2632, 5219..5370, 7333..7481, 7484..7516, 7519..7533, 7536..7550, 7553..7558, 7560..7605, 7660..7661, 9515..9724, 12651..12809, 13163..13231
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved