Otolemur_garnettii Locus RPS8
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPS8
Otolemur_garnettii
RPS8
GeneScaffold_2671
SNORD55, SNORD46, SNORD38
1556..1634, 2127..2229, 3661..3734
5569
GCCCCGCCCAAAAAGTTTGTATTTACCTACATAAGAAAAGTTTGTAGACCTCTCTTTTA
CGCTTTCTCTCTAGATTCCATTCCTTCTGGTGGCTTTTACTAGGATTTATATATTAAGGA
TTCCCAACATATTCCTTACACAAGAACGACCAGGCATGAATATCTAGCTATCATTCCCAT
TTATATAAATTGCTCTCTCCTATCTTAGTTCACGTAACAAACGTGTTGGGAACATGTCTA
GAACAGCTCCTACCTTAGCCCACCCTATCTCAACAAATAGCCCCCAAACTGATCTAATCG
ACCAACTGAGAACTTAGAATCCTCGACACCTCCCTCTTTCAACCCCCAAGTCCAGTTTAC
CACCAACTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCACGCTGTCCCCCTGGGTAGAGT
GCCGACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCAGCCCCCCAAGTA
GCTGGGACCACAGGCGCCCGCCACAACGCCCGGCTATTTTTTGGTTGCAGCCGTCATTTG
GTGGGCCCGGGCTGGATTCGAACCCGCCACCTTAGGTGTATGTGGCTGGCGCCTTAGCCA
CTGTGTCGCCGAGCCACCACCAACTCTTCAAAACAAAACCCAAGTCCACCCCCACTCGTT
TCGACCTCTCCACCATTTTTCAAAGTACATCTCTCTTCTGAACATGTAAATAAAGCCATT
CTGCTCCCCCCGGCTGTGCCTTAAATCCCTCCAATTCTATCAGAAGCGGGCATATCTACC
GACGCCGCGGAACCTCCAACCCCCAAAGTAGGCAGCACCAGCAGAGAGTCGGCTGACAGC
AGGACCCGCCCAAGCCCGAGTCCCTCAGCGCGACAGTGAAAACGTAAGTCACGCCGCCCT
CCGTGGTTACGGCACTAGACTCAACGTTATCTGGGCGGGACTGCGTTTTACAAACCGAAC
CGTGAGTCTTTGCGTTTTCTCTTTCCAGCCAGCGCCGAGCGATGGGTAAGTGACGCTCTG
CCATGGGGCCACGGGAGTGTGTGGGGGTGTTTTACCTCAATCCGGCTCCATCCTGCCTGG
CGGCCAAGTCAGAAGTACAGAAACTCTGACGCCGGGCTGGGAGCAGCATCGAGGAGCGGT
AGCCGTAGGGTTTTGGTTGCTGTGGCCCTGCCGGAGGGTTTCATCAGGCGTCTGTCTCTG
AGCCGCGGTTTGTAGGCTGCCAGGTGGCACCAACATGGCTGCCGCGGTTAAGAGTTCGGC
CGGGGCTGGGCCCTGTAGCTCAGCCGGCTGGGGCGCCAGCCACATACACCGGAGCTGGCG
GGTTCGAATCCAGCCCAGGCCTGCCCAACAACAATGACAACTACGGCCAAAATACAGCCA
GGCGTTGTGGCGGGCGCCTGGGGTCTCAGCTCCTTGGGCGGCTGAGGCAAGAGAATCGCT
TAAGCCCAAGAGTTCCAGGTTGCTATGAGCTGTGACGCCACGGTACTCTACCGAGGGCGA
CATAGTGAGACTCCCGTCTCAAAAAAAAAGAAAAAAAAGGTGTTCAGCGGGCCACACGCG
CATGATGACACCCAGGAATGCTGCAGACTGCCGATCGTGCAGTGAGGAAGCCAACCTTGG
AGAGCTGAGCGTGCGGCCCCCGTGGCGCGGGGATCTGGAGCTGGCGAGTCGCCGGCACCG
AGTCCCCACGTTTCAGGGTTTCGTCCCCGCTCTCACATGCAGGCATCTCTCGGGACAACT
GGCACAAGCGCCGCAAGACCGGGGGCAAGAGAAAGCCATACCACAAGAAGCGGAAGTATG
AGTTGGGACGCCCCGCAGCTAACACTAAGGTGGGTGCCTGTGTGGGACTGCCCGGACGGA
AGGTCGCCTTCCTATGCTCTGCCGCGTGGTCAGGTCGCCCCACGTGTGTTCTTCCTATCC
GTCTGGTTTCTTTATGGTAGGGACTGGTGGCCTGCCCAGCCTTAACTGGATATACCATCT
GCTTTCTCGCCAGCTTAGGGGCTGAGACATGTAATTGAGTAGTGGGACTTGGAGAGCACT
GGAGAAGTGTCTCCTTTCAGGATGATCAGAGAGATCGTCACTTGGTATTTTTATTGCACG
GAAATTTAATTTTCAGCGTTTGGGGGTAAGCAGAGTGATGAAAAAATATCCTTAGGCGTG
GTTGTGGCTGTCTTGGTCACGATATGCCACTTGCCAATGCAAGGACTTGTCATAGTTACA
CTGACTGCAATACCTCCATCTAACCCCAGGTTCCACTCCATCGCTTTTCTTGCTCTTCTT
GGTAACCTACTTCCTTTCTCCTTGTTTTCCAGATTGGCCCCCGACGAATACATACCGTCC
GTGTTCGAGGAGGTAACAAGAAATACCGTGCCCTGAGGCTGGACGTTGGAAACTTCTCTT
GGGGCTCAGAGTGTGAGTGAGGCCCATCTGGAGTGGGTGGGAAGGCACCTTAATTTTCCG
AAGCTTCATAAATGTTTTCAGCAGGAAGTCAATGGCCTTAGACCTGGGGTCCTCAAGCTT
TTAAAACAGGGGGCCAGATCACTGTCGCTCAGACCGATGGGAGGGCTGGACTGTGGGCCT
GGTGCGAGTCAGCTGCTAAACAAGACAGGCAGTGGTGGAAAAAACACCCCGTGGGCCAGA
TAAATGTCCTAGGAGGGCTGCATGTGGCCCGTGGACTGTAGTTTGGGGGATGGCTTGCTT
TAGACCAAGAACTTTGAAAAAATATTTTTAGTCTCACTGGGTTGCCCTCAGTAGACTGCT
GTGGTGGCACAGTACACACTAACCTTCAAATTCTTTGAGTTCAGCAATTGATTTACTTGC
TTCAACCACCCAATAGACTTGGGACACAAGGACCAGCCCACAATGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGGCCTTGATTTACTGAGACTGTGTGGTGACCACA
CTGTATGTAGGCAATTGGTCTGGAGACAAGAGTCCTAGTATGTTGCCCTTGGTAGAGTGC
TGTGGCGTCACAGCTCACCGCAACCTCAAACTCTTGGGCCCAAGCAATTCTCTTGCCTCA
GCCTCCCAAGTAGCTGGGACTACAGGGGCGCACCACAATGCCTGCCTATTTTTGGTTGCA
GTTGTCATTGTTTAGCTGGCCCAGGCCAGGTTTGAACCCATAAGCCTCCATGTATGTAGC
TGGCACCATAACCACTGTGCTATGGGTGCCAATCCTGACCACACACTTGTAGAAAGATGA
GGGTGTGGGAGACCAGCTGATGTTTAGTGGCTAAGAAAAGGTTCAATGTTGCTGTGCTTC
TCTTTAATGCCCTACTACGGCAGAAGAGCGTGGGGAACTCGATGCTGAATTTCTTCTCTG
AGCAGGTTGTACTAGGAAAACCAGGATCATTGATGTTGTCTACAATGCATCTAATAATGA
GCTGGTTCGTACCAAGACCTTGGTGAAGAACTGCATTGTGCTTATTGATAGCACACCATA
CCGACAGTGGTATGAGTCCCACTATGCACTGCCTCTGGGACGCAAGAAAGGAGCAAAGCT
GGTACGTGTAACTTCGCCACTGTAGGCACTTTGTGGGGATGTGGGGCAGCCTGATTCTAG
CCTTCTTGTGATGAAAAAAACTGTCCAGTTCTGCTACTGAAGGGAGAGAGATGAAAGCTT
TTAATACTGAGGAAGGCTAGTGTTAGGGGGTGGGTTTCAAGAAGGCTTTAATGACCTTCC
ATGTGCTAATCCATATATATGCCCTATCCTTTTATCAGACTCCAGAAGAAGAAGAGATTT
TAAACAAAAAACGTTCAAAAAAAATTCAAAAGAAATACGATGAAAGGAAAAAGAACGCCA
AAATAAGCAGTCTTCTGGAGGAGCAGTTCCAGCAGGGCAAGCTTCTTGGTGAGATGTCTG
TTGGGGGAATTGAGAGTTGCAAAGATGGCCTGCCCTGTGTGGTTATTGCCTTACCTCAGT
TCATTGGACCGCCAACCATGTGGTCTAGAAGGTTCACTAGGAAACTTTAATAGTAAGGCA
CAAGCACAAATACTCCCATTTGGTTACCCTATTAGTGTGAAGCTGAAATGGGAAAATTGG
GTAGGAAGAGTTCATAGGGCTATACATAGCTTAGAGCTTTAGAAGTATTGTGAGACATGC
ATGTCCAGGCTGTGGTGGGCTGTCACGGTAATGAACACTTTGTCCTCTTTGTCCAGTCCT
CCTGCTACTGATTTTTTCTTTTTTAGAGATAGTCTCATTCTGATGCTCTGGGTTAAGACC
CCCTGGCATCATGTCTGAGGATACAAGTGGGCTTTATGCTTGCCCCTAGGGTACCTGAGC
CAACAATAGACTTAAAGGGATAGATAGGTTTGGATGGGCTCACTTTGTCATTTTACTAAA
GACCATGTAATCTCTTGCAGCATGCATTGCATCAAGACCAGGCCAGTGTGGCCGAGCAGA
TGGCTATGTGCTAGAGGGCAAAGAGCTGGAGTTCTATCTGAGGAAAATCAAGGCCCGGAA
AGGCAAATAATTCTTCCTCTTTTTTTTTTTTTGTTTTGTTGAAGTTGTCATTCTTTAGCT
GGTCCTGGGTTTGAACCCACCAGTATTCATGCATGCAGCTGGTGCTGTAACCACTGTGCT
ACAGGCAAGAAGCCTTCTTCTCTTCTGTCTTGGTTCATGTAATAAACCTTCATTATTCCA
TTTGTTGTGTCTCTTTTGTCAGTATATGGCTATTTGTTCTCTGGTTCCCTATCCTGAGCA
AAACAAATGGCTGCAACCCCTTCCTTACCTCTATGTCCTTCTGTCCACAAAGGGTCATTA
CACTATACAGTGGAATCCCTATTGGTCACAATTCTATTTCCCTGAAGGCCCAGGCTGTGC
CTTTCTGTAGTAGGGGCACATTTTTCCACCAGGTTTCCATTGGGAATGGGGATGTGGCAA
GAAGCAGCAGAGGCCATGTGAGGGGGTAGCAACCCTGGAGTTACAAATCATGTGGGGTGC
TGCTGAGTGGGTTTTTTCTTCTATTAGGAAAATCAGTTAAGTTTTTAACCTGGATTCTTG
GATGGTCTAGAAAGCTTGAAATTGTGTTCAGAGCTTCTCATCCACATGCTTACCTATCAG
TATCCTGTATGTGTTAGAGGTATAAAGTGCATATACCCTTTTTTCTGTGACTTCTAATCT
TCCTCCCTATCCCAAATTAAAAATATTTAAAGGGCTGGGCACTGTGGTTCACACCTGTAA
TCTTAGCACTCTGGGTGTCAGAGGTGGGTAAATTGCTTGAGCTCAGGAGTTCAAGACCAG
TCTGAGTAAGAATGAGACCCCCTTGTGAAGGACACTTGTAGTCCCAGCTAATTGTGGGAG
GCTGAGGCAAGAGGATCACTGGAGCCCAAGACTTAGGAGTTGCTGTGAGCTATGAGGCCA
TGACACTCAGCAAAGGTGGAAGTGAGACGGCCTCAAAAAAAATCTGAACTCGTGCATTAT
TAAATTTAAGGATCACCTTTGTCCTCAACTTGCCCCATACAAGTTTTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1004, 1722..1828, 2312..2411, 3425..3600, 3818..3947, 4460..4569
1001..1004, 1722..1828, 2312..2411, 3425..3600, 3818..3947, 4460..4566
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved