Otolemur_garnettii Locus TBXAS1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii TBXAS1
Otolemur_garnettii
TBXAS1
GeneScaffold_285
SNORA70
117344..117475
205998
TCCTCCACTGACGTTTCTCCACGTACATCTGTCCTCTTTGGATGACTTCTCCCATCATC
CCACGCGGCCCCACCACACCCCACCTTGCTGGCCGGCACCACAGGCTCCTCAGGTTTCAG
TGCCCTCTTCACGGGGCTGCTATTTACTGTCCTTCCCTCTCCGAGGAAAATTCTCCAGAG
CCTGGTCCCAACAGGAGCCTGGCCCCGTATGTGTTGGACAAAAGGGATGACTGTCACGGT
GAATGTTCCCTCTCTGACACCCTTCCCATCATGCAAGGTGCAAGATGCTGACTAAGGGGC
AAAAAACGATTCCGCCTGCGTCAGGCAGGTGAGCGCAGAGCACACCCCAGCCTGCAGGTG
GGCCTTCAGAGGGCAGAGGAGCCTTCCCATGCAGGACAAGAGCACCAACCCCGAGCCAGA
TCTTTGCAAACTTAGTCACTAAGAGGGGTCAGGAGACCCAGGAACTAATAGGCCTTGCGG
TTGGGCTGTGCCTAAAGCAGCCAGCATTTCTCATTAGGCTGATATCTGGCCTTGAATTTT
CTGGGATATTCAGAGACTCTTCTCTCTGGATATAGATACAGAGGCGTGGCTTGGAGGAGA
GTCTTTCTCTGAGGGCTACTTGCACGGCAGAAGTCTACGGCTGCAACCATCTTGCCTCTC
AGCAACTGTGGGGCCGATCTGCTCTTGTTTCCCAGGGAAACTAACATAAATGTTTATTGA
CAGTACAGTCATCAAGAAAATAAAGTTGCTGATTCATTGCCTTACCCTGGAACCCTTTTT
TTTTTTTTTTTTTTTGCCCTCCTCTTCCTTCCTCTTTATAAGGAGACACTCTGAGAAAGG
AGAAAGAGCACGTTTTGGGGACATTAACCAAATAACACTTGGGGTGTTATTTCCCCAGTT
GCCCATTCCTACCTCCACCTGCAGATAGCTATTCCTGAGACAGTGGTGGGCTCAGCCACC
CTCTTTCACCTGGAAGACCCCCACTCTGGGGTCCCAGAGGAACAATGGAAGCCTTGGGGT
TTCTAAAATTGGAAGTGAGTGTCCCCATGGTGATGGTGGCCCTGTTAGTGATGCTCTTGG
CCCTCCTGAAATGGTAAGTGCAGCCAACCCTGGGATTGTGACATTGTCGTAAAGGCAGCC
CCGGAGCCTGGCTGGTGCCAGGGTAGGGTCTGTGGGAGTGTGTTTTTCTTCTTTTCTAAT
CTAGAGGGAGTTGAGTATTAACACAGCTTCAGAATTAAAAGCAAACAGCCAGGTTAATCT
TTTGCTAAAATGCATGAGATTGAAGTGTCAGGAAAGGCTGGTGATTCAGTGACTGAGAAC
GCTACACATAATTAAGTTTGAAAGAAATGGAAAAAGAAACAAATTGGAAAGGCATTAGGT
TTGGGGAGAAGTATTTCCTCAGACCCCGTCATATCTTCTCACCTCGTTTTTCTAAAATCC
TCTTCCTTTGTTGGATTTACAGCAAATCCGGCCTCTTGGTTCATATTACATTAAAAACAA
AATAGGACATAGGAGCTGTTTGGCAAACGGGGTCTGCTTTGCCAGAAGTCCTTGACAGGG
ATCTCTGTGGGTTTAAGGACAAAGTGGCAGATCTGATTTCCTAGTGTTCTAATATTTGAC
AGAAGGGGACAGATTCTGATGAATGTAGCACATACGGTTCCCATAAAGTTGGAGACCCTA
AAAAAGCCTCTGATTTGAACTTCGATTCGCTCCCTTGTGGTTTTGTTAATTCAACGGCAG
ATTTTCCTAAGCCTGACTCTATGGTGTCTCTAGATTGATGGCCTCACACTATGTTACATC
CATGTATGTTCACCCTGTCACTTAAACTTCTTAGAGTTACCCCCTCAGTCAAAACCGCCT
GGGTTTAGATGGCTCCAGTATTTGAGGGGAAAGTGGAAAAAGAAATAATGCCGACCTGGA
GTTGGAACAGAATTGTAATTTATGTTTTCAGTGGTAATAAAGCCTCTTCTAGATTAATAA
CTGGGAGAGCACTTTGAAAAGCATCAAGCATTATGCAAATGGGAGGTATTATTCTTTTGG
AATTTGCATAGCTGAAAGTGGAATTCACGTTTGATGTTCTGTGATGATGAAATTCCTCCT
TGGAAATTGGCTCTGAAACCCAGCCTCAGTCCCAGTGCTGTTTTGCTTTTTAACTGGTTC
AATTATTTTTTGAACTTTCCTCAGTCAGCTTATCTTGCACTGAAACTAGCCCCGTGCAAA
ACCAAGAGCAAGTTGCAGACCCCTGTCCCCCAGCTCCAACAATCCATCTCACTGATTCTG
TGCTCACTGAAGCCCAAAGCACAGTGTCTGACATGCAGATGGTGTTTAATAGATGTCAGC
TACTATAATTAACTATCATCCACGTAACCTAAAAGAAGAAGAAAATAAGTCTTTAGTGGT
TTAGGTTTAATTTTATTTTCTTACTAATGTGCATATTTATATTAATCTCATGGTTAGTTA
TGCTCTGACTGTGGCTCTCAAAGTATCCACTTTTGTTCCTGTCTTTGTTGTGTCTGAACT
CCCAGTGCAGTGCCTGACTCACAGTATATCTGAGTTCAATCACTGTTTGATGAATGAATG
GGCAGCAACATGGCACCATTTAGCTGAGCGTTTTGCCATCTATTCTCGGGGACTTATTAA
TAACCTGGCTGAAAGACACAGAGATTAAGACAGAGACATGAAACAGAAGTGGTAAATAGG
AAGTGAGAGCTGACTTCCACTTGTTATCGCAAAAATATGCATCACTCTGTTAACGTGTGT
CCGGCCTGGAGGGCCGCCCTGGTACACAGTCAAGGAGCAGGTCTGGATTGGGTGTCCGAG
GTAGGGCAGACATGGAGGTCCTGGGGTTGAACTCAGCCACTGCAGGGGATGATGTGTGAG
AAGGTGGCCGTGGCTGTGGCCATGACTCTGGTGCTCATGGGTTCAGCCCTTGTTCCATTG
CTTCATTGCCAAGGGATGCATCTTTGGGCTTTTGACCCTCCTTTTCCGGGCAAGGTTCTA
GGCAGCTACTAGCTACAAGTTTGAATGGGCTGAGACCTCCCCCCTGCTTCATCCTAAGAA
GATACACTCAGGAGAGACGGGCATGCTTTTCCTCCAGCAATGAGATTGTCAGGCAAGGAG
AGGTGTGGAGACACTCACAGCCATTTTGCCCCAGAGGAAAAGCTATGGCTAGTGAAATGG
CCCAAACCCTTCAGCACATGCATCCTTCCAGAGTTACACCTATCACCAGGAGGGCTTGCA
GTGAAAAGCGTAAATCTGAGGAGGCACAATTGCAGGGGACCCCAAAGTTGCTTCTTGTCC
CCTCAACCAGCCTGTGAGTGCTAGAATGGTTAGGGCAAGGTTGCATATGTTGTTAAAATT
CTTGAAACCTCTGTCCATGACACAGATGCTCTGCTAGCCTTTGGTTGAAGGGGGTTCAGT
TAAGAAATCCTTACCCCCTCAAACTTATTAATAAGAAAAGAACAAGTGATCCCATTTCAC
TATGGGCAAGTGACCTGAATAGTAGCTTCTCCAAAGAAGACAGGTGCTTGGTCTACAGAC
ACATGAAAAAATGCTCGTCATCTTTAATCCTCAGAGAAATGCGAAATCAAAACCACTTGA
GATAGCATCTAACTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATAAATGTCTTAACACAATGATCAAGTAAATGAAGTGAAAGCTATGTTGA
CTGGTTTGATGTAACCACGTCAGATTGTATAAAAAAACAACACATTGTACCCCCACATAT
GCATAAATGTATTCATGATCTATGTGTATATGACTTAATTTAAAAAAAAAATCAAAGAAA
AAAGAAAAAGAAGTCCTCACCCCTCAGCCTGCACCTAGGCCGTGCTATCTGGTGCCTGCT
TCTTCAGCGGCCTGCAGCCCCTCTCTCCCCAACCACTGTGCTGGGGTTGTACTGAACTGT
CTGCCCTACTGGGGAAGGTCACGTTGCTATGTGCACGTGGCCTCTTCTTCCCTTCAATGT
TTCCTCGGTTCCTGTTTCTACAGGCACTTATTGGCCCCTTCTCAGCACTGCTTTTTGTTC
TGTTTTATTTTAATCAGATATCTCATCCTATCTTTCTTCCTCGCAATGACTGACACACAG
TTGGCATCTATCTAATAAATGTTGCCTAATGGGTAAATCCAGCCTCTAGTCTCTGCCTGG
TGTTTTCTCTCCCTGGTTCTCTCTGGGCCTTCACAGTTCCATTCACATCTCGGTTCTTTC
CTCCACATGCCTCGCCCCTTCTCTGAAAGCCTGTCGTGTTTTCAGTTGGTGCCAACTTGC
TGCCCCCCTTTTGAGTTGTTGCAGAGGTCCTGTTTTTATGTCTTCTCTCACCTTGTGGAG
CAGAGTCCTGGGCATGTGCTTAACAAACACCTCTTAAGTGTTTGGTGGATGTGGGAATGT
GGAGAGAAGACGACAAAAAAGTTCATTTCATTTAAAAAGACACTGTTCTGAACTAGGTGT
AGTATATTTTGATAGTTTTCCTGAAATTGCACTGGACACCGTTTTTCAGTGATGACCATT
TAGATTGGCTGGTGTGGGGCTTCAGGTGGTCAGGGTTGAAGATGGAGCTGGGGCGTGGAC
CGTATTAGCTGTAAGTACATAAGGCGGTGAACATACAAGATAAAAAATTTAAAAAACTTA
CTTTTCTATATAAAGCGGTTTGCAATTCTGACTTCTAGAAGAGATTTGATGTACGGGGAA
TAAGTTGTACCAGCTGAATGTTGCTCGAGGCAACCTTAAGTACTAGCATATTTAATCTTT
CAAGCAATACCTAGGAACTGGCAGCCGGACTCCTGAGGGAAGAATAAAGATTACTTTCTT
CTTTAAAGAAAAGAGTGTAAGGGAATAACCCAAATATTAGTAGTGGGTTTCGTTCTGGGG
TGAGGGTATTGGGTAATTTTATTCCTATTTTTAGTCTTTCTGCATCTTTCATATTTCTTT
AATGAGTATGAACACTTAGTAAAAAAGAAATTTCACTAAAAAGAATGAGCAATTGCTTCT
TCCTAGTAGTAAAGAGAAAAGCAGTTTTATGCGTCAGGCATGGTGGTCTGACCGTTTCTT
CTGGTGGAGTTGGATGCCAGGGGGACCTGGAGTGATGGGGCACTTCTTGGCTGATGGGGT
GGTGAGGCAGGGAGCAGAGGTGGAGGAGTCTGAGCAAGGTGGAGGGAGGCTGGGGGCTGT
TTGGGGAAGGTGGAAGCACTTCTAGTGCCAACCTGCATGTACCCTCAGGTCCTAAATCCC
AGAGATATGAATCAAGTCCACAAAAAACCCTGGAATTCAGAGTCTCATTTCAAGAGCAGT
TTCAATTAAAAAGTGATTATTGGTGATTATTATGACTTAAGCATATCATGGATTATTAAG
ACTTAATTAAGTCCACTGTTATACCTAGAAGTTTCTTTCTCAGGGAGCTTGCTTTACATG
TGAAAGAACTGGATTCTAATTCTAGACTCATATCCACTCCCAGACCATACTCATTAATTG
ATCATTTTTGGTTTTAGTTTTTGAGAGCTGTGTTACCCAGGCTGGTCTCGAACTGCTGGG
CTCAAGGGATCCTCTTGCTTCAGCCTCCCAACCGGTTGAAACTATAGGCATGTACCTACA
GTGCCTGGCTCCAGACTAGGTTTAAAAGGAACCACTGGGGGACAGAATTATGGGAGCCAA
GATGGGAACTCTTGAGCTCGTCAGAGAAAGAAGCCACTGACACATTCCCTGGTGCCATCA
GCAATTGAGCTCTAGAGAAGGCATCTAACCTCCAGCATGTGGGTATTGCAGAAAGAAGAC
CAATTTGCCCACCATTTCCCAAGTTCTGTTCCTAAAATTGTTTGGGAAATAAGTCAAGGG
GGGTCATTCTTGGAGATTTATAGCATAGCAAAGGATTCTTGCTTGAAGGATTCTTCAGCA
AAGAAATCTGTTTAACTTTCTTTACCCCAGCATTTCTTGTGTCTGGACACAGACCCACTG
TGTATGGCCTCAGAGGGAAGGGCAACCAAGACCCAGTGGAACAGTCCCCTGGAGAGGGTG
GTTAGATACCTTGGTGGTTGGGGCAGGTGCACAGCCTGGCAGATGTGCAAGGATTGCTAA
GCAGAGGAATGAGATGTTCAAATCACCCCTGGGCGAGCTCTGAGGTTGCAGGGTTGATGT
CTTGTTTACTTTAGGGCATGGAGCGTGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTAACGTGACTGATTATTCAGCATACACACG
AGAACTTATACCGCCAAATGAATTTTATGACCTTCAAAGACGTTTTCTTGATAGATCAAC
CTTTACTGCAGACACGCTGCTATCAGAAAACACATTCTTAGCACTTTTCTATGGGGATGG
TGCTTGGTGCTTAGATGCGATCTTTTCAAAACCCTCCAGGCAACAGATCTTTGTCAAGAA
TAGATTAATTTTTTAAGAAACAGCCTAAATTGTGGCAAATAGGTGATTAAAATGGGTAAT
ATTATTTGCAATCTGAAACAAAATGTGATTATCAAACAATCAGACTCGGAGTTGTTGTTT
TCTCGAAAGATGTCTGAGCCGGTTCTAGAAGCCTGGGGACTGAGCTGAAGGGCCACGCTC
ACTGGCACAGGCGTTGGTTTCTGTTTTTTAAAAAGAACAATAGCAAGAGTCTTAGTACTG
ATTGTCATATCTTCTCTTATCTGGTAAAGCATTCAGGCTTCCGGTAGCCTCTATTTTTTG
GGTGGAATGAGAGAAGAATCTCAATTGTTGTCTAAACAAAGAAATCCATCAGATTTCTAT
TTGTGTAGCTCGGAGCTGCTTGCATACACACTTGGCGCCACTTTTCCTGGGAGGAAGTGG
CTCTCCCAGAAATAAAGCTATTGAATAAATCCTACCCTGCCCCTGGACACCGTAATAACA
ACTAAGCTAATAGGCCAGGGTTTGCCACTGAAGGTAAGTGCCCCATCCTTAGGAACCTCA
GTAGCCTCATAGGGACTTGTTTCTATTGCAGGAATAATGTGCATCTGGATATAGGGACGG
GACTTGGGGGAGAAGGGGATGGGCCACAGATGGTCACGCTGTTGTTGATTGATATTTCAA
TTATTCAGAGCCATCTTCTTCCTGGGTTATCAGAAGTAGACAGAACCACTTCCTGCTGGG
CGGGGTAGGCAGGCAGCGAGGGCCCATCAGGGAGTTTCCAGGAAACCCGGGGCTCCCTGC
TGCCTTCCTCCCCGGCCCTCAGAGCAGAGTGGGGCGCTGAGCCCCATGGTGGAGCTTTCT
TAAACCTCCCACATGTCCTCGAGAACTCATGCCTCTTTAAGTGTTGCCTCACCAGACTGT
CCACTGCTCAGCACAGTCCCCCAAAGAGGAGAGACCATTTTTTTTGCCCTCAACTATACC
TAGAAAAATGGTGTCAGAGATGGTCTGAAAGCCAAGCCAACCTCTGCAAACAGTGGCTTC
CACCAAGGTCCTGTTTGTATGTACTGCACATGGACGCCCTGGAGAGAGCCAGCGCCATGC
TCCAAAACTAGGAACTGTCTCCAGGTCTGATGGGAAAGGAGCCCTGATCCTCCCACAAAT
TCCCTTCCCACCTGCGCACAGCATCCGTGTCCCTCCACAACACACCGTACCATCCCTGCT
GCCTGAATCCTACCCACCCTTCAAAATCCTGTCCAAATGTCACCCTCCACGCAGGTCCCC
TCAACCTGGCCATCCCTTGATGAGCTGCTGCTCCCTGTGGGCCCTCTTCCCGTCTCTGTG
GCTATCCTGGCACTTCCCATGTTATTTTATTGCTTATGCATGTGTCCTAACTTCCTGACC
TGACAATACACTCCTGAGGGCAGGGCCAGTGAGTGCCTCATACATGGTAGCTGCTCCATA
ATGTTAAGGACCATGTTACCCCTCTGGTAGCTGAGATGGTGACACTGTTATAACGCGTAT
GCTATGTCCCCACATTCAGCTATGTGTGCAAGGGCGGGGAGGATCGGTCTCCTTCTGACT
TGCACACCGGTAATACTATGCTTTCGGCACCTGGAAGGATGCCTTGCATGTGGCACTCTT
TATTGAAATAAAGAAATGACTTCTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAGAACAAAGATATTGGTGGAGATTACAGGGCACATGTTTATAAATTTTGTTTT
ATAAGTCAGTAGCATTCCTGGCCCATAGCAAGTGCTTAGTAAATGTTAGTGACTGTTAAC
CACAGTCTTCTGAAGTCTTGAAATCCACTTTCATCCAGCCCAGTATGAGTTTCCCTATTT
TCCTTTTCTAATGAAAGCAAATCAGATCTTATCTATTCTCCCAGGGATGTACACATGGCA
TCTGGGACAGTACCTGACACAGAGGTAGGCACTATCTCTATCTTTACGGGATGAAGGATG
GAAGATCAACATTTTGTTTCAGTATCTCATCAGAGGACATAGATTACAGATGTTATGAGG
CTTAGTAAACAGCTTGAAATATAAAAGGTGAAGTTTGTTCATACCAGGGCATAGGTAGCC
AGCCTCCAAGATGGCTCCAAATGTCCCCGCCCTGATATTCACACCCCTGCCTTGTTCTGG
CTCCCATTGTACCAGGGGCAGTCGGTGTGACCAACAGAATACAGTAGAGGTGACAGCGTG
TCACTTCCAAGGTCAGGTCATTAATGACTGAGGCTTCCATCCTGGACGCTGTCTCTCAGG
TCGCTGTTTGAGGGGAAAGGCCCGCACGGCAGTGCCTGCCCACAGCTACGTGAGCCCATG
TGGGAGAGGTTCTCCAGCTTGACTGTAACTTTCTGGAAGACCCTGAGCCAAAACCACCTG
GTTAATCTGGTCCCAGAGTCCTGACCCCTAGAAATGCGAGATGACAAATGTCTGTTGCTT
TTAGGTCACTTAAGCTTGGGAGGGGATTGCTGCACAGCAGAGAGTCACTTATACAGGCAA
AGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTCAAGGGATGG
TAACAAACTGGTCGACTTACAGAGGTGGTCAACATAAGGCACTAGGCCTGCTGTACTGGT
AGGTACATATGGTGCATGTCCAGTCTATGAAAATTAGGTCAACTGAAGGAGGTGGTCAAG
TATGGAGGTTCTGCTATATTTGACTCTGTTAATGTTGAATATATGTCAACTGAATGATGA
TGAATATATGAATAATGTTGAATATATGTCATCAGTTGTGTAGAGGTAGAAAAAAGATTG
AGTATCATCGATTATAATCCAATGACCTCATTTTATAGATGCAGATATAAAGTTCTGGAG
AAGCAAAATGCATTGAACTGTGTTCATCAGATTTTTCTGCAATGATGCTGTGTAACAAAC
TACCCCAAACACACAGTGATTTTTCTCATAGTGATCTGTGGGTTCAGGGTGAGGGTACAG
TTCAGATCTGCTCCACATGTGTTTAATGGGGAATAGGCTGAGGGGGATTTGGAGTACAGA
AAATGCAAAATGAAACAGCAATGTCTCTGGAAGCCTCATCCTACAAACGGCTTAAGGCCA
CTTCTGCCCACCTCCCATTGGCTGAGTAAGCCATATGCCCAAGCTGAACTTCAATGACAT
GAGGGAGAAGAGTATGCATTGCACAGGAGGGACGGCAAAGCCATGTAGCAAAGGGCATTG
ATACAGAATTTTGATCCAGGCCTAGCATGAAGAATCGGGAGCAATGATTTAATCTACCAC
GTGCTCTAAGATAACGTCTGGATTCTGAAAGTGGTCATGAGCAACGAGACAAAAATAAAA
CCATAACTAAAAATAAACAAGAAACTTAGAGCTAATAGACACTTGGATTTTTTTCCCCAA
GACACAGGGTCTTTCTCCATTCTCAGGCTGGAGTGCAGTGGCACCATCCTAGCTCACTGT
AGACTTGGGATGCCTGGACTCGAGCGGTCCTGCTGCAGCCTCCTGAGTAGCTGAGATTAC
AGGGATGAGCCACCACATGTGGCCAACATTTGGATTTTTTATTGTGGATGAAAGAATGAT
GGAGAATTTGCCAGCTGAGAACACTGACATGGCAGGTCATAATGGGTCTTAGCTATGGAC
TGGTGACCTAACACCAAGGGTGCTGAAGCAGGGTCCAGCACTTAGTAGAGAGGCTCAGGT
TGAGCCTATACTGATCCTGGGACATACCTAGGAATTTCTAGCCAAGTGGAAGTGAGGGAC
TGCCTGGTGACGCAGGTAGGGGATGCTTTAGGAAGAGCAGATAATTGATCCAGGGGACGG
GATGGGGAGGCGTCGTAGGATTTCAACTCCAGTCTGGAAAAGCAAAACAGAGGGAAGGCA
TGTTTGATGTCCAGAAGAACAAAAGAAACCCGAGTGCGGAAAGCACAGTTGCGTTCACCA
TGCCCTGAAATACAACAACCAGGGGACACCCCCACAGACTGTGAGCTGTATTGCTTAGGA
CAAATTCATTGTTCTGCTCTGGGCAGTAAATTTACAGATGTTGTTATGCCAAGAAAGGGC
TATGGCTGAAAACATAAATAGCTCCAGATTGTTTTAAATATTCTCATGGGCGCTAGAGCC
CTCCTGGGTTGGTAAGAGAAAAACTGTTTATCTGCTGCCCTTCTGGAAACCTCTCCTTGG
ACTGTCTAGAGGCTGTTAGGAGAAAGAGTGCGTCTCTGTGTCATGGGGCCCATTCCACAC
TGTGATTTTCACTTGGGTTTTCAAAGATAAGAGACCCTTGTCGCTCTTCCACGTTCCTCC
TTGTCGTGCACACTTACATGGTCTCCTCTGGGAAGTCGCTGAGAAATCTGAGCAGGGTGG
CACCCCTTCAGTCCAGGAGCAGCCACAGAATTTCACTTTCTTTTTTATCCCATAAAAAGG
ATGTGCCGACTAAAACAGAATAGTGCAGTAACAATAAGTAGCAAAACAAAGCATGAAAAC
AAAGCACAACATTCAGAGTGAGCCGGGAAATAAATGTTTTGAATTAGTATCTTCTTTCAT
TAGGGCTGGTTCTCTCCGTCTGATACCCTCGTGTCCTTAGGGTGTCAGGCCCTTGCTGCT
GATCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCAACCACATTCCCGAGTATTGAAACTCAGGGACCTCAGA
CTGGAACTATCACCTTTTGACCTTTGTTTTATACAATTTCCAGTTGGACCCACAGTTGAT
CATTGTATCTAAGAGTTGATCAAAGTCCAATGAGTAAACTTGCCAAGAATTAGGTCAAGG
CAAAGATCTGGGGATTACAGTAACAAATGTGGTGCCGTGGAATTATAAATATGTTTTGAA
ACACTCGTAATATTCTTTTGTTGCTTTGAATCGCCCAACCTCTTTAGCTATCTGTCAAGC
TGAGAGTCTGAATGGGGTTTCCCAGGCCTTTTCCAGTGGGTCACAGTGCAGTAGAAAAAC
AGAAATAGGGCGGCACCTGTGGCTCAGTGAGTAGGGTGCCAGCCCCATATACCAAGGGTG
GCAGACAGGTTCAAACCCGGTCCCGGCCAAACTGCAACAAAAAATAGCCGGATGTTGTGG
TGGGCACCTATAGTCCCAGCTACTCGGGAGACTGAGGCAAGAAAATCGCCTAAGCCCAAG
AGCTGGAGGTTGCTGTGAGCTGTAGTGCCACAGCACTGTACTGAGGGCAACAAAGTGAGA
CCCTGTCTCTAAAAAAAAAAAAAAGAAAGAAAAAGAAAAACAGAAATATTGGCTGGGTTT
ATGAAGATATAACCTCAAATCCAACTGGCAACTGTTTTCTGAATACCTGCTTGGCTAGAT
ATGAAAGGACTTAGAATCTTTTACACGTTCGCGGCAAGTACCCAGAGCTCCGTATACCTA
CCTTGGCTACACAGAGATACTTAAATTTAATCAGTCAGAGAAACTTGTGTGCTCTGCACA
GGCCAGGTCTTCATATTTATTTACCTGCCCTGGTTTTAAGTCTTGGAGCCCTGCTAACTT
AGTGGCTAATCTGATCAATTGATTTGAACCCTCCCTTTTTTACAGGGGCCTTAGAATCCT
TAACCCACAGAAATGAATAAAATAGAGTTTCCCACATGCCTTATGGACAGGTTGGAGTTT
AGGCAATTTGCTGCTCTGCAAATGTAAAATAAGAGACAGTAACACCCAGTACTAAAGAGT
ACAGACTCCAGAGCCAGACAGCCTGAGTTCAAATCTTAGCCTGGCTACTTACTAGCTGTG
TGACCTTGGGCCAGTTACTTAACCTTTCTGTGTCTCAGTTTTCCCAGCTACAAACGAAAA
TGATAATAACAGGACATCCCCCCGCAGAGTGTGCAGAGGACCAACTGAGTTCATCTGTGG
GCAGTACTTAGAATAGCTCCCGGCCACGGGAAACATGCTCCAACCGCTCCCTCTCTTGCT
CCCTTTTATCATGCAGGACACAGAGGCCGGCTGCAGCTCAGGCTGCCCTCTCTGGGCTCT
AACGTCATTGTCCGTCGGGGTTCACCCAAGGCAGATGTCCCTCTTTACCACAATGTCTCA
AGGGTTCTTTAAGGACTTCATAAAAACAAAGGATTAGCTGCAAATGATTAAGCCCAAAGA
TGATGGAAACAGAACCGGGTACAGTAAATAATGATCTTAGGCAGGATTATATTCCTGCAA
ACAATGCAGCGTGTTCTCCCCGCTGGCTCCTGTTGCCAATCCTCAGTAGGGAATTGATGG
GACTCCTTCAGTGGCCAAGGGAAATGTTTCTGTGTGCCCAGGACCGTCTAAGTGGGCTCT
TAGAGGAGGTAGCCCTTAAGCTGAGAGCTGAAGACTCACCAGGATTCACCAGATGGAGAA
AGAGGGAGGCCACGCCAAAGGAGAGAAGAGTGGGTGGGGACCAGGACAAGGGAAGCAGGC
ACCTGGGGTGCAAAATTTAAGGAAGTCCCTGTTTTCAGGGTCATGCAAGAGCAGGGCTGG
CATGTTCACAGCTCTGAGAATGATGGCTTCCTTAAACTTTTTGTCCTAAATGCCTCATTT
GCCTCACCTGAGTTCTGGCCTGGCAATGAGCCCAGGCAAAAACTGGGAAGGGTGAAACAA
CATGGCAGCACCAGGAACAGACAAGTCAGGCAAGATTGTCAGAGCCTAAAGGGAGACAGA
GACCATTTACAGTGTGGCTAGGACTCATGTCATCAAAGGCCCCAGGTGCCAAATAAAGTA
AGTTAATTTTTGTCTGAAAGTGATAAGGAGCCAGCAGAGAATTGTGAATGATTGCGACCT
GGTCAGATCTGCACATTAGCAAGAGTCTTCTGGCCTAGTGTGAAGGGCTGATTGATGGAG
GAGGGGAAGAAACTGGAGACTGGGAGGCCAGTTCAGGACTCCACTGAAGGGTCCCTGCCC
CAGGGAGAGATGAGGATGGCCTCAAACAGGGCACTGTCAGCTGGGAGTGAAGGTGAAGAA
CTCACTCGAGAAATTTTGAAGGCAGAATTGACCATATTTGGTGACTGATTGCAGATGAGC
ATCAAGAGAAAGAGTCAAAGATGGCACTGAGGTTTCTACCTGGTGGTGGACTTGAAGCCA
CGGGGAGTTATTAGGCAAGATGAAAAGTACGAGGAAGGTGGTTAGTTATACGGCTCCCCT
AAGTCCAGGTTAAACCCTTGGTTGCCTCATTTGTTTTCTCAGGACAAGCTCTCTGGGGCT
GGGTGGATATACCCAGCATCATTATACGGTGTCCACACTCTGTAAGTGCACTGAGCTGAA
TTAAGTGGCTGTGGCCCCTCTCTGTCCTGCTGATTTGCTCCTAAGCAGCCTTGGGATGCT
ACTGTGGTTTGAAAGTTTGTCCCCTCCAAACCTGGGTCATGGGTCATTCCCGCAGGAATG
GCCTCCTCGGAGAGTCCCCACCACCAAGAAGGCTCTTTACCAGAAGCAGCCTGTAGACCT
TGGGCTTCTCAGCCTCCGTAACAGGAAGAAATAAATTCCTTTTCTTTGTGAATTATCCGG
TTTGGGGCATCCTGTTATTAGCAACAGAAAAAGAACTAGGACATGTGTGAATGTCCTTTT
AAGGGTGGCTGTGCTGCTGGGGCCTGACGAACACGGCGGTGCACCCAACCTCCCACCTGG
ACACGCAGGACCTAGGGCTCTGACTTGGCTGGGCCGTCTTGCATAGGAGCCTTCAGTGTG
ACCAGATGCCAGGCAAGGGGCACAGGAGGGTTGGCCTGTGGCTCTGGGAGGTAGAGGTAG
AGGTGAGGGAGGAGATCAAGAGGATGATTGAGCTGCCTAGCGAGGAAGGCTTTATGAAGG
TCAGTTTGGGATCAGAAAGTCAGCCAGGGAGAGGCAGGGTGGAGGGCTGTGGCTTCTGAG
CTGCTGCCCAGAAAGGCTGACTCAGCGGCGTTGCGGGGAGAGGGAAGAGTCTGAGGCAGG
GGGAAGTGCTAAGGCCACAGGGTAGCACTTGGAGCCACATACTGGGTCTAATTTCCTCTG
ACCCAGGCAACAACATGCTGATCTGTGGTCAACTAAAGCTCTCAGCTCCTTTTCTATGAA
CTGCAGTGGAGCCAGGACGTACCCTTCCTAAATTTGAGAAATTTGAAAGATACCTGCTCT
GCTTGTATTTCTCCCCATTTTCATAAAATAAAGCAAGTGAAAAAGGGAGCCTGAGCTCTT
TGAAACATTAATTAAAGGCACCACAGTTTTCTTATTTAACTGAGAGTTGCTGCCTCATCT
GGGATTATTAGCAAAGCAAGAGAGCCTTTGTTGTGCTTGACAAAGTGATTAATTCAGACT
CTAGTTGAATTTTGGCTTTCTCAACATCTTTTGATGTGCTAAGATGCCCCGATGAGGACA
ACATCATCAATTACTTAAACAAACTATTACCTTGAGAGCACAATTATCAGTTAGGCCCAG
TCTACTAATTGGCAGAGAGATAGGAATGAACTCAGGGTTGTGGCTTCAACCCTTCCTTGT
TCTACGGGTGCGAGAGTCCTTTCAAATGTCTTGTGGCAATGTTCCTGTTGAGCTGGGGGT
GACAGAGTTATTTTTCTACCTCTGTGAAATGTAACGGGGGTGACTTGTGTCTCTAGAACG
AAAGACCTACCTGTGATTGCTGACCCGGCATTATTGTGGGCAGGCGACAGAGCTCAGCAC
TGGGAACGTGAGAGACAAGTTCATGGGTGTGAATGTCCTGCTCCAGGGCTGAAGAGCAAG
ACCAGCCAGGGGCTGTCCTTGTGGTTCTGTGGGATACTCCTCTGGGCTCACTACCCTGTG
ACCCAGAAGGAATTCAAATCTAGATACAAGAGGCAGCTTATTACACTGAAAAATATATAA
ACATATAAGCTTATACAATATTTAAATAGATTTTTATTTATACACTTAACTAAGCCATTA
CTCTTCATTTTTCTCTCAGTCCTAGAAAAGAGTTTTGGGAGAAGGTTTTATGCTGTGTGC
ATATTCAGGCAAGTAACCAATACGTCAAACAAACAAAAAACACCCCAGAAATGTTTCTTC
CATACCAGCCACTTTGATGGCTTCATGACATAATTCAATTGCTTTGTCTGTTTTTACAGT
AGAGACCCAGGTTGGATGTCATGTTGTAACCCCAGGGCTTGCTGTGTCACCATCATTCTT
GTCCTTTAATTCTCACAGGGACTAAGGGGCAAGCCACTATCCCAGGATCCTGGGAGAGGC
CAGGCTGGATTTTCTTGGACTGAGATGGGCATTTTTGAGGGCACCTGGGCTTGTGAATCT
TATCTCATATGCCAAAAGTGATTTCGAAGAGGTGATTAAATTAGGGATCTTGAGAAAGGG
AGAGTATGCTAGATTATTTGAGTAGGTCCCACACATAATTGTGAGGGTCCTTATCAAAGA
AATGCAGCAGTAGTGGCAATGTCAGAATGTAGTGTGATGGCTGAATGCAGACGTTTGAAT
ACTGTGGCCACAGCCAAGGAGAAAAGGAATGGACACTCTGCCAGAGCCCTCAGAAGGGGC
CAACCCTGCTGACCTTCAATATCAGATCAGTGAGACTGACTGTGAACTTCTGGCTTCCAG
AACTGTGGAGATACCAAAGTTGGGTTGTTTCAAACCAGCAAGTTTGTGGTTGTTACAGCA
GCAACAGGAAACTAATACAGTTGGAAAAGATTAGTTGAATTATAAAAAATTCTTCAATTC
TAACCAGATTCACTATATTGATCTTTTATGTAAGGTACCTATTATACATTTGAAACAATT
CTAATGACAAACAATTCAATTAATGAGTTTTAAAATCTATTTGCTTTTGAATAGGCCTTC
ACGTGGTGGAAGCATCAAACATGATATCATCAGTTGAATATCTCACGCTGGTGACATGCA
ATAATTTGGGATCTTTATGAACTCATGGACTCAAATCTCCTTGATGTGTTTTGATCATTG
CAATTATCACTTGATTGATCAATTTGTCCATGTATCAATCTTGCTCATCTAAAGTCAAGG
TGTTGACCGGGCTGGCTCCTCCGGGAGGCTCTGAGGCAGTGTCTGCTCTTTGCCTCCCTG
GTTTAAGACCTCTCACTCCAATCGCTCCTTCCTATCATCACATGGGGGGGGCAGTCATGT
TTTTGGCTTGAGTAGTTGGTGGACTGTGGTTGCAATGATGGCCCAGAGATGATTAAGGGG
CAAACAATTTAGAGGGAAAATTGAAATCAGATTAGACATGTTAAGTCTAAAATGCCTAAT
AGACATTCAAAGGGGGTAAATAATTTGGAAGTTGGGTAACGAGGACTGGAGCTCAGTGGA
GAGAATATAGCTGGAGATAAAAATGTAGAATTATTGAGGTGGCACGTATGGCTCAGTGAG
TAGGGCGCCAGCCCCATATACCAAGGGTGGCAGGTTCAAACCTGGCCCCAACCAAAACTA
CAACAAAAAATAGCTGGGCTTTGTGGTGGGCACCTGTAGGCACAGCTACTTGGGAGGCTG
AGGCAAGAGAATCAACTAAGCCCAAGAGCTAGAGGTTGCTGTGAGCTGTGATGCCACGGC
ACTCTACCAAGGGTGACAAAGTGAGACTCTGTCTCTAAAAAAAAAAAAAATAAAGAATTG
TATTTCTATATATTAGCAAGGAACACTGCAAAATTCAACTTTAAAAAATTACCATTTGTG
GCTCGGCGCCTGTGGCTCAAGCGGCTAAGGCGCAAGCCACATACACCTAAGGTGGTGGGT
TCAAATCCCCAGCCCGGGCCCACCAAACAACAATGATGGCTGCAACCAAAAAATGGCCAG
GCGTTGTGGCGGGCGCCTGTAGTCCCAGCTACTTGGGAGGTAGAGGCAGGAGACTCGCTT
GAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCCATGGCACTCTACCCAGGGGGAT
AGCTTGAGGCACCGTCTCAAAAAAAAAATTACCATTTGCAATAGCATTAAAAACCTTGAA
ATGTAAAATAAACTCAGCAAAATATGTGCAAGATCTGTACACTTAAAACTGAAAGATGGC
TAAGAGAAATGGAAGAAGACTTATGTGATTGGGGAGAGACATAACATGTTCGTGGATCAG
AAAATGCAATATTGTGAAGATGTCATTTCTCTTAGACTTGATCTAGAGATTCAGTGCAAT
GCTAGTTAAAAATTCTAGTAAGCTTTTTTTTTTGTTTTTCTTGANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGGGATCGGCTTTAGATGGGTGAGGACTCCCTCCCT
TTCCCTGTTTCTCTCACCATGATCATCAGTTCATTACGATCTGTTATTATTACACCTTTG
GTTTCTAAGCAACCTGCCTGTGTTCTCAGGATATTCTCTGCATGTTCTCAGGTGGTGGTT
TATCCACAAAGTCCTGGCCTAGAGTGCAGGAAGGAACAGGTTAGGAGAGTTAGTGAATAG
CCTGTCTGAAATGCGCTGACCTGGTTTCAACTCTCACTGAATTACTTTGCAGCGCTGTCA
CCTTGGGTACACTATGTCTGCTCTCCAAGCTTTAATTTCCGAATCAGTAATAGGAGAATA
ATATTCTACCTTTATGCATTAGTAGAAGGTTTCTATAAGACAGTGTGTATAAAGCACTTA
GCATGGGGCCTGGCACATAGGAAACATTAAAAACTATTATAAATTATAATAATAGTAATG
ATTATATGACTCTTTCTGTCTGCATAAATGCATAATGTATTTTTCTTGTGTTTTGACAAA
GTTGTTGTCTGGATAATGACTACAATGACTATGGCTTTATGGTACTTAAATTCTTGGGGG
AAAGAACTTCACATCAGCCAGATAGTTATGTATTTACTCAGTAGTCCTCTGTTTTCCTTC
TTTTTCCAAAGGAGTAAAGGTAATAAACAGTCACCTTTCTGGACCTTTAATGCCAAATCA
TAGTGACTGTTACTCATTAAATCTTCTATGTAAGGTCTTGCAACTCCAAAATATCAGTCC
TTCTGAGGTTTGTTTGTGTGCCTATTAGAACACATGTATGCTCAGAAATTTCCTATTAAA
ATGCAACTATTGGACCAAGAAAATACTATGTTTCAAATTGTGTGTGATATAGTTAAAGGA
GTGCTCAGAGGAAGATTTATAGCTTTAAATGCATTCATTGAAAATAAGTGAGCTGGCTCA
GCGCTTGTGGCTCAAGCGGCTAAGGTGCCAGCCACATACACCTAAGGTGGCAGGTACGAA
TCCCCAGCCCGGGCCCACCAAACAACAATGACGGCTGCAACCAAAAAATGGCCGGGCGTT
GTGGCGGGGGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCTTGAGCC
CAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCCACGGCACTCTACCCAGGGGGACAGCTT
GAGGCTCTGTCTCAAAAAAAAAAAAAAAAGAAAAGAAAAGAAAATAAGTGAGCCAAGCCA
TTAACTTAAGAAGCAGAAAGAAACAACAACAAAGAACAAAGAGTAAACTCAAAATAGAAG
GAAGAACACAGTCCAATATGAACATAAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCCAAAGCAGCTGAGTAGCGGGAATTCTTTGATGGTGACAGTGAGGATGAA
TGAACAGACCTGGGAGCTGGCTGTATCAGGTCACACGGTAGGAGAAGCCCACTCCTCTGT
GGCTGCTGGAGCTACGCTGTGAGCGAAATACCAGAGGGCGGCTTATCATTTGACCATTTT
CTTCTTTTGCTCCAAACTTCAATCAGTTTGACTATCTCCTTAGCACATAATTCATCAAAA
TATCCCCCAAATTTTCCCGAGTGGCTTCTTTGACTGAACAAGAGGCTAAGCACCTGTGCC
GAATCTACCAAGAGAGGAAATTTGTCTTGAGGGACATGAAACACTGGGAACTCTTCAGCC
TTTAGAAGTTGAAACTTATTTTGAAAATGACCTGTCTGGTTTAATTTATTTTGAGAGCGG
ACAGTGGAACTTGTCCCACCAGCACTGCAGGACCCACGTCATGTAGCATTTAACGACTGC
TCGAGTTGTGAAAATAAAACCAAGGGATGCTATCTGAAGCCACACGTACTTTCCGTTGTC
ATTTTCCAACTTGAGTATCCTTAATGTAAACAATGACAGATGTGCATAATCATAATTGTG
GGATACATTTGCATTAATTCCCGTCAAAGGAAAGCTGTTCTAACTGTCACAACGCGGCGA
TCGTGTGATGATTGCATATTACCTGCTTTACGCAGCAGTAGCCCAGGCCACCTGTACTTT
TTGGATGGCACAGGATTTAATGACATAAAAGATAAATTTTTTTCACAATTTTTTGACCAC
TTTTAAAGTAACAGGATTGTTTAAAAAATTGAAACGATCTTTTCATTGACTCTCTAAAAC
TCACGCATGGGAGTCCCTGGTGTATCACTTTCTGAAGCCTGCCATATCTAAGAACCACAA
ACTGGGGGACCTAAAACGACCAGAAGTTTATCCTCTCCAGAAGTTCGAAGCATGAAACTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATTCTGGCCTTTTCCTGGCTTATAGCGGATGACCTTGGACGTACCTTGGCT
TATAGTGGCATCGCTCCAGCCTCTGCTGTCACAGTCACATGGCATTTTCGCCTCCACCTT
CTTACAAGGACACCAGTCATACTGGACTAGAAGTCCCTTCTACTTTGATGTGACCTCATC
TTTTTTCTTTTTTTTTGAGATAGAGTCCCACAGTGTCACCCTCAGCAGAGTGTTGTGGCA
TCACAGCTCACAGCAACCTCAAACTCTTGGGCTTAAGTGATTCTCTTGCCTCAGCTTTCC
GAGTAGCTAGGACTACAGGTGCCCGCCACAATGCCTGGCTATATTTTTGTTGCAGTTGTC
ATTGTTGTTTAGTAGGCCTGGGTTGGGTTCAAACCTGCCTGCCTTGGTGTATGTGGCCAG
CACCCTAACCACTGAGCTATAGGCTCAGTGGTCACACTCTGAAGTCCTGGAGGTTAAGAC
TTCAACTTACTTTTGTTGGGGGGGGGTGACACAATATGGTCACACTCTGAAGTCTTAGAG
GTTAAGAGTTCAACTTACTTTTTTCAGGGGTGGTGACACAATATAGTCACACTCTAAATA
AAGTCTTAGAGGTTAAGAGTTCAACTTACTTTTCTCAGGGGTGACACAATTCAACCCATT
ACATGTGGGGTCCATGAGTTTTGGGTTAAGAACCTATTGAGACAGTCAGAGAAGGTACCA
TTGGGACCCTGGGACCAGAGAGTATGCAGCCAGGGTGCAGAGAGGGATGTGGAAGGGAGA
TGAATGGAACCCACTTTGCAATTTTTCCCTAAATATAGTGGTGGTGATCTCTCTCTCTGA
ATATCTGAGCACAGAGACTCTAGACACTGATGGCCATATTTGGCCAATATCCAGCTGAAG
GCACTTGAGTTCTACACTTGAGTCCAGGCTGCAAAGTGAAGTTTGTGTCCAAGACACTTT
CTGCTGGTGCCATATGCTTGGAAATGTCTGAATTTTGTGCAGAGACACACGAACAGTATT
TCTCTAAGAAGAGTTACATAATTAGGGCATGGACTTGCATAATAATTAGCATGTGTAATT
AGGCACAGACTTCTTGTCCTTTAGACAATCAAGACATCTAATTACAAAATTAAGATGTAA
TTACGTGGTCTGAGATCTACATATTTCTTTCTACCCAAGAGATTACGTTTAGAAAATAAT
TCACGAAAACTGATGAAGAAACGATCAGAGATACCCAATTTGGGTATGTCAAGGAAAGCG
TTAAGTGGGCTGATGAGTCTTTTTTTGGTCTTTGCCTTTAGGTAGTAGGGGAATAATTTA
TAATATCACAGTCTACTTGAAAGAATAACTTTACAAACTGTTCTGTCAACCTTTGGGACA
CACGTTAATGAAGAGGAATGTTGGCGTGACTAATCTGTGGCACTCACACGTGGCTCTTGA
GTGTGGTTTGTAATTACACTTGAACATGGATACAAATGTGATGTTCTGGGAATTTATTCA
AACCTAATAATGCAGCCATATGATGGCGACCTTGGGAGAGCTGGGAGGAGAACCTGCCTT
CCCCTTCCGCCCCACCGTGGCTCTCCCTTAGGGCTGCTTTACAAACAGACCCATTGCAAA
GTGGGTAAAGTCCATGAATATAGTGGTGGTGATCTCTCCCTGAAGATCTGGGCACAAGGA
CTCTAGATACTGATGGCAATATTTGGCCAATATCCAGCTGAAGACACTCAAGTTCTAAAC
TTGAGTCTAGGCTGCAAAGTGAAATTTGTGACCAGGGCACAGAATAATGCAAACCAGTAC
TTACTGTGTGCTGTCTTTTCCCTAAACATTTGAGTATTTGCCAAAATGTTCTCATTATAA
GTGCTCCCTATTGAACTTCAGGTGAGAAAGGGAACAGTTAAAGAATATAGCAAAATTCCA
TCTTTCTAATAAGCAAGAGATTCGTACAGCAGTGTTTTTTGGATTCCTAAGGAAGCCAGA
TTGTAGCGATATTCTCCCTGTTTTTCCTTGCCCCTAAATTGTGACTTGGCTGATCTCTGC
GTATTGCTAAACACCCAGTTTAACTCATTAATTTTTTTTTTAAATGGACTGAACTTTTGA
CCTAATTGGCTGCTGGTTAGGGATCGGAACCATATGTCCAGGTTTTTCTATGCCAGTTCT
AACTTTAACTGTGTTATCCCTCTGTTCCTATAAATTGTTGAACTACTCTAGTCATTCCAA
TGTTTTGACAGCCACACTGCACTTCTCAGACTGCCACTTTCTTCTGGAAAATGGCATAAA
AATCTGTTGGACCACGCTTCCTGATTTTGGCTAGAAAATACACTACCGTATGCTCGCAGG
CAGAAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCTGAGCCCGGCAA
GGCTTTCCCCATGACGCGTTGCTCTCATCCGTGTCACCCCCACCCGGCGTGGACTCTCTG
TGATGTGAGGAGCCCTCCTCTGCTTGTATGAATTCTTATGTGAGGAAAATGATCCACCTC
TTATCAGTCATCATTACATATCGATTGCTGTCATCCATTCATTCACCCATTCATTTACTA
GAACGCCTAAATAGGCTTGGAAGAAGTAGAAGTTGCTTGTGCCCTCAAATTCACCATCGA
CTAATGGTGTTCAATTCCAAATGAGCTGTACCCCAGTGCTAGACTGGGTGCTGTAGATGG
GAACTGTGGTCCTCCAGATGGGAACCGTGGTCCTCCTTCAGAGGAGATAGTGATCCATCA
GGGCTGGAAGCACTCTGGGAACATCCTACATTGAGATAAGGACACATACACCAGGTGGGG
CCCAACACACATGTGAGAGCCCCAACGTGAGAATGACACCACAGATCACCCAGTAGCCTG
GAATGACTAGGAGCCAAAGATCTGGGAGCACTGAGAGTGTGAGTGTGTGAGAGGAAGATG
GTGGATTATGTACAGGCTGGACAGGCTGGCGAAGAACTGCTCCTAAACTGACGTTTCTGA
GTGGGAGAGGGGCATGAGAATGGAAGATAACTCTGCAAGGGGCAATGCACGTCAGAGCCA
TAGACTCCATCTGTGGCTGAAGTGCAGGTGTAAGTGATGAGGGCTTGGCTTGGGGTGGTG
CTGAGAGCAAAGGGAGTGGGACAAAGGGATATACACATTTACTGCTTTGCGAGTGGATTT
AACTTATCAGTTGAGCCAGGGCTCATGAAGCATATATAACTCACACATCTCTCGACTATC
TTGACTAATAAGCACTGTGTCCTAAAGAAAATGTTTTATTCTAGGGTGCCATCAGTGTGT
TTAAGAACTCTTCTTACTGATTAGGCATAAAGAATTCGAGGCAAGGCAGCACCTGTGGCT
CAAAGGAGCAGGGCACCGGCCCCATATGCTGGAGGTGGCGGGTTCAAACCCAGCCCCGGC
CAAAAACTGCAAAAAAAAAGAATTTGAGGCAAAATGAGTCGAATGTGAGTCTAAGTTTTA
AGCTGGGGTAACAGGAGGAGTGGCCATGAGTTGACAAAGCTAAACGTTTCGGGGAGAAGG
CATATTTTATTTTAAGTACGTTGTCTTTGGTTTGCCAGAATGTCATGTCGGCGGACACGG
CCAGTGGGCATCTGCAGATACAGGCCCGGATTCGATTTTCTAAGATTGTTTTTTTTCTTT
CATTGGTTTTTCTCAGAAACCATTTGGTTTCTTCTGCTAACTCATGGGGACGCTGCCACC
AGACCCCACATCAGAAGCTGACAGGTCCTGTGTGTGGACAGCCACTAAGCAAACAAAGGC
AGGAAGAAGGAAATTGGGGCTAATCTTGATAATATTTCTTCAACATCTCCTTAGGATTCC
CCCCACTCTCCACCCCCGGAAAGGCTGCTGCTTGGCACTAGATAGGAAATGACACCAGCT
ATTTCTGTCTTTTTTCTTCTCTTCCCAATTTCTTTTTTATCCTTTCTGTCTGTTTCTCTG
TCCATCGCCTTTTCCCACGATTTGTTGTTGCTGTTACCCTCATCCCAGCATTTTAAAATG
TCTTCTTCTCTCATCTCTGTCGGGGATGGGCAGTTCACAACTTTTAAGCCATCAAACTAA
CTCATTGAGGCTTCCTGTGAGACTCTTGAAACAAGTGTGAAGAAATTTGAAAGTGTCAAG
ATAGAACAACAAACCAGGTCAGAAACTTAAAGAAAGTGTATTTCACAGATTTGGGGGAGG
GGTGGGAACAATCAGTTGTATTTGGTTCAGTAATTCACTCGGTATTGACATGTGGAGGAA
AACAGTGTAACTGTCAACATCAGGAGGACTCCAGGCTCTTGCCTCTGGCTGGTCCCCACA
TTTGTTCCTTTACAGCCCATCACCCCATATTACACCAAGTCTTTCTAGATTACAGACATT
TCAGTGACTATTTTTGTATTCATATACACTTTCCTTGGTATACAGTGAGCTTACATGGTG
AAATTCAGGAGATTTAAGGAGAATGGGGCGTGTTTCTGCTCAGCATGTCTACCTCTCCTA
ACCCCCAGCTCCCCACTTCCCACCCCCCCAACTAGCATGTTTCACACCCCACCCGACCCT
GACTCACACATGTGCATTTTCAGGTAGACTCCGTTCCCACCGCATAACAGGTCTAGCATT
TTCCCACCCACTACCCTTGTGGTGCCCTCCTCATCGTGTCCTTCTGCACACGTGCTCCAC
CCCCAGCACATAGCTCTGTCCCTACGGTGCATGGGTCTAGCACTTTCCAACCCCCTCATC
CTTCTTTCACCCATGTGTATTTATTTCCAGGTACATTCCCTTCCCAATATAAAATACGTC
CTATATAAAGTTATGCTAAGGTTCTTATGTTTAAAATATATTGATTTTTTTTTTTGAGAC
AGGGTCTCTGTCACCTCAGGTAGAGTACAGTGGTATGATCATAACTCACTGTAAACTCAA
AATCCTGGGCTCAAGTGATCCTCCTGCCTCAGCCTCCTACCTGGCTATTTTTCTATTTTT
TTTATAGAGATGGGGTATCACTCTTGCTCAGGCTGGTCTCAAATTCCCAGCCTCCAGCAA
TCCTCCCACCTTGGTCTCCTAAAGTACCAGGATTTATAGACATGAGCCACCAAGCCTGGT
TTCACATATATTGATTTTAATTAAAATTTAATTTGGACGAATCATAATAATTCAGAACTT
ATGATAATTTAGGATAGAGTCAGTAGAAGTTTATACACCTAGTGGCAGTAAAAAGGAGCA
TGGCCAAATAATTATAATGAAATAAACCAGATCTCAAAGGGAAATGGTATAGGTAAGAAG
GTAAACATTTTCAAATATTTCAGCAGCAATTATACACAAATAATTTAGGTACTGATGATC
TTTTGTCTATTAAAGCAGAGCTGCCCAAGACTTTTTTACTTGCTGTTATTTTTTAAAAAG
CTATTTGTTTATTCCATTACTCCAAAGGACTTGAAAGCAATATAACTTCAATTTTTTATT
ATTAATGTAATATTCTTCTTGCTGTTTCAGAATTTTTTTCCTAAATAAGTTTGAGTAGTG
GGAATTTTGCTTCATCTTATTCTCACTGCAGTGTTTGTTTCCTTTAGGGCTTCTGGGAAA
GCCAACTGGAGCTGAGGAGGTTGTATGGCCCTCTGTGTGGGTAAGACGGAAACTCCGTTT
TTCTACTATTTGCTGTATTTTGATTTTTGTGTGTGGGATGGGACATGGAAGTAATGACAA
GAATAGGAATGTCTCATGGGCTTATATGTTTTGAGGAGCCCACAAAGAGGGTGCCACGCA
AACAGACGAGTTTCCAGAGAAGACTCTGGGGCTGCCCAGGGGACACCAGGCCAGCCTGAA
AAGAATGCCACGTCCCAAGCTTTACAACCCTTCTGAGCTGGGTGCTATTGTCACCTCCCC
CGACTGTGCCAAGAGTGTGCTGCCATGGGACAAGGCAAACAGCCCAGTTTGCTTTGACAA
CCCTGACAGATGTTCCCCATGAACTTATCTCAATCTTCCTTGGATCTGTGTGTTTCAACC
CTATGGGTAGAGGGTACTGCCCACAGTTAAGACCACATCGTTTATCTCCTAGTCCAGTTC
CCTTTTGACAGTGAAAGGAAGTGCTATTAATAATTACCCCAGGACTACAGTGTAAACCAA
GACTCTCCTGGATGTGCTGGGATGTGTAATGCAGCCCTTGCCTTTGTTTTTCCTGAATTT
TCCCTTTTTGTGTGTCCAAGTATGCTCTTCTGGTGAACAAACCCAAGTCCAGACCATTTA
GTCTGTCCAAGACATAACCGACTTGAACCATATTGATTCTCCCTGTGTCTTTCTCCACTG
GAGACCTAACCATCTTAGTCTGTTTTCACAAAGCAGATTCTCAGACCCTAAGAGGTTTTT
CCGGTAGCTTTTTCTAGATCTCCAGGTTGGGGATAACCATTTCTAGGTACATTAAAGGTC
TCCTGTGTTGCTAATGTACATCCTAATGGGCTCTAGTGGTTTTTGAGCCCTTCTGTCCAA
AGAATTCACAAAGTCTGTTTTTCCAGGCCCATCTTTGCACAGGATTGGCTTGTCTTCTTT
GTGCTAGTGGCCTTTCCCTGGAGACCCATGGTTTGGGACAAGTTCTTCTACCTACTTTTT
GGCTTGCTGTGTGACCCCGAGAAAGTAATAAGCTAAGATGTTGTGCTATGTGCTCTCTGT
ATTAGTTTGTATTGCTGCATAACAAACAGCCCCAACTCAGTGACATAAATAGCAATTTAT
TACTTATCATATGCCTAAGGGCTGGCTGGAGTTGGCTGGTCTAAGCTGCAACGAAGTTGC
CTGGATTTCCTTGTGCATCTGCTGGGGAGGGGCTTACCTGGGGCATCCTCCTTGGAAGGG
CAGGCTTACCTAGCACATTCTTCTCGTGGTAAAGGCAAGGGCTCTGGAGAGCAAGCCCAA
CACTGGAAGAACATTTTAAGTTTCTGCCATATCACCTCACCTTATGTCCTATTGCTCAAA
CCAAGTTACATGACCAAATCCAAAATCAGCAGGGAGGCACACTGTGGCCCCTGTGAGGCC
CAAGCAAGTCACTTGGCCAACCCTGTTGCTGCTGGTGCAGGGAGGTCAAGTCACTTGGCC
AAGCCTGTCACTGATAGTGCAGGGAGGTGCACTCTTCTGATGGACAGCCAGGGAGGAAGT
CATGTATTTAAAAATAAGCAACTCTACCTCAGTCTCTGAGATCTCTTTTAACTTGGCCTT
CACTGTCTTTCTTTCATTCTTTTTTTTTAGTGCATAGCTTCTTGCTTTTAAGCATGATAG
GCACTCAACAAAGGCTCAAGGGATTAAACTATTTACCTTCTCTTAATCATATGCGATTCT
ATTGGTTTCTGAAAGTTCTCATCCCAGCTCTCTCTTTCCGGTAGTCTCATTCTGTGGCTG
ACTTGGCACTGACCTTGGAGACCATCCCATCTGTTTCTGAGACACAGCACTGACTCAGAA
TGATGATGACTTCATCAGAATTAGAAAAAGTCCTGCCTGAGTTTGAATTCTAGGAATCAC
TTCCCTGGAGTAGTGAGCCATTGGGCATTTTAAAATAATTTTAAAATGTCAGATGAGTTT
AAAGGGTACTGTATTAACTGGTGTGTGTGTGTGAGGAGAGAGAGAGAGAGAGAGAGAGAC
TCTCTCAGAAAGAAAGAGAGATGGAGAGAGAGAAGTGAAGAGTATTAGTTTCCTTGACAA
CAGGATGTCCAATCAACTTTCCCACAACTTTAACTAAGTTAAGACAATTTATCCTTCACA
TTTCAAGCAAACCTAAATCATAGAGAATGATTTCAGATGAGGTTGAAAAGATCAGAATTG
CAATATCATCTTCACTCTCTGTTCTCATTCCCAGTGAGAAGGAAAAAAAGAAAGGTGATG
GCATAATTTCTTCCTACAAAGCTATCGACTTTTTCTCCTTTAGAAAAAATAGATGAGCCA
TAAAATGCTGATTTCTTTTCAAATGTGTCCACTCCCAGATTTAGAGGCCATAGGGTGGTG
GAGTCCAAATGAAAGGATTGAACTGGTCTACATCTAAGGTCTTTTCTAACTTTAAATGTT
ATTTTTATTATTTTTTTTACTGTTTCCATTGAGCAAAAGCGTTCCACTGACTGGGAAAGT
CAAAGATGTGCTATGTTCCATGAACAACAAAGACGCTGAGGAAACAGCTTGGCTTACGTT
ACATTAATTTCTAGACGACTTTTGATATTAGGAAATATAATTTTTTTTTTTTTTTTGGTT
GCAGCCATCATTGTTGTTTTGGCGGGTCCGGGCTGGGGATTCGAACCTGCCACCTTAGGT
GTACGTGGCTGGCGCCTTAGCCGGTTGAGCTATAGGCGCCGAGCCCCAGGAAATATAATT
AATTCCAGCTTGGTCCTCTTAAAAATTGAAATAATAGATTGATTCATCTTTTGACAAATG
AAACATGCTGTTGGTGCTGTGGAGAGATGCACTGGGGCCTTAGGTAACTGCACAGCACCA
AATGTTGAAAGAGATGTGGGCAGGGAGATCTCCTCGCTGCTCTGGACTGGAAAGCCAAAC
GTGGTGATTGAGCTTATTATTTGCTTGCCATCTAGCAACTCAGCCAGGGTTCAGAGCCTG
GAACTGGGAATCAGCTCCTTATTCTTTCCCTCTCCCACTCACTGCTATAGGAAAGACAGT
GCTGGAGGGGTGACAATATCAATGTTTATTATCACTATTATCACCACGTCACCGCCACCA
GTACCAGGACTGTCGTTGCAAACCAAATGTTTTCACTATGAGTCTAATTATGGAGGCTGC
TTTGCCAATTTACTTCTGCATAAATGAAACTACACGTGTCTCTACCTGCTTTGAATGTGA
CTGTGAAGCAGGTGGACTGGCCCGGCATGGACACCTGCACAGCTTTTATTCAAGGTACTT
GACAAGAACTCCTCTGAATCCTACATTGGTACCACCGACCATATCACGCAAAGGAAGCTA
GGTTTGATTGCTTTGGAAAATCTTCGTCAATGAATGACAGCGTGTTATCTCCTTCAGTCT
GAGAATGAGCCCCAAGTTGGATTTATATTCCTTCCCAAACTCTACAAGAACAGTATCAGC
GTAATCAGCATACGAGGGTGATCGAATACAAATCAGATAGATTACGCCCCTCTGATTTGT
AACTGACTTTGTAATCCAATAGATGACATACCCTATTCATTACTACAAATACTCAGTAAA
TAGGTAAACATAAACATCGTATGTAATTACAGATGAGTATACAAAAATAAGGACACATGC
TCCCTTCATTATTACAAATACTTACACAGCCCTCAAGTTCAGCTCATTAGTAACCTCTAA
TGGCCCCCATGCAAAGCTCCTTTATCTCATCTGTCTGTTCAGTGCTTACTCTGTAGTTCT
CCTTTTGTTTAGCCTCATCCCCATTTCTTCCTGACCCCACATCACTTTAGCTTTGATCTT
GAGTATAAACTTAGTGCCCTCTTGTTGAACTTGACTTTCGTGCTTCCGGACCTCCATCAC
TTGCACTGCTTTATTTTGGTGAGTCCTGCGTTCCTGAGTCCCTTCATGAAGCCAGCTTCG
TTGCATAATCTCAAATACTCTCATTAAAATGCTAAAGGGTATTAGGTAAACATAAACATC
ATGCATAATTCATAAAGTACAGACGAGTATGCAAAAATAAGTATACCTGCACCCACCCTG
GCCCCCAGCTACTCTCTCACCACTTTCTCTTACCAAATAGATAATATGTGAAACACGCTG
TTCTTTACCTTGCTTTGTTCAGTAATGGCATTTGGGAATTGGCCTGTCTGAATACATTCA
TTTTTGTTAAGTGATATTCTATTCTCTAAGGATTTCACAGTTTGGATATATCCTAATTTT
TAAAACAAGCTCTTGATGGAACATCTTTTACAAATGATCCTGCAGCAAATAATGCCATAC
ATTCTCATGTAAATATGTACAAGCACTTCCTATAAATAGAGTTCTTAGGTCCAAGTTTGT
CTTCATATTTTCTTTTGGTAAGTATTACTGCATGGTTCTCTCTAGAAATCATATTAATTT
ACATCCCCATAAGTAAGCATATGAAGAGCACACTGTCCCCTGACATGCCAGCCATTAAAA
TGCACGGTCACAATTTTAAATCTTTGCCATTTGGTGGTATTTCACTGTGGTTTTAATTTC
ATTAATCATGAGCAAGTTTGAGCATCTTTTCATATGTCTAATTTTTTTTGTAGTTTTCCT
GTTTAAAATCCCATTGTATTTTGTTTTCTGAGGACTCCGGTGCCACTTCTCTATTAGGTC
ATTCATCTTTTTCCAGTTTATTTGTAGAAGGTCTTTATGTGAATATATTTTAAAAAGTAG
CCCTTTGTATGTCGCAAACATTTCCCTCTTGTCATTTGCCTTTGACTTCTATGTTTTTCC
ACTTAGAAAACATTTGGTTTTGTGTTGTTGAATTTAACTGATTTTAACAGTTTATACATT
TTGTATCTTACTCAGAAAGGCTTTCTCCACCAAGATTTTTTTTTAAACTTCCATTTTTCT
AGTATTTTTAATTTCATTTAAAAAATTTAGGATAGTTGCTATATCGAGAATTTATTGGAA
AGTAAAGATGGAAGTAGAGACCCACCACTTTTCTAGATGGTGACGTTCCATCTGGAGATT
CCTTCTTTTCCAACCGATTTGAAATGTCACTTTTATCACTTGTTAATTCCTATGTGTATT
TCCGACTTCTCTGTTCCACTGCACTGCCTAATCCCAGGCCAGAGCCACTCTGAATACCCT
CAGTTGGACATCGTGTGTGCAGATTCTATATCCAACAGCAGGGGGTTGGTCTAAGAAATG
TCTCTGCAAGTGTCAGAACCCAGAGCAATCTATCTCCCAGGAAATCTTGGTCCTCTCGCT
GAACAAGTCAATTTAGCAAATGAATAAGCCTTCGTATAAAGGGTCTGCCTCTCAGCTCAA
AGTTCACACCACAGGAGGGGCAGGGGTCTCAGACACCACCACCTCAGAAGTTTTTAAGCA
CCGTTTTTAAATTAATTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCCACGTACTAGTTTGATGGGACTGAAGAACAGCAGAGATGGTTTACTTTA
CTACAGGGGGTGGCGATGTCATCCGCAGCGGGAGACTTTCGGGCTGACTGCCACAGACGG
AAAACCATGGGAATGGAAGGGCTTGGAAAGACTCAACCTGTTGGACCACTGCGGTGTCAC
GTGATTATCCTTTCAGTTAGAACACAGGAGGCATCTGGATATACCCGGCTTCAAAATGTG
GCTGAGGATAGGGTGAGGTGGAAACTATTTCTGATATGTTCAAGAAAATATAAGTATTTA
TACTCACCCTGGACAGCTGACATCTGGAGACTGTACTCACTTTGAAACGGGGCTGTGCTC
AGCAGCACTGCAGATGCTGAAGAATGGCGGAAACTGAGCCACCCTGAGAAGAGCTTCCCA
GACGCTGATGCTTGGCAGTCAGGTCTAAGTCACTGCTGCCGATACACCAGGCAAGCCCAG
AATGAGGCTCATTGACTAAGTGTTTGACCTAAAAGTATGGCTCAGTTTTAAGAGGAATTA
ATGAAAACAAAAATATACTATGATCATTGAGAAAACGCAGTATCCTTGAAACAGTGGAAT
TAAGCACAGAAATCCTCCCATCCCTGACCGTGAGGCCAAACTGTGGGCAATATTTGGGGC
TTCCTAGCTTAGTAACAATGGTCTTTTATGGAAGGGTTGAAAGTAAAGCTGAGTATTGCC
AGTTTTAAGTAATATGATTCTGGAACCGATTATTTTCAAATATTTAAAAAGGTTTACTCT
GAGCCAATACGAGTGACTGGACAGGAGGGACACCAGCTCAAGAGTTCCTGGGAAAATACA
CCTGAGATGGTTGGAATACAGTTTGGTTTTATACATTTCATGGAGACAGGAATTGTAGGT
AAAATCATAAATCCTAAGTGTATTCATGGAAGGTATACCTTGGTGGAAGAAAAATTAGTG
TGAAACTTGATGGCCTTGATTCCATAATTACTGAGACTCATTCAGTGAGTTCAATATCAA
TATTCTCACTGGTTAAAATAGATTCATCACTAATGCTAAGCGTGTAAGAGCATACTTTTT
TAAACGAGTGGAATTTATTAAACTGTTGTGGTATTTTAGGGGGGAAACATCATTTTGTAA
AAGTGAATGCCCTGACATGAATAGTCTGTTTTAGGGGGCCTTTGAGAACAGGAAGAAAGT
TATTAGCAGGACGACTGTCACCAGTGCAAGCACTTTGCTCAATAGGTAGAATTATCAAAG
GAATGATTGTCCTCCAATAATTAAGTAATTTAGACCAAAAAGACACAGAGACTATTCAAG
CCCCACTTTTCCTGAATGAACTTTTAATAGATTCTTCACTCCTACCTGCCACTGTCATGA
CCTATTGTTATGCTAAATAGGATACTGCCCCAGAGGTTCCGTTCCTTCTGTGACTTATGA
CCTTGTGGCCTAGTCTTGATCCAAGGGCCCCTCTGAAGTTTACCTAGTTTTGTGGATTTC
TGATTTCTTCTTTCAGTTCATTTATTTTACGCCACTTCATTTCCCCCATCCTCTTTCTGC
GACAAGGTACAGGTTTGATAGTTGCTGTGTATTTTAAAGACGATCACTGCCCAAATCTTT
GTGACCCACATTCATGAAGATTGAGAGACTCTATCAATTCCCTCTTTTTTGGGTAGACAC
ATCTGACCAAGAATGATAACTCACAATAGAAATCTGGGGTTTAGAAATCCCAACTCTTGA
CTCTTTCTAATGGATTTGAGGGCAGTCACCTCCCCCTTTGAGTCTCAGTTTTCTTTGATA
TAAAATGAAGGGACTTGGACTAGATCAGTGACTTTGATACTTTGTTTAATGTTTTAACCG
TATTGTGATCCATTGCACACACATACATGTGAAATAAATGTTTTACGAAATAATACTGTT
TTTACTATCTAACAACCATTTGAACTATTCTAGTCTAGTCTAGTCTATTTGTGAGGAATA
AAACAAATACAAGTTAGTTATGACCCATGAAATTGATTTTGTACCTACTAGTGAGTCACT
ATTAGCAATTTCAAAAGCAAGGGGCCAGGTAATATCTGAAGTCCTTTCTAGTTATAAGCT
AGATGACACAACCCCTGTCTACATTACAAAATTGTTACAAGCCCCTGTGTTTTCCCCTTT
GTGGGTTAAGATTCCGAGTCACCTTTGACAAAATCAGCAAAAGCTCATTGTTGGTGGCAA
AGCAGAGCTGTAGCTGGAGGACTCTCCCTCCAGAGAAGAGGCTCCTGCACCTGACTGTGG
GCTCAGGGTGGGCACCTCCTGTCCAGTAGGACAGGCCTTCTTATTCTTTGAAATCACAAG
TTCAACCATTTTGAAATTATTTCCTAGCCTTAACCCAGAACTTTTCAGACTAAGAAACTT
ACAAAATTGTATTCATTAACCATTAAAAACATCTCTTTATAAGATTTTTTGCATTGGGTG
TAAATATCTCAGCAATTTGTGTGGATATCCTATGTCTGATAGGTATGGCCAGCTGATTAC
TTACTGCCACGGGGATCGGGCAGCAGGAGGGAATGGCCTAGAAACCAGGAGTAGCCCTGT
TCACCAGGAGCAGGCTAGATAGGGGAAACTGACCCGGCTGCTGTGCTGAGAGCTCATTCC
AGTAAATGGGCAAAGTACAGCATGCAAAGGGCAAGAAGGGAATGGCTCCCCATTCTAGCA
AACATTGGCCACAGTGGACAGTCCAAGAGAAAGCTGGACAATAGGCAGATGCCCAGTAAA
ACATCAATGAAGGAGGCCTTCAGTGGACATTAGGGACCAACTCATGGGTAGTTCAGGAAA
CTGAGAGTCCTCCGAGACCTGAAAAAGGAGTCTGGTAGGAGCACACACAGGGTGGGAAGT
TATCAAGTACAGACACGCTAAGATGCAGAATATGATGTGAGGCTCAGGACTCAGAAAGCA
GACCCAATCCCCAGTATTGGGTGGGAGAAAAGGTCTGTCCTGGCTGGAACAGATCCAGGC
TACGGAAGCTGTCTCAAAAGGCCAAGCCAGAGGTTGTTGCAGTGTCCAGGCCCAGGGCTG
GGACTGTAGCTGGGGAATGGAGCGCTTGGCTGGGAAGATGAGGACTGCAGAGGAAGGGGG
TCAGCCACAGGTTTGCATTCCTTGATGTTCCTATCCCAAATCCACTGCTGAGAACATATC
AGGCTCAAAGTAGAAGGGAACTCGTTCTTGATCAGTTACAATCCAATGTAGCATCAGTAA
CTTCTTCATGCCCCAAGTGACAGCTCTGTGCAAATGTGTTCCCAAACAATAGAATGTCTC
AAATTAAAGTCGTATAAAAGCTCTATTTCTAGCTAACATTTTCAAATAATAAATTCCATA
TTTAATTGAACTGTACCTGCAACAAATCCAAGTTGTTCAACCCAAAATGCAGAATAGAGT
TATGTAACAGTCATGAATCATGACAAGCTTTATGCATACCTCTTCTGTCAAGAACTCCTT
TGCACAGACGATCTCAAAAGTTGCACGCATTTACCCAATTCTTAGGGCTTTGAATGCCAA
TTAATTAAGAATGCAAATAGCATTTCTATTCTATCCAAAGGGAAGAATGATAAGCCATCT
TGGATTTCATAATTTTTTAAAAAATCATTACTAAAATTGAAGAAGCAATGAATTCTCAAT
TCACATAGAGCTTGAAGTTCCTCTTTGATCATTATTTTGTAAGCAAAGAAACTTTTTCCA
AATAAGTTCTCAGAAACATTTGAACAGTTCTAAATCCTGTTACCCACACAGGGCAAAAGG
TGAAGTCATTTAAATGTCTACAACTCACTCCAGATATTACTGTAAACTTTTAAACAAAAA
TAGTCATACACCACCGCACACACATGGGAAACTCTACTAAATTAAAAAAAAAAAACATAT
TGTAACATATTCTTCTTTCTTCCTCGGAACTCTCAGATCTTTTAAAGTTTGGGTTGTTTG
TTATGTGTCCCTGTTGTTCCTAATCACTCTTATGTGCAATACTTGTAAAGCTGTGCACAT
GAAATAATTCCCCAGCAAGGCGCTGCCAAGTTTTATGATGCCTGCACGCCTGGGGCAGAT
AATGTAAACTTAAGTACTAAAAATAAGTTCTTTGATTATCCTTTTGTGTCTCAAGATCAT
GTTCCTAACAACTTCTCCCCCCGCTTTCACCCTCAAACTGCAAGAATTTTGCAACCCACT
CTGTGAAGTTTTTTTACCTGGGTACGGCTGTTTACTGGCCTGTTTATAAAGGTCTGAGTG
TCTGACACCTTCTCCAGGCTCCCCACATTAACCACTAAGGAGGTTCTGTTAGCAGATACT
TTTTTTTTTTTTTTTTTGGCCTCTGTTTAAAGAGGAAACTATTATATTAACCTTTGTCCT
CGAGTCCTGACTGGTGAATGGTATGTCATCACATACTAAGTGATGTGCTGATTGTGGTCT
TTTGTGTTACAACACCCACTGGGACCTTTTGATACCACTGGGTCCACAGGGGAGGGAGGC
ATCCAGGTACTGAGTGGAGACCAGTGCCTTTCACAACAGGACGAAGGAAGCTCCCTGGTT
GTGTCATCTCCATCCTCCCTGATGCAGTGCCTGGAGTGCATTAACCACCAAAGAGGCAAC
TGCTGAATGGACCTTCCATTTTGTATTGAAGCTTGTTTGTAACTCTTCAAGTTCTTGTCT
CTTCTCCCTGCCAGACCACAGCTTATTACCAATGATCAACACGGCTCCCAGACTCTTCCA
AAAGACTTCAGCCTGAATACTCTTAGCTGCCCAAAGTCTCAGACTTCTCTGCTGTAGTTG
GGTTCCTCAGGCCATCCCATGAGCAAGAAGCCTCCTTCAGTTCTTTGTCCTCAGCTTGGC
AATGATCTGTCTCTAACCTATAATGACACTTAGCACGCTGAGTCTTCCCTCCACCAGATC
CAAACCTGTTAATGAGTGCCAGGGCTTCAGGGCCCAAGAACCCATGACTAACATCCACAG
AATAAAGAATTCATCTGAGTAGGTGAAAGGGGTCCTCATCCATGGCCAGCAGGAACATGC
TGTGTGAGGCACGGTTATGGGACTGATGGTTCCTGGTCAGATCCAAGCATTGAGGATGGC
ATGGGGGGCATTTTTCTTACTGTGTAAAATACACATAACGTAAGATGCACTATCCTGTTT
TTCCTTGTATAGCTCAATGTCATTAAGTGTATTCATACTATTGTACAACCGTCATCACCA
TTCACATCCAGAATGCAAAGCTGAAACTCTGTCCCCATTAAATACTAAATCCCCATTCCC
CTTCCCTCTGCCCCTGGCAACCACATTCCACTTTCTGTTTTTCTGAATGTTGCTGCTCCA
GGTATCCTGTACAAGTGCCACCATACAGTATTCGTCCTTTTGTGACTGGCCTATTTCACT
TGGCGTTATACCTTCAATTAACCTACACTGTAGCATGTGTTAGAATCTCCTTCCGTTGAA
GGCCGAGGAATGGCCCCCGTAGGTGGATTCTGCCTTCTGTTTCCTACTCACCTGTAGGTT
CACACCTACCTGGCTTTCACCTTTGAGCTGTTGTGAATCAAGCTGCTGTGGATATGGGTG
TACAGATACCTCGTCAAGATCCTGATTTCAATTCTTTGGGGCACATACCCACAAGTGGGT
AATATGCTAGTTCTGTTTTTAAGTTTTTGAGGAACTGTTACACTGCTTTCCATCATGACC
GCCCCATTGTGCATGCGGAGGACACTTCACAGCAATGTTTTCTTCCCTTTTCGCCATGAT
GAGCTGCCCGTTACTTCTCGTTTTCAAACCTCGAAAGTGCACTCAGATGAAATTTACACT
TCTCCTTGTGCTCTGGAACCCACTGGTCAACGAGAACCGCACATTTCGGATTGGAATGTA
TGGCTCCAGCGACCTTGCCACTAACTTCCTGCTGGAGAAGCCAGTGAGCACATTTGTTCC
CAAACTAGCCCCACTATCAACAAATGCTTACACTGCACCATAAATCCAGTTTGCTTTAAT
ACATCCCCAGTAGTCTCCACCCGGAAGTCCCTCTCCTCTTATCTCAGGCCTCTCTGCCAA
ACCCTTTGCAATTTATGTGTCTGCTTTTCGATTCTGCTTTTAGCCCCCTCCACGTTTCCT
CTTTCCCACCAGCTCGCTGGGGCCGCCTGTGTGTCACATAAATTTTGTCTTCTCTGTCTG
GGACACTTGCTGACTTCTCATCCACTCTCTGTTGTCCTTCTCCCCTCCCTGGATCCAGCC
ACTCAATATCTGGGCTTCCTGCCCCAAGTCATTTGTCAGAATCCTGTCTGTGCGATTCGT
GGCTTGTTCATTTTATTTCGCTGACTTTCTTTCACATTTCCCTCTACTATTTCAGAGAGG
CGTGTTCCTGCTTTGTGACCCTTTGTGACATGTTGACTTCCTCTTTTGTACCCCATTCTC
TCTGCCGAGTTGTTTACTGGGGAAGATGAACTAGCTGTATATCTACCCAAAAAGGAGAGA
TGACCGGTGGCCCATGGAGAAGGCTGTGCCCAGGCACATATGCATGGGAGAAAGTGTACA
GGTTTTAGATGAAATAGAAAGAGAGAGAGTAGAGGCCAAGGGTGTGCTAGGGGAATGTGG
TGTTTGGGGTGGTGATAGAGAGGAGAACCTTGGCAGTGGCCGGGGAGGAGGCAGGCCTCG
GAACTGGTGCTGAGGGGGTGGAGTATTTGAAGAAAGTTGTACAGGTGCAGAGTAGAGAAG
GGCAGGGTGAGGGTACAGAGAGAAGACAAGATTCTTTAAAAATACCCCAATAAACACAAA
GACATTCAGTTAGCTCAAGTGAGAGATCATAGTGATTTGGATCATACATGGAAGGAAAAG
AAGGAGTATTTGATGAAGAAAATGTCCTGCAGGGGAAATACGGCAGCCATCGATTGCGAG
GAGTGAGAGATGAGTCACCATTAATCGCTGTGCTGACTTCCCATTCTGGAGACAAATGGC
GATTCTGCCATAATGGGGAGGTGGAACGGGGCAAAGGGAAGGTTAGTTCTGTCTTCAACA
TAATCAGTTGGAACTTGTCTTACTCTGTTTGGGCTGTTACAACAAAGGACCGTAGACTGG
GTGGCTTATAAAGTTATAAATATCTTTCTCCCAGTTCTGGAAGCTGAGATATGCAAGATG
AAGTCACTAGCAGGCTTGGTGTCGGGGGAGGGCCTGCTTTCCGGTTCAAAGCTGGTGCCC
TCCTGCTGTGTTCTCACATGGTAGGGGAGGTGAAGGAGCTCCCTGGGGCCCCATTTCTAA
GGGCACTGATCCCATTCCAGAGGGCTCTGCCCTTATGACCTACTCAGCTCCCAAAGGCCC
CACCATCTAATACTGTCACCGTGGGGTTTATGATGTCAACATATGAGTTTTGGGAGGAAA
CATTCAGGCCATAGCAGGGCTATTACTGAGACATTGGGTCCAACGCACTTAGGAATGGGG
CACCCTATGGGTCATGAGGCTCCACTAGGAAGGAGAAGGAGGAATTGTGCACTCGGCTGT
GCTTGGCTGGAACCTGGAATCTCCTGCCTCTCTCTTGAACTTCAACAGTCTAATGTGGTG
TTCCCTACAGTATGTCCTTTGGACCATTGCCACTAACAACTGTTACACAGGGGAGCATCC
CCCTTAGTCAAACGCTGAACACGCTGGGTCTGTCGAAGGAACCCAGGTCTTTGTAGTGTC
GGCTGTCTCGGAACCTTTCATGTAACAATGTGCTTGGAAAATCTCCAAGCGAGAAATTTA
GTACGCGGTGTTTATTTGACCACAGGACTTTTTTTTCCCCAGAATATCTCTGGGGACTAG
AATATGGAGAACAGGCTTTGAGAGAATACACTGACCTAATAAACAGCAGCATTTTACTCT
AAGGAATTCTACATAAAACCACCACCGATAGGAAGAGTTTACTTCACCACTGTGAATTAT
CGACATTACAAAGAGTAATTACTAATTATCTTTGTTTCAAGTTGATTCTGTGGTGCTATG
GAGAGGCTGGGCAGGCCCCGCTGCGTGCTTGGCTTTTTTGTTTATTCCTTTTTATCCCCA
GACTTTCTCTCATCTCCATCTGTCCCCAAGAGTCAGCCATTGCACTATGCTTAATGTGTA
TGTTTTTTATATGTTCTTGCAAACTGCGTAGTATCATTTGGCGGGTATTATCTTCAGCCT
ATGCTAATGGTAATGTCATAGCTCTCATTCTGATTTTTAGTTTTTCCGCTTAGCACTGCG
CTTTCAGGCTCCATCATGTCACTGTATTCCTGTTGAATCTGTCCAGCACTCCGCAGCTGC
CTGCACCTGTTTCTCCTGTGCCCTGTCCCAGCGGCCTTCAGCAAACAGTCCTGCAGGCCC
TATTTAGGAGCCTTTATGGACCTGGGGGAGAACTCCATGGGCTATATATCTTGCTTTATG
ACCATAGAGAGATACGTCTCAGATCCCTGGGGCCATGAACATATTAAGTGTTAATAATCC
GTGAGCGTTTTCCAGCACTGGACGTGGGTTGTGTCCTTCTAATATAGTATCTCATGTGAC
CATCCCAACAACACCGTGAGTCTGGCTGAACTGACCAAATTATCCTCCATTTATGCAGAG
ACATGAGTGACTAAGATGAGAGGGGCTGGTGGTACTAAGAAGTGTGAGCAAGATTGTACA
GGTATTAATGTACCTTATTAATACAAAGCTTTTCCTACTCCACTGACTCTTCTTGCCCCT
TGAATACTCCAAACCCTTCTGCCTTATGACATTTGCCCTAACAATGAGTAATAGAATTGT
TTGTTTAGTGACCTGCTTTCCTGGTATGCAAACTCTATGAGGACAGGAACTTTGTCTCTT
GTTCATACCAACAGTCCTAGTGCCTAGAACAGTGTCTGACACTACTAGGAGCTCAGCAAG
TGACCAGAAGAATAGCCTCCCAGTATATGTTTTTCACAAATTTGTCCCCAAGGAAACCTC
AAATAGAAATGTCTTGTTAATTTGCTAATTTGGATAATTGATATTATTATTATTATATTG
TTATTTTGGGAGATGAATGAAAGGAATTAGGGGAAGTGTCTCACCTTAACATCAAGGCTT
GAGGGAGGGGAGGTTATAGTCTTTTCCCTTCAGTGATTTATGCTCCATCAACTCAGTAGT
TGGGTCACCAAAGTACACAGTTTCATTACACCATGGAAGGCCATCTTGGGATCCAAAGGT
AAGCAGATAAGACAAGGGGCACGCTCTCCTGGCACTTTAGCTGGGCTCCACTCACCAAGT
CATTAACTGGGTTCTTACTGGGGTACTGCTGCATGCTTAGCCCCCCAGGCTGCCAACTAC
CAGCCTAAGTCTCTGGGGTCAGCTGAGTGTACCAGAAATAGCACTGGATTAGGATCAGAT
CTGGGTTCTGGTCCCACCTTGGCTGTCCCTAGCCATGGGGCTAGAATGAGTCTCTGACAG
TTTTCCTCAATTTAAAAAAAATACTTGCTCCCCTGCCCACCCTCAGGTCTGACTCGAGAC
TCAAAGGGACTCTGAGTTCTCCCAGGACAGACCGTCCAAGTCACAGGGATTCTGTGATAC
CCACATTCCTCAGACTTTCTTGTAGCCAGTTGGCACCTTGGGGAGACCCCCAACTTCAGA
AACTCCTTCCCTAGCCAGCTCAGGGCAAGCTTCTCGAGTCCCTGTACACAGGTCCTCTCA
CCTTCAAGTTCTGGGGGATCCTCACCCTGTTCCCTCCTCCTGGGGCTCCTCCTAGGTAAG
AGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTAGCTTTGGCTAAGATGCTCTATCCATATTGTAAGTCCACACATCA
TTTGGGGAGAAGCGATTTCTCATATACTCTCAGTCAAATATCAGTCCTGCACATACACTC
ACACACACACACACACACACACACAGGGAGCTCTCTCAATATCCTAGAAAATACATTTTT
GGGCATAATGTGTGGGCAAAACTATTCAGGGACAGCCAGCTGACTATCTTAACGCTTCTT
TGTCCCCGCGGGGCCATCCAACTATTTATTTAGTAGCTCGATGCTGTTTGCATCAACAAC
TTTGCCTTATAGGCTCTTCTTCATGTTTATGATTCTTACTGTGAAAAAAATTGCTTGCCT
AACATCTGTTCTGAATTTGTTTTTTCTTTATTTTTATTTATCTGTTCCCTATTGAATCCC
ATTTGTGCCAAGGACAGTAACTTGAATTGGAATCTTCAGTGTCCTTCAGGATTTCTCCAC
ACTTCAATACATCTCTTAATTACCCCTTTTTTATTGTTATGAGATATCCAGATATACCCC
TGCTCACACAGGCAGATTGGTTTGTAGCTTACCTCTGCCTGTCCCCCTCTGGGGAATAAG
TTTTATTAACTGAATAAATTAAATGGGCGGGTGTATTCAATAGAGGAGGGAGGTTTATCG
TTATAGGTTTGATTCAGATATTTTTCCCCTTGCTGCCCAATTCTCTCCTTCAGCCACAGC
TCTGTTTTAGAGAAAGCTTTACTGTAGCTTGATGTAGTCATAATTTACCAGGATGAGAAA
GGCCACTTCACTTTACAGATGAAGAAGCTGAGGACCGGGGAAGAGGCCGTCTCCCTGCCT
ACTTCCAGAAAACACAGAGAATAGATGCCCTGGAGCCATGACCTTTTGAGAAGGGGAGCA
TTGCTTGACACTGCGTCTCCTGGAAGCAGGAGGCCTCCTGGGGTACCTGACCAGCAGCCA
TATACCAAGCCACCAGGGCAGACCTAGCCCTTCCAAGAGCAAGCATGTTGCATGTTGTCC
ATGGACACAGTTGGAGGGGGCAATCAGGAAAGCGTGCAGATGGTATGGGGCCATGGTGGC
AGGGGAAATTGCAGCAGGACCTCCTCTTTCTTGTGGACCCCTGTTGTGGAGCTTTTTCTG
GGATTTCTATATGACATGAATTCTCATTAACTCCTTGCTCTCACCATTGGAACCCAACAT
AGGGACCAACCAAGCATATTCCCAGCTATAGGCAAGAAGGTCCTTAAAGAAGGGTGGTGA
GACCTGCTTTTTTTTTTTTTTTTTTTAAAGCTGATCTAGGAAAACTTACCAGGTATAGAG
ACAGTTACCCAGTGACTCAGAGGATGGGCCCAAAGTCACCAAGCTGTAGCTGCAGATGCA
ATGCTCTTTGCACCATCAGTTCTCTGTTCACTCTGGAAGCACTGTCCATGCTCTCTCTTC
CTGACTTCCCTACACCCTTCAGCATCTGTGTCCGTGTCTTCCAAAGGCACAAAGACAAAG
GGAACAGTTTTCCCCACACCTGGAAGCTGTCACTGCTGGGGCTGCTCTGGACATTGCCCA
CTCAACAGATATTTCAGTCTTTGCTATGTGGACAGCACTGATCTGATGGCAGGGAGAGAC
CAGCTGTCCCCTCCAAAAAGGTATCATTCGTGTCTCCTGTCCTGAAGAAAAATGGCATCT
GATTTAGAAAAACACATGCAGGGGCCAAGCTGCACAGGAATTCCAGGAGTATAATAAGTC
TTGAAGAACGAGTAAGGGGGAGGTGAGAGGGCTGGACAATTTACCCAGCGAGAACATTGG
AGAAAAGACCTTGAGGAGAGAAGAGTTGGGGAGGGGAAGCTGCCCAGGTGGAGGACAATG
GCAGAAACCTCAGTGGCCAGGCTGAAGATGTTTGCTATTATTCTTTCAGCTAATGGGCTT
TGAGCTGGTTAAAACCATGTCTTGAAGGTTGTTTTCTAGAAGGTGACATCGAGATGGGCT
TTGGGATGCAAGATGTTTACTAGGATCTGTGCCTGGGAAGGAAGGAGGAGGGAGCTGTCA
GAGTCACCCCCAGCAGGACAAACTGCCAGTCTTTCATGTTCCTCCCTGACCTTGAGGGAG
CTAATCACTGAAGACTCTCTGCTGACCACAGTCTTGGCAGCTGGACAGCAAGTTCTTCCC
TATAGGGGGTTCTGAGCAACATAACTTGATGTCACCACATCATGGAAACCTTGGTTCAAA
TGAAATCTTTGGCAGAATCATTGGGTTGAAGTGGGAGGTGGTCTGAGGGTTCTGTGTGCT
CAGCTTCCCTGTAGGGGATTCTTTGCACAGCCAGATCTGAGGCTGGCCAAGGCAGCCACC
AAGGTGGGCACACGCTGATGGAGCCAGCAGGGCAGCTCTGCAGGTGACCCTTCTCCACAC
CGATGGAAGTGAACTAGAAAGAGAGGGCTCCAGGTTGTAAAGAATGACCAGGGACTGATG
ACTTCTGGAATGCAGGATAAATGTGAGTAAAGAGGAGGAAGGTTCTGATTTTTCAAGTCT
GGCTTCAAATCTACCAGGCGCAGGAATATGGAAGTCAGGAGGATAAAGTGATTTCCCAGT
CGTGGAAAGGCAGACTCAAAACCAGCCTTCCATTTGCTGCTGAGGACAAGGAACTCCGGT
AGCTTTCCAAGGGGTGCAAAGCCAAGTAAGACAGGGCAAGGAGCCTGTCGGCAAATAAGC
AGAGTGACGCAGGGACCCACAGGTAGACAAGCAGCAGGCCAGAAGGACAGACATAAATCC
CTAACTGGGAGGTGCAAAGTCTGGACGGGAAGACAGGGACGAGAGGGTTGTCACGGGTGG
AGGAATGACCAGGTGCTGTGGACACTGCAAGGACTGAGTCCAAGGACTGGGTCCAAGAAG
ATACCATAGAAGAGGGGACTAGTGACCCAAATGTCTGTACACGTTTTCCAAACTACCAAG
AGGAAGACTCTGGAAGGAAAATATGTGCAAAGAAACAGGACATGGAGAAGTACTGCAAAT
TTGAGGAACCACAAATAGCTTTTATATAAGAAGAGTGTGCCTCCCAAACTGTGTGCTGAG
ACACACCCCTGGGAGCCACAGCGAACTCAGAGGGGCTTCCTGGGTTACAGTATTTGCAAT
ATTCATGGGAAATACAGAGGCATCTGTCAGTCACTTTGAGAACTGCTTTCCATTCATGTG
GATTATTTTTTCAAGTGTCCACTGAGTTGTTAAAACATGAATACTTATCAAGTTGTTTGG
ACTTAGACTTTTAAATGAGACTGTTAAGTTCTTCTTTTGGCCCAGGGAGTGCTATGAAAA
AATTATGGAGTCACTAAGGGCACCAGAAACTGAGAAAGTCTGGAAACCTTGTGTAAGAGG
ATGGGGCAGAGAGAGGTTATGAGCTCTGCAGACCTAGTACAAGTCTAGAAGCTTGGACTT
ACTACAGTAATGGAGAGCCATAGTGGTTGACAGAAGGTGGAGAACACAGTTCTGTTTTAC
AAAGGTCAAATGGCTTTGGGGGGCGTTAGTTTGGAGACAGAGAGCCATGGTGAACTACTC
AGTGGTTCAGGAAAGAAGGAGAGGGCCTGGACCAGCCAGCATTAGAGGTTGGAACTGGAG
CACAGGACACACCATTAGCATCATGGAACTCCTATTGCAAAGCTAACACTGCAGTCAGTA
CTAGACATCTGCCGTGAGTAAGACAAGGCTCCTGTGTTCAAACCACCTACAATCAAGTGG
AAAAACAGTCAAGAAAAAAATAGTTAGCAGAGAACCACTAGGAGTGAACCAGGCAAGAAA
AAGGAGCGCAGTTTTGGGCAAGACAGGGGAGCAACATGTGCAAAGCATGTGCATGAGATC
ATGGGGCGGGGGTGGTTACCATATGGGGTGATTCTCAGGACTGGCTCTTGGGATCACCCC
ATATAGGAGGAATAGGGAGGCACAAAGAACGAGGTAGGGACCAGGCTGTGAAGGAGGGCT
TGATCTCTGCAAATCATTGAAGGGTTTTCAAAAAGGAGCGGCAAAATCATTTTGCACTTC
CTAGGTAGATAAACTGAGCTGGGGCCCACAGGTAGACAAGCAGCAGGCCAGAAAGACAGA
TGTAAATCCCTGAGTGGGAGGTGCAAAGTCTGGGCAGGAAGTGAGGGACAGGGAGGCCAC
TGCAGGAAGAAGGCAGGAGAAAGCAGCTGAACGGGCCCTCACAACCCAGCGCTGGAGAGG
TCTGATCAGGGGCTGCCTCAGTCCACCCATCTCCCAGGGCTCTGGGAACTCAGGGGTGCA
CCCAGGCATAGGGACCTTGGGGTTCCTGGGGCAGGTGACACACACCTCTACTTGGAGTGA
TAGGAGTTAGGAGAAAGCATCTCCTGACTCCAAGGCCCATGACTGTGTCACTGGCACCTC
AAGAAAAGTCTCCCTGGTAGCTCGAGTCTGCTGTGTCACTCAGCTAACTGGAGCATCCTG
CTTGCATGGCAGATAGATAGTGGACCAAATGGGAGAGGTTGGTCCCCAGGGGTGAGCAGT
GTTAGACACCTAGCCCCAGGGGAGCCCCTGTGAGTCAAGTGCCAGGTACTCATGACACCA
AGTTCTCCTAAGTTCTCTCTGCACTTTTTAGAAGTTGATGGTCTCAGACATTCACAGTCA
GGGTTTGGGATAGTGTCTGCCACCTTCCCACTGAACTTCCTGAGGTTTCCAAGTCTAGAT
TACACGCTAAGGGTTAGACTCCAGGGCAGAACAGCAGTGCCCCCCTCCCACCCCGTCAGC
ATCTTCAGCTTGCTGAGAAATAAAACTGTCACTGAGGCGGGAATTTCTCAGGTGTTTGGT
GTTCAACAAATGTCACAGGAGCTGAGCACACTCTCATCGATTCTTATGACAAGAGGGAAA
GGCTGTGGTCCCCAAACTGTGCTCAGACACCCCAGGGTGCCGTGTCAGCTCTCCCTGGAA
CTCAGGAGTCTTGGGACATGCGTTTGTTTCTATGCCTTCTGCCAACAGAGGCAGGTGTCA
GGCTCCCATCAGGAGCCTCCTCTCCTTCTATCAGCTTCTTTATCCCTTACAAAGTGGCAC
CAGCAGGGTGTGGCCCACCTGCCCAGGCCTTTCACCTCTTGAGGGAAGGACGTCAAGGCC
AGCATTTGCATAAAACTTTACTGTTGACCAACTATTCTCATTTGACCCTCACAGCAGGGT
CTTTATCAAAAACAGGCTCTAGGGGGTTGTGATTTGCTCAAGGCGACACAGCTGTGGAAT
CAGAGGACAAGGCCTTGAACCTGAGTGCCTATGACCCAGCACCTGCAGCTGCAGCCCTGC
CAACCTGCACTCTGCCTGCCACAGTCGCAGTGGAGCCAAGCCAGCCACGAGACCCCCTTC
CTTTTTCTGACTGCAGAAGTCACACACACTCATTGTAGAGCACTGAACAGTAAAGAAATA
AGTTACATGAAGAGTAAAAGTGCCCCACCATTTCCTGCTCCGGATACACGCGCTGTTAGC
AGGGCCCGGCATCCTGCCTGACCCAGAGCACGCGCTCCATAAATGCTCCTTGAATGCACC
CGTTAATGGTGAGATTGACTATTATTTATTAACAGAACTATACATACTATTTCACAACGT
CTTTCTCTCTTTCTTTTGGACAACTTTCCATGTTGGTGTCTAATGGTGATCCCTAACCCC
CCAAACAGTCACCCCAACAGGAGCAGGCGTTCTGGAACAGGGCCAGACCACCCCCAGACT
AACACCGACAGTTTGTCCTACTTTGTGAACTATTTTGATTGAACTGACTGGTCGGTGAAA
AAAGAACGAAAGAAAGAAAGAAAACCACTAATTAAACAAGTCAAACAAGAGTTATTTTTG
TCTACACAATACTTCACTGATTTGCCTAAATTTTCTCTTCCACCAGGTGCTTTGGAGTTG
AATAAACAAAATCTTATGTGCGTAAATGAGTATAAATGAGTAACTGGCTAAGAATTTCTT
GCTCCCAAAAAGAGTCTATATGCAAGTTTGTGTTAGAGGAAAGCAAGACCCTACCTCCTT
AATTGGGCTGGGGGTTTTCTGGCCCATTAAGCAAGAATCTGCTCCAAATCTCCACCTTTA
AAACTGTGATCTGCACAGTGGGAAGCCTGGAGCTGGTCCCCAGTCTGGGAGGAGCACAGC
CACTTGCTCCAGTGGGTGGCAGCAAGCTCAGTGGCGAGGGGCCTGGCCTTGGGCTTAAGT
CCCTGCTTCTTGGGCAAGTTCTTTAACCTCTCTCTGTCTGTTTCTTATTCTGAAATGCAG
GAATAATAATACCTCATCCATTTTCTATGAGGATTAAATGAGATGATACAGCTAATGCAC
TTAGGAGGTCTGGCTAGTCACAAGCCCTCTATAAACACTAACGATTGTTAGCTCAGAGGT
TCTGAGGAGAATCCACACCAGTGCGGATAGCTCACTGACCGGTTTCCCTGGTATAAGGCA
TTTCTTCACAGCCTGTGGAAAATAGTCCTGAAACTCACAAGCCCTATAATCTAATGTCCT
TTTGAAGTCAGAGGAATTATAGGATTTGAAGCTAGAGCAAACTGCAGAGATTACCTAGTT
TTCACTCTCACACTTCAAAGGCGGCCCAGAGAGTTTCAGGAGTTTGCACATGGAATCTGC
GTGGAGCAGGATGACCCTGGATCCCTCCTGCTGAGCTCTAGCAGGACGTATTTCTCAGGA
CCCCTCTACCAACTCAGGAAACAGGAAGACATTGCTGTATCCCTGCCCGTCCTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGAAGGGTTTTGACTGG
CCCTGACTGGGTCATGTCTCCACCCCCTGGACCAGTCACTGTTGTCAAGGAGATACTAAG
CCTGGCCATGCCTGGGGGGTGAGCCCATTCTCACGACCAGAGGGGCAGGGTCCTGTAATT
GACAGCACCTTCAGAACTACATAGAATGGGGGAGGGGGCTCCCCAAGGAGTAATGGGCAG
TCAAAAACAGGAGAGCCATCCTACGCCCCCTGAAGGAATGCTATGTGTGCTTAGGACACA
CTGCCGTTACATTTCTCTCTATTGGAAATCTTTCTAGGAGCTCCTCAAACTACAGATGAG
CCCTTCTATAAATATAAATTCACAAGATTACACAATTTACATGTAAAATGGGACAAGTTT
TCTCATGAGGTTCATAAACTAGCTCTGAAGCAATTCTAAAGGAATTGTTGCAAAATTGTT
TTTAGCATTAGCAATATGACTAGAAAAAGGCAGAAAGACTCCCAAGGTGACTACTTGGAA
GGACAATTTGCATTTGCATATAGAAGTATTATTTTGGTTTTCTTAAAAATCCAGATTATG
TATAAAATTATTTTGATAATAACTACATCAATATAAATATATTACCAAAATACGTGAGTG
CACCACAGTCACTGCTATCCATTTAGATCTAAGAATTTAGGGAAATGAGAACAAGGTATG
AACTTTGGTTATATATAGAGCAGGTTTTTAACTTGGGGTTTCTGTGTCCCCAATATGGTT
ACTGTCAATCACATCAGGATCCCCGGGGAGCTTCTTAAAATAAGAGGTGCCTGGGTCCCA
CCCCAGAGACTCTGATCTGGTAGGTCTGGGTGGGGCCAGGCACTATTATTTTCTGAATGT
TTCACAGTGGTTTTCACTAGACTCGGAGGCTGGAAAGCAGGATAGGGGTTCTCAGAGTGT
GGGAGCAGTCTTCTTACATCAAATCTGAAAGCCTGCTAAAATGTAGATTCCTGGGCCCCA
CCAGCCCTGGTAGATCAGTCTTGGGAGACAGTATGGATTTACTAAGCTCCTAGGTGGCTT
TTTAAAAACTTTTTTCTTTGAAATAATTATAGACTCATAAGAAGTTGTAAAAAAATGTTG
CAGGAAGCTTCTGTGTTAACTTCTTCCCATGTAAACCTCAGGCATAACTATAGTACGCTA
TAAAAAATGGGAGATTGACATTGGTACAATCCATAGAGCTTATCAGATTTTATCCAGGTA
TAGATGTGTGTGTGTGTGTGTGTGCATAGAGTTCTGTGTAATTTTATCACCCGTGTAAAT
TCATGTAACCGCCACCACAGCCAAGACACAAGACTATTCCATCACCATAAGGCTCTCTCG
TGAGATCCCTTTATAGGCACACTCACCCATCACCACCCCCGTCCCTAACTCCTGGCAACT
ACTAATCTGTTATCTGTGCCTATAAATTTATTCCAAGAATGTTATACAGACAGAATCATG
CAGTAGGTCACCTTTTGAGATTGGCTTTTTGCACTCACATTCCCTTGCAGTCCATCCAAT
CAATAGTTTGTGCTTTTTGTTAAATGCTGCATGGTATTTCGTCGCATAAGCACCAAAGTG
TGTTTAACCCATCCATTGAAGAACATTTGGATTGTGTTCAGTTTTTGCCTATTACAAACA
CAGCTGGTATAAATGTTCATAAACCTGTTTCATGTGGACATACATTTCCATGTCTCTGAG
ATAGAGAGGTTTAAGAGCGCAATTGCTGGGTCATATAGCAAGTACATGTTTAGTTTTATG
AGAAATTGCCAAACTGTCTTCCAAAATGGCCGCATTGTTTTACATCCACATCACTAACTA
ATGATGTTCTGCTTTCTCCACATCATCATCATCATCTGATGTTATCACTATTCGTTTGTT
TTAGCCCTTCTGATAGATACTATTATCTCATCATAGTTTTAATTTGCATTTCCCTAATGT
CTAATGATGTTGAGCAACTTTTCTGGTGGTTACTTGATATCTGTACATCCTCTTTGGCAA
AATTTCTGTTCATGTCTTTTGCCCATTTTCTAGCTAAATTTTTTCCTAACTGGGAGAGTT
CTTCAGCTATTCTAGGTGCAAGTCCTTTGTCAGGTGTGTGGTTTGCAAATATTGTCTCCC
GGTCTGTGGCTTGTCATCTTCTAAATGAGGTCTTTCATAGAGCAAAATATTTTAATTTTG
ATGAAGTCCAACTTATTGACTCTTGTCTGGTGTGTGTTAATCTTTTGGTGTCAAGTCTAA
GAACTCTTTGCTTAGCTCTAAATTCAAAGGTTTTCTTCCATTTTTTCCTAAAAAAATTTA
GTTTTATATTTTGCATTTAAGTCTGTGGTCCATTTTGCATTAAGTTTTGTACAAGGTATG
AGGTTCACATTTTTGTCTATGTTATGTCCAGTTGCTCCAGCACCAAAGTCTATCCTTCCT
CCGTTGAATTGATTTTGTATCTTTATGAAAATGATCAATTGAGCATATACATATGGGTCC
ATTTCTGGTTTCTCTATTATGTTCCATTGATCTATGTGTCTGTGTCTCTGTCCAATAGCA
CACAGTCTTGGCTACTATAGCTAATTCTTGGAATCTGGTAAACTTATTCCTCCTACTAAA
TTCTTCTTTTTCAAAATTGATTGAGTTATTTTAAGTCTTTTGCCTTTCCATATACATTTT
AGAATAAGTTTGTCTATGTCTATGAATATTCTTGCCAGGACTTTGATTGGCATTGCATTA
ATCCTATAGGCCAATTTTAGGAGAATTGATATCTTTACAGTGTGGTGTCTTCTAATCCAT
AAATATGATGTGTTTCTCCATTAGGTCTTCTTTGACTAATTTCATCAGCATTGAAAATGG
TATTGTGTTTTTATTTTAGCTTCTTCATGCTCATTGTTAATACATAGAAATGCTATTGAT
AGTTTTATATGTTGATTTTTTATGAGGTGACTTTAAGATTCATGTATGTCGATCTTGAAT
CCTTCAACCTTGCAGAACTCACTTCCAGAATTACTTTATTCCTTATATCTATATATACAT
ATTAATATGTATTCCTTATATTTATTTTGGATTTCTTAATTCCCTACTTTTTTTTCCCTG
TGGACAATTATGTCATGTCAAATAGGGACAACTTTGTTTATTCCTTTCCAAAGTTTTTAT
TTGTTCCAATCAATTTGTTCCTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTTACCATTTTGAGTGACGTGGAAATTTTATTTCTATTTTAGTCTCTTTAGCCA
TTTTTACCCATTTATTTATTTTTCTTGCCTTATTGCACTGGCTAGAACATCCATACAATG
TCAAATAAGTGCAATGGGAGTGAACATCCTTACCTTGCTCCCCATTTTAGGGAAAAACAT
TCAGTCTTTCACCATTACGTATGATGTTAGCTGTAGGTTTTTCTGTAGATATTTTTTATG
GAGTTAAGAAAGTCACCCTTGGCTCGGTGCCTGTGGCTCAAGTGGCTAAGGCACCAGCCA
CATACACCTAAGGTGGCAGGTTCAAATCCAGCCCGGACCCGCCAAGCAACAATGATGGCT
GCAACCAGAAAATAGCCTGGCGTTGTGGTGGGTGCCTGTGGTCCTAGCTACTTGGGAGGC
TGAGGCAGAAGACTTGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCCACA
GCACTCTACCCAGGGGACAGCTTGAGGTTGTCTCAAAAAAAATAAATAAAAAATAAAAAG
TCACCCTCTATTCCTGAGAGATTTTATAATGAACAAGTGCTAGATTTTATCAAATTCTTT
GTTTTCATCAACTGATATGATCACACATTTTTCTTTCTTAGGCTGTTAATATGGTAGATT
ATATTGATTGATTTAAAAACATTAAACTAGCCTTGCATACCTAGAATAAATACCAGTCAG
TTGTTGTGTATAATTCTTATATACTGCTAGATTTGATTTGTTGGATATTTTTAAGTTCAC
GAGAGGTATTTGCCTACAATTTTCTTTCCTTGTACTATCTTTGTCTGATTTTGGTATCAG
AGTTAATACCATTGTCATAAATTGAGTTGGAAAGTGTTCTCTCCTCTCTTATCTTGGGAG
AGACTGTAAAATTATCGTTAAAACTTCTTTAAATGTATGGTAGAATTCTCTGTTGAAACC
ATCTAGTCTGGTGATGTCTTTTGTGGGAAATTTTAAAACATTAGTCAAGTTTTTTGTGGT
TAAAGGATTTTTTAGATTGTTCAGTTCATCTTGATTGAGTTTTAGTAGTTTGTGGTTTTC
ATGAGATTGGTCTATTTCTTCTTAGTTGTTGAATGTATTCATCTAAAGTCATTTTTAGTA
GCCCCTTATCCTTTTAACGGCTGCATTATCTGTAGTGATATCCCCTTTCATTTCCGATAT
TGTCTTCTCTCTTTTTATCTTTGTTAGTCTTGCTAGAAGTTTGTTAATTTGATTTTTCCA
AAGAATCAGTTTTTCATTTTATTAATTTTCTGTTTTCAATTTCATTGATTTCTGCTCTTT
ATCATTTTCTTCCTTCTGCTTGGTCTAAGTTTTTTGATCTTTTGAAAGTTGTTTCTAGTT
TCTTGAGGTAGGAATATGGATTATTTAGTTCAAATCTTTCCTCTTTTCTAAAGTAATGGT
TAGTGCTATAAATTTCTCTTTCAACACTACTTTAGCCCCACCTTAAATTTTGATCTTATC
TAATTATTCCACTATATTTAATTATAATACAGTGATCTATTTGTTTTCTTTTAGACCCTC
TGTTTCTTGTTTTATTTTTCTTTCTTATGGGTTACTTGAACATTTTTTTAGAATTCTGTG
TTGGCTTATTAAATTTTTTTATATATTACTTGGTATAGTTTTCTTGTGCTTGCGTAAATA
TGCATATGCAATCTATCACAGTCTACGATTATGGATGCCTTACCATTCTGAGTGACATGT
GGAAATTTTGTTTCCAATTTAGTTCCTTTACCCTTCCAAATTTTTAAATTTTAATTGTCT
GAAGTATTTCCCCTAAGTACATTGAGTATTACAATATCATGTGATGTTATAATTTTTGCT
TCAACCACCCAGTATGATTTAAGAGATTCATAAGAATGATGGCCTATTGTTTTCTACCCA
TTCCATTGTCCTTCTTTGCTTTCTAAAGTTCCAAACTTTCTTCCGTTATCATTTCCCTTC
TGTTTAGAGAATTTCCTCTAGCCATTCTTTAAGGATAAATCTGCGAAAGACAAAAGCTCT
TAGTTTTCCTTCTTCTGAGAATGCTATCATTTCCCCTTTTCCTCCTGAAGGATTACTTTC
ACCAGATTAGCAATTTGTGATTGACAATTTTTTCCCTTTCAGCACTTGAAAAATGTGCCA
CTTCCTTCTGGGTCTCCAAGGTTTCTGATGAGAATTTGCTGTCCTTTTCGGTAATACATC
AATCCCATTTCTCTTTGGCTGTTTTCAGTTTTTTTCTTTCTTTTTTAGTTTCAGAAATGT
AATTATGATGTGTCTTGGCATAGATTTCTTTGAGTTCATCCTGTTTGAGGTTCATTCAGC
TTCTTGAATCTGTGGGTCTATGTCTTTTGCCAAATTAGAAAATTTTTCAGCTGTTATTTC
TTCAAACCAAGATGACTTTTAAGCATGTTTTATATTTGAGAAATATGGCTCTGGAGTAGA
GTCGGAGAACTTGTCAAAGTATATACAAAATGCTGTGAGTGTTTTGTTTTTCTTATGGGA
GTGTCCACAATTTTCACTAGATACTCAAAAGACGCCGTGACACTTTAAATGTTACAAAAG
CATAGGTTTATGCCTTATTGGGTTTATTTTTCATGTTCTTGATTGGAACAAGGAAAAAAA
CTAGTTAGTATTCTTTTCTTTCCTTACACCGCATCTGTTGAATTCCTGTGTCTTAAAGAT
TTCTCCAACAGTTTTGGAAAATATGGTCACTTAGGTGAATACTTTCTGAACATCTAATGG
GTGCCAATCCATGGATTTTCTTTTCCATTTTTCTCCAAGTTAATGAGAAAGAAAAGAGTT
TAAAGGCTACCATTATTTTGGGGTTATGAGAAGTTGTAACTACGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTACAGGTGTGGCAATCAGAGTCAGTCCTAC
CCCCCCAGGTTTCATCTTCCCCACATTCTCACAAGCATCTGTTTAATCATTGATTTTATA
TATTTTTTGAGAATCAGTTTAAAAATTATTAGTCTCTCTTGCTAGAATGCCTATCTCTCC
ATTTCTAGAAAATATAGGCAACACTGACCCTTATCATTTTCCTTCTCTGCCTTAATACTA
GATCTTACAAGTCCCTTATTATTGTGTCTACATTTGTAGATCTGTCTCTCCTATCAGATT
TTAAGGTCCTTGAGGCAATGTCCATGACTTATTCAGCTCAGAGTCTCCAGGGACTGGTAC
AAGGTGACATTCCATAAATGCCACCAGAAAGAATTTGACGTTAGGTGATCACAGCTACAC
AGTCACACATGATTGGAGCATGCATTTCCTCATCGTCTCCACATCTTTACTTTCTATCTA
TCTTTTATCCTTCATTCTAAACCACTGTGAATTCATTTTTGGAGAGGAGAAATGGGTAAA
TGCAACACATTTTAAAGTAATTTTTTTTTTATTCCTCTCAGATACTACCTTGGCCGACGG
ATATTTATTGTTATTTCTGAGCCGAAGATGATCAAGCAGGTGTTGGTTGAAAATTTCAGT
AACTTTACCAACAGAACGGTATGTAGCTCTCTTTCTGCAGATGGATGGATGGGGAATCTT
TCTAAAATGCAGGCACCACGTGTCAGATCAAACAGGGCTGCAGTCAGCCTCTTAGCAGGT
TTAATTCAGTTGCACTCAAAACTGAGCTCCCTAATGAACTCAGGTTTTCAAAAGGGATAT
ATAGGATTGGTATAAAAATGTGGCATTTACAATCAAGCAATGCATCAAGAAAGCCAAAGC
TCAAGAGAAGTTGGGGCCAATAAAAATGCTCAGACCTAGAGAGTTTCTAACGCTGTGTTC
AAAGTCAGGGAGCCCAGAGGGCACAGGCCAAGTGACTGTAGAAGACTGAGCAAGGTTGAT
AAATGTCAGTGGGAAAGCACAATTTCGAGGCTCTTATGCTCACATCTTTCCCAGAGTGTA
TAAAATGATTAAGGCCGGAAAGGGAAGATAGGCAATTTTAGGAGGGAATTTGTCCCCAAG
TAGGAGAAGGGGCCTTTAAGAGGGCTTCATTATACTAGTTCAAGTCTCACTCCACCTACA
AAGGCTGTACGTAGCCTATTGTTTTGGAAATCACATGTCCTGTTCTTTATCTTTGATAAG
AAATCCCAAAGAATGTGAGAGGTGGCAGAAAATAGCAGAGGTGGGTGTTGTCCGTGTTTT
CCATTAAGCCTTCAGGGTTAAGCTCAAGTTCCCTTGACGAGAGTTAAGGGCCCCGTGATG
TAGATCAATAGCACATGCTCCACTCTGTCTCACCTGCTCCGAGAGGCCTGGCCTGTACCT
TCGCTCATGCTGACGTGCCCCTGGGATCGGAGGCAGCACAGCCGCGGGTCTTATGTGTAT
TACAACGTGAGCGGGAGCACCTTGCTAAACTTCTTTAAGCTTCTTGTTCCTCTTTTGGAA
GGGGCATGTGCTCTACCTTCCTGGGCTGTTGTAAGTGTGAATGGGACCAGGCAGGCAAGC
CGTTCCTCTGCACTTGGCAAGTGAGACATTAGTCTCAAGAACAAGAAAACCCTCCACTTC
TACAGCCACCCAAACGCTAGCTATTCATTCCTCATGGCTTTCCTCAATTTCCACCTCCTC
CATGAAGCCTTCCTTACCCTCCCTGACATTTGCTCATGAACTCTGATAGCTCTTAGCCGA
GTCACTCCTGTCTGCAGTCGCTCCCATTGTGGCTTCTATTATGCCCGGTGAAGGAAGATA
CCTGTGCCTTTTACCCTAACTTGATTATCGGCTCTATAAGGCCAGGAAGTATATCATTAA
CTTTTTTTTATACCCCCTGGCCCAGACATAGAATCCAATATATTCTTCTTCCAACTGAAT
TGAATCTCCAACACCTTGACATTCTTCCCAGAAGAGGAAGGTATTCCCCGAACCTGGAGA
TTCGACACACACCTCTTCATCTAGGCTTCTGGGTCATTCACAAACCTGTAGAACGACCCC
CCAGAGAGGAGAGCTCTAGGAAACCCCTGTGTTGGTAGCTTTCCATCTGGGAATGGATCC
ACTTGTCTCCAGTTTTATTTATGGTCTTTAAGCCAATTCCTTATTCATGGGAAAACAACC
CTTAGTGACTCAATTTTTTAAAAACAGTCATTAGAGTGGGATTTTCTCAGAGGTTTTTGA
AAGTCAAATTAAATTGGGTTCTGTGGTTCCCTCTCATCCACATGCTTATTTATCTGCTCA
GAGAAGGGAGATTAGTGAGACGTGATTTCTCCTCACCGACACCACACCGCCTTCCCTCTA
ATAGGCGACGTTTACTTAAGCACTCAGCAACTTGGCTTTATTATACATTCACTCAGTAAA
CATTAAACGCTTACTCCATGCAAGCTTCTACCAAACGGTCCCTGGTGATACAGAAAATGC
CCTGGCATATTAGTTTGATAAATTAAGTGAAAAGGAACTTAAATAACGTGCACTTTTATT
TTCTAACAGTGCGAGCCCATCTCTGTTCTCAAATCCGGACTAGAGTTACATGAGCTCTGG
GTGCCCCTGGGCAGCCTGGCAGAGAAGTCCCTGATCGAGAAAGCAGGGTTTAGCTTTGAA
ATTTGATGTGAGCTGTAAGCATCTCATCAGGGATCCCTAGAGTGTGTTGATGGGGCGGGG
ACACTACAGGGAACTCCCTGACATGCAGAAGGAGCACTGAGCAAGAACCTGAACTCAAAA
ATCAGTGAATGAAATATTCTTTTTCAAACTCCAGAACACAAGGCTGAGCAGACCCAGGGT
GGCTGTTCTCACCACTGAGCCTGTGTCATGTCTCTGCTCTGCCTTAACCACTTTCCCAAA
GGGTTTATGAGTCTGTATGCTGCCCTCAGACTTCTGAAATGCTGAGATGTGCAGCATTGT
TGCATCAAACCCAAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
GTCAAGCCCCCACCCACTGACGCACAAGAGTTACATCTAAAGCCATGTGATGGATTTGGT
GAGTGGTTTTATCCACAACCATCCAAAACCCAGGGGCGTGGCTGCCCCAGGTGCAGTCTC
TAAAAGGGCTGCTTCATCCATTCACCACATGGCCGTCAGAGTCATAGGATGAGTCACTGT
GAAACCATAGACTCCTTGGCACTGGCAAAGATGACTAATGTCATGAAGTAAATAAGTCAC
GGGAAACCTTATTAGAGAGGAACAGGAGTGTGTCGGCTCCTGGCAGAGCTCACCAGCAAA
GAAGGGTCAATTCAGAGCTATAAGTGGATCAGACTCACCTGTGCTGGGGTCACAGGACCT
GCCTGGTGACATCCCGTAGGGGGTAGATGTCACAGTCTATAACTGTCCCTTGAACTTGTT
CCCTCACCTATAACTGGTACTTGGCTACTACGAGCTTTTGAAAATGTATTTATCTAGAGC
AGTGGTTCTCAACCTTCCTAATGCCTCCTAATGCCATGACGCTTTAATACAATTTCTCAG
ATTGTGGTGACCTCCAACCATAAAATTATTTTTCGTTGCTACTTCGTAACTGTAATTTTG
CTACTGTTATGAATCGTAATGTAAGTATCTGATATGCAGGATGTATTTTCATTGTTACAA
AGGGGTCACGACCCACAGGTTGAGAACTGCTGATCTACAGTTTTGTTCCTTTTCCCTTAA
ATAAGACACTAAGCAAATGAGGACATTCAGATGTTCAAATGTGTACAGCAAGAGTAAGAG
TGGCTGTCATGCATGGGCTCAGGAAGCTCGCAGCACTTGGAACCTTGTAAACTTGCATTT
AGCTATGCATTTCTTGAGAAGGGTGAGCTCACACAGTGGCCCACGGTTCGTGGGGAGGAG
GAAGTCCTTCTGTGGGTGCAGACTGCAAAGAGCAGCGAGGCCAGAAATGCAGGTGCACGA
CCTCATTTGCCTGTCCTCCTATTTTGAGGCTCTTTGTCTTATGTGACACATTTTGCCATG
CACAGGAAACCCTCCAGCCTGAGCTGAGAGCTGCCTGTGCCAGGACAAGCTGCCCATTGG
AAGTCCCAGGCGACGGCCTGTCCCCTCTCACTCACTTTCCTGATGTCTGGACATGGCTAG
TCCCAGAAAAGACAGATCCACGTAATTGCATTTGATCTGCAGAACACACTGAGCTTCAAG
TTTCCAACATGGTAGCGAAGTTTGAGCTCTAACACCTTTAATGGTACCCCGAGTGCCTGG
TGAAGCCTGGGGACTCCGGGAATGGTGTGAAGTGCTATTGATTCTGAGCGCTCAAATGTT
GTTCTTTCTGCCTTGCAAGACATTTCTTTTTAATTTCAAAATCTTGTTGGAAATGATGTT
CTATGTTTGTGTCATGGTAGATAGACTCGTGGTTCAGCAGGAAGCCATCCTTGTATATTT
TTTAAAAGAAACAAGTAAAAAATCTTGTTCTGATATTGAGACCTTCTTGCCCTCACTTTT
ATAGTGGCAGAAGTAGAAATAAGTGTATAAACCAGGAGATTCATACGTAGAATTTGGGGA
TGAGAGTTGTAAATAAACCATGGAAGCATCTCTGGTCTCTCAATGGCTGTGTTCCAGAAT
GTTCTATGAAGGTCAAGTCGCAGTGCAGGGGGTCCTGCCCCCCACTCCCTCTCTCTGCTC
TCGTCTCCTCCTATTGTAATAAGGCCCCTTTCTTCCCATTTCCCTCCTCTAAACCACATG
CAGCAGCAGCACGGTGAAAGATCTGTGGTTCACATCGAAAGGAATGAAGTCAGATTCCAG
ATTCACTGCGTCTCATTAGTGTGTGACTTGCACCCAAATCTTTAACCTACCTGAGCCTCA
GTTCCCAACTGTGTAAACCCCGAGTATCAGACTACCCAGTCCTAAAGCTGTGCTGCTTCG
TTCCAGTTTGTGTTGGCGTCACTGCCACAGACACTAGCCCATAGCTCTCGCAGAGCATCT
GAGCTTGATAGTGGGTCAGCTCCTCTTTGGGTCCTCGAGAGAAATGTCTCTCCAGCAGTG
CACAGGGCTCTATCCAGACACCCTTGTCCTCTGTGATACTTCTGGCCAGAAGCTCCACTG
AGATCTGTTGAAGAGTTTCCCTGAGAAGATTTAACAAGCCTTTGACTCCCTTCCCCCTCA
GAAAGGGTCCTCACTGTTGGGCGGGGGGCTAACAGGGCACAGGTCCCACTGAGTATTTTC
TGCCTCCTTGGTGGATAAAATGCTGGAAACTCTCTCAGCCATGATCATCTGCACCATGCC
TTTATCCAAACTGGAAGAGGCTGCCTTTCCACCAGCTGGAGCTGAATTGGCAGGTGGAAC
CCAGGCTTGCTTTTAGCTGCCAGGTGACCCCTGTGCTGGTGCCCTTGAGCTGTGGACACA
CCTCACAACCTTACTCGGAGCTGCTCTCTCAGGCCAGCCAGCGTCTACAGCAGAGAGAGA
GAGATTCTGTAATCTTTATGGCCGTTTTCTCCTGGCAGAGTGAATGAATAAACATTGTCC
AGTGTAATAATAAAAGGAAACCTCTGCCATTTTCATTTTTAAATACTTTTTAAATCTATA
TTTATATTTGTATTTTATTTTTAGTAAAGGGAACACCTTTGCTATTTCAAAGCAACAAGA
TATAAGGCCTGTACTTGTTTCAAATCTTTCTTCAGCAAGACAGGAAAAGTCGTATATTGA
AAATAACTTTCAGTGTAGAATTAGGGGTCATCTAGGTGATAGAATTGTCAGGTTTTAGCT
GATTAGAATGCAACGAGGGGCAGTGCCAGATGTTTCTGGTTTCCAGGTGAGGAAGAGACA
GGTTGTCCTGGGAGCTTCCTCATCTGTGCAAGGTCATGAGAAGTAGAAAGAACGTTTGTA
ACAGCTGAGCATGGTGGACTTTCTAGTATGTATAGTGGAACCTTGTTAGCTGACCACCCA
AGGGACTGTAACAAACAGGTCCATATACAGAGGTGGTCAACATAAGGAACTAGGCCTGCT
GTACTGATACGTACTTATGGTGCGTGCCCAGTCTACAAAAGTCAGGTCAACTTGAGGAAG
TGGTCAGTGTAGGGAGGTGGTCAACTATGGAGGTTCTACTGTATTCATATTTTTGTGGCC
TACTTGGCATACCTACTAGACAAATCAGCCACACTCACATCACAACCACTGAAATAAAAC
ATTAACTCCCAGAGTCTTTAAAAGCACCTACCTGTCTATGTTTCCCTGGCACCCTCAGCT
CTGTGTGGCCTTGGAGGACTGCTGACTGCCCCGTCAAGGCATCATAGAGGTCATCTAGGC
TTAGAGTCAACGTTCTTGCATGTTCTGGAACACAAGAAAACTTTTTCAACTATAGTTTCC
TACCATAGTATGCCCTTTCTCCTAGTAATACGTGCACTCAGGTGTAGCAACAGGGCTCAG
CCTGCATTTTGCAACACTCTGGGAGAAGCCAGTGGCCCTCGCATAGCCATGCCAGGTGAG
GTCATTGGTGTAGCCCACAACACATGCGCGCTGAATGGCTGTTGTCCTCATGCAACTATA
GAATACTGAGGTACGGGCTTGTTTGACAACCTGTCCCTTGGGACTATGATTCCTCAAAGT
TTGAAGCTTACATTTAGCTGACCCAATAGAAAGTTAGACTTCTACTTAAGAGGAGGTTAA
TTGAGAAACCAAAATGTTTATCATCCTAGGAATCTTAGCAGTTGAGACAAGAGGCCACAG
CTAAGCCAATGCTGCTTATCAGGGCAGAGTGTACTAATTACTGGAGAATTACTCAAGAGT
TGAGGAAATAATGTGAAAAGCACCGGGTTAGCTGTAAGATCTGCAAATATTGGTCATAAA
CTTCCCTGCTCCCACCTTTAATTCTGTCTTGGTAATGGCTGTAGGAGCACAGCCCTCAGC
AGGCAGCAGGCTAAGTGTTCAGGACCATTCGGAGCTGAACTGCAAAGCCCAAACGTAAAA
TGCAGCAAACCCAGCTCAAAGGCTTGGCTGTGGCAGTGAAGTCGCATGTGTCTAAGCCCC
TGTTAAAAAGAGCAGCTGCCCAGCTCCTGTGGTGGGTCTATGTGGATGGCAGGAGACAGA
AGCTTCCACAGATTCAGAGTGGGTGTCTTCCTGTCAAGGCCTGGCTATTGGGAGCAGTAC
AAGCAAAGACCGACCAGCGGCCCCTCTGCCGGGTTTTCCACCCCTCTCTCTGGCTGGCCC
GTAGCACACAAATTCTCCAGCCCACCCCATTTCCCCTCCCCGCTCTGGCCCCTCTGTAGT
GACTTTCACTCGCTCAGCTCTCCTGCTCCTTCCTGCATCTTTTAGGAGGTGGGAACCAAA
GGGCCTGTGGGCTCCAAACAGGGACCACCTTGAAGGAGGGGACACAATCACAAAACTTCA
CATATCTCATCCGAATGGGAGTCCGTGTTGAATAAAGCAAATTAGCCACCTGGCCTTGGA
GGAGACTTGCAAAGTATGCCAAGGCGATTGTCCAAAGTCAGGGAGGTGAACGTGAACCAG
CGAGAGATAAACTGCAATTCACCCACAACATGTCAGAGGTAATGCAGCCAGGGGAGGGTG
AATAACCTCCAACTTCTCCATCTTTGGTCACAAGCAGAAGATGGAGAATCTGAATCAAAC
CTGGTCAGAGGGCTCGGCGCCTATAGCTCAGCAGTTAGGGCACCAGGCACATATACCAGA
GCTGGTGGGTTCCAACCAGCCCAGGCCTGCTAAACAACAATGACACCTACAACAACAACA
ACAAAAAATAGCTGGGCATTGTGGTAGGTGCCTGTTATCCCAGCTACTTAGGGGCCTGAG
GCAAGAGAATCGCTTAAGCCCAAGAGTTTGAGGTTGCTGTGAGCTGCGATGCCATAGCAC
TCTACTGAGGGTGACATAATGAGACTCTGTCTCAAAAAAAAAAGCACCCAAAAGAACTGG
TCAGAGGAGGGGAGAGGATGCTCTGACCACCCTTCACATCCCTCTTAACATGTGGCCGGC
ATCTGAAAACCATCCTCTGGATAATGAGGTGTAACTGCGTCACACCTGACAGTGGGACAC
CTCTTCCTGAGACCAGGCTCTGCTCCTGTCAGAGGAGCAGGACAGGCTGCCTGCACCTGG
CGATGATACCCCAACACCACCCTGCCAGCTCATGGTCAATCAGGTCCCCAGATCTTTTTA
ATGTGAATTATTGCAAATCTGATTTCTTCCTTCCTCACACTCTAAACAACTAAATTTTAA
TCTAAATATGAAGTCTTACAGTTACATCTGTTATTTTCATCTTGTTTGTGTTCATCCAGC
ATTCAAGTCTGTCCAAATTAAATGTTAATTGTTTTTTAGGTTTTTTAATTGAGATAACTT
CCATATATAAACCTTGCGCGTAAAGCTCAATGCGTCATCATCTATGTATGCCCCCATGTG
ACCATCACCCAGATCTGGGCACAGAACATTTCCAGGGCTTGTTATGCCTCTTCTCAATCA
ACCCATCTCTACCACCCAGAGGAAAGCACTCCTCTGACCTCTATTAGCCAAGATTCACTT
TTTCTGCTTTTGAACTTCACCTAATTGGAAACTTACAGTCTGTGTCCTTTTGTGCTGGCT
TCTTTTGCTCAATATAACGTCTATGAGATTTATCCATATCATGTACATAGGTCTCTATGA
AAGTTTTGAGACAGACTGTGTTCTGGTTCATTATTCTATTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCAGGTACATGTTTGGCTTTT
GTATATACTGACAGTTTTCCAAAATGATTGTGCTAATTTATACTCCAACCAGTACTGAAG
TGAGGTGTTACTTACTATCTTAGCTGATTCTTCTTCTTGTCACTGTTTTTAATTGTAGCT
GTTCTGGTGGCTGGTAGCAGTGGTATTTGTTGTGGCTTTAATTTGCATTTATCTAATGGA
TAATGACGTTGGGCTCCTTTTCATATGCTCATTGGCCATTTGGATATCATTCTCTGTGAT
ATGCCCTTAAATCTTTGCCTGTTTTTATTTTTTTATTTTTTTGGCTGGGGCCAGGTTTGA
ACCCACCACCTCTGGTATATGGGGCTGGCGCCCTACTCCTTTGAGACATAGGCGCCACTC
CCATTTTTTTTAAGGTGTTGACTTTTTCCATCAACTTATTTGCCTTCTTTATATGCTTTT
GTGAGTGTTTTTATCAGACGAATTGTGAAGATCTTCTCCCAATCTGTGGTCTGATTGCTT
ACTTTCTTCATCATGACCTTTGATAATAAAGTCCAATTTATCAAAATCCTCCATGGTATT
GCTTTTGGTATTCTGTTTAAGAAACCTTGACTTGCATCTGATGTCACAAAGATATTCTTC
CAGAAGTTTTATTGTTTTACCATTCACTATTGAGACTATGATCCACGTCCAATTAACTTT
GACCTATTCAAAAATGAACCTTGACCCATTAGTCAGGAAGGGTTCAGGGTTCATTTGTTT
TCCTGTGTTGATATTCAATTGCCCTCATACCATGGTTGAAAGGACCGCTCATTCCCCACT
GAATTGAATAGCAGCTTTGTCATAAATCAAGAGATTGTATGTGTGAATTTATTTCTGGAC
TCCCCATTCTGTTTCGTTAATCTATTTGTTTATCCTTGCACCAGCATCACACTTTCTTAA
ATATTATAGCTTTATAATCAATCTAGAAAGATGACAGTATAAATTCTCCTCGTTATTCCA
GTTCCTTTGATTCCATATACATTTTGATAAGGATCTGCTTATTGATTTTTGAAGAATAGA
CTTCATAACAAGATTGAATCTCCCAAATCATGAATATGAGATCTCTATTTATTTACATCT
TCTTTAATTTACCTTAGCAATTCAGAGTAGAAGTCTTGTACATCCTTTGTTAAATGTATC
CCTAGGTACTCGATAGTTTTACTGCCAATGTAAATTGTATTTTTTAAATTTCATTTTCTA
TATGTTTGTTGCCTACATGTAGAAATAAATTTTTTTAGTTTGCAAGTGTATTCAACAATC
TTATTAAGCTCAATATTAATTCTAATAGTTTATTGATAGACATTTCTTGAATTTCCTGTT
ATATAATCATGGGGGCTATAAATACAGATTACTTCTTCCAATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATATGCCTTTCTTTTTTA
TTCTGTTAATGCAGCCAGTTACATTGATTTTCAAAGGTTACCCTCCTGGAAGAAGCCCCA
TTTCATATTCTGTTTGATGAATTATTCTTTTAGTATATCCCTGGATTATATTAGCTAATA
TTTTGTTTAGGAGTTTTGCATCCATGTTCATGAAAGACACGGAGCTATAATTTTTCAGTC
TTGTAAGCTTTGTCAGTTTTTAGGATCAGTTTACACTCCCTCTTGAGATGGTCCAGATTG
CTGTTAAATTGTGATTCTGTGAATATTAATCTTCTCATCTGTGATTCCTGCAAATCAGTA
ATTCATTATGAAAATAGCAAATAAAATCTTCAGTTAGACTGGGCTAAGTGTAGAAGCCTG
TGGTTCTCCATTTGATTTCACATTAATAGAGTTTTATTTGTCTTTGGCTGTTCTACCAGG
CAGGAAACCACCCACCAGAATTATTTCTTCTCTTTCTCCATAAAAAAAGTCCTTGGGAAA
CATGAAATGTTTTGTTTCCCACATCTATAGATCTTTCTCTCTCCAAAAAAAAAAAAAAAG
TAATGAGGCTACTTTGGCATTACTTGTTAGTGAACTCACACTGACTCCTAAAGATCACTT
TTTAAAAAATCTTTTTATTATACAATGCAAGTAAGATGTTACTTATATGGGGCCGTCAGG
GTGAGGTCCAGTCGATAGGGCTTCCTTCAGGAGATGTTCTCTAAGCTGGGTTCTAGAAGT
TAAATAGTAGTTAACAGGCAACAGAGAAAGGGGGCTGGAGTGGGACCAAGAGTTTCACAT
AAACAGAATTCAAGAAATTCACAAGAAGGACAGACCCTAGAGAGAAGATGGCACGCTCAA
GGGAGTAAGAGAATAATAAGAAATTATCCTGACCCTCTTCCTGAGACTATTCTAAATGCT
TTAAATGAATTAGTTCAATTAATCATTCCTGTTGCTCAGTCCAAAACTGAGAGTCATCCT
TGACACCTGTCTTCCTGTCTCCCACCTCTTAAGCAATCCAGCAGGAAATCCTTCTGACTC
GTCTTCAGAAGCAGCCCAAATCTGACCATTTCTCTCCTTGTCTGTGGCCTCCACCCTGGT
CTGAGCCCCTCCTTTCTCTCCCTTGGTTATTCTGCTTCCTCCTAATGGTTCTCCCTCCCT
CCGTCCTGGCCCCTTACAGTCCATTCTTAACACTGAAGCAGAAGTGATTCTTAAAAACAG
AGTCAGCTCAAGACATGCCTCTGTTCAAAATTCTGTTATGTCTTTCCATATCACGTGGTG
TAAAAGTCCTTCCAAGGCCCTGGAGGCTCTCAAGACACAGGCCACCAACTATCCTTGCAC
TCCCACCACAGGCCCCCGGGAGCCTCCGCACACACAGGTTACTGTCTTTGCTACAGTGGC
TCCCCTGCCTGGTCCTCACTGCCCCCAGCTCCTTCAAGGCTTTGCTCAAATCTCACCCAC
TCACTGCAAAGCCCAGAGCTAATCCTGCACCTCGCCCAGGCCCCTGCACCGCGGGGTACA
TTTCTCATGCTTGTCCTCTGCCTTCTCCCGCTGGCGTGTGTGAGCCCAGTGAGGACAGGG
AGCTTCATTTTGTTCACAGATGTATTCAGCACTAAACAGGGCCCAGTCAAGCAGCCCTCA
TAATATTGCTCAGTAGCGAATCATCCTAGAGTAGCAGCCTTATTATCCCAATTGTAAATT
GAGAAATTGTAGCAAGGCAAGAGTTGGGCCCAGGGGACTGACTACAGAGGCAACGCTCTT
ACCACTGTTTTATCCTGCCCAAGCCCAGGGTAGAAACACAGCCTAAGGTTCCAGAAAATT
CCTCCCCCGTGTCTTCAGACTACTACTCCACAGGATTGGGAAGTTCAAGAACTTCAGGCT
TTGTGCTGTGTTCAGAAGTGGGTGGGGAATTGGCCAGAGCATGCCAGGCCTTATAAACCA
AGTTAGGAAGTTTGCACCAGGACAGAGCAAGATTTTTGCTTTCGAAAGATCCCGCTGACT
GCAGGGTAGAGGACAGATGGGTGTGACAGGCTGGAGGCAGGGAAATCAGTCAGGGGTTGA
GATAATGGTGAGCTCAGCCAGGGTGGGGACTGTGGAGATGGAAGAGTTGGCAGATCAAAA
AAGATCGAATAGTTGTGATGACAGGATTTTAGCTGAGAGAGAGGACAACTCCCAGGTCTG
GGGTTTGGGTGAGAATAGGGTTTTCAAACTTTGTCAAGACTTATAGTAAGAAACACATTT
CATATTTTGACACAGAATACACACACACACACACACACTCGTATCTTGAACAAATTCAAC
AAAATACTTGCCCTGACTCTGTGAAGTGTTCCTCTATATTTACTAGCCTGTTCTATTTCT
TCTTTCTCTTCTTTTGGTAAATGCTGGTTGCCACTCACTGCGCTGATTTGGTGACTGGCT
GTGGCCTGCAGTCTGGAAATCCCTGGTCAGGCAGTGATTGGAGGTGCCCTTGCTGAGACT
TGCTGGAACACACAGCTGAGCTCACCAGAGTCCAGAAAACTCTGTTTCCCTGGACATCCT
TTCCCAAGACTCCGAGTCCCCTTTGCTGCCTGACACGGCCCTGCCCCCCTCAAGTTTATG
TCTTGTTCCTCATTTCTTTGTGGAAATCCTTTGTGCCATTCAAAGGATCACTCAGAACCT
AATCAACGAACACATACAGACAAAGCTTAAGGACAGGGGGAACAGGGTTTAACAGGCACA
GAGTTTTAGTTTTTCAAGGTGAAAAGAGTTCTGTGGGGGGATGATGGCAATGGTAGCACA
GCAGTGTGAATGCTCTCAATACTACCGACCCGTGTGCTTAAAAATGGTTAAGGTGGAAAT
GTTTTGTTACGTGTATTTGCTACATTTAAAAAAAATTATGTGTAGGCAAACCAATGGAAA
AAAATGTCTGGAGTGGTCTTCTGGAGAGGAAGTCTCAGGGCTAGAAGAGTTCTTGAAGGT
CATTTAAACCAAAGTCCTCTCAACGCTCAAGCTTCCTGAATACTAAATTCCAAGAAATGG
TGCACAGTCCCAGCGAAGAACAGCTCGCTGCTCAAGGCATGCTGTTTTATCTTTGAATAA
TTCCGGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGAATCCTTAGGCTTTAATGACAGATACAAAAATCCAATCACTCTTGAGTCTTATCCCT
GATTCATTCTGTCTCAGCAGAACCACATAAACCATCACCCCACTTTCCTTGGAGTGCAAT
GCTTTATAACAATGTCATAGCTTAGCACAGACCACACTTGCCACTGTATAAATATCCATA
ATGTATGATTTCTCCTTTGACTCTAGAACCTAAACAAATGGATTATGTTCCAAAAATTCC
ATGAAACCATAACTCCGTTTGGTGGCCATGGCACTCCTAAAGAATTTCATTCTAAATATA
GAGAGGTATTCCTCTGCAGAAAAATATCCCAGCAACTTGGTTCTAATATATAATTAAATC
CCCTCTAGATTCTTTGCAGTTATATTTTATGGCTTATTTTGAGTGTTCATATTTTATCAG
AAAATTATAATTTTCCTCTAAAAAGGAGTTTTTTACTAGGCTTTTGAATTACGAAGGCTG
GCTTCATGTTTCAACTATAATTAACACAGTGAAAAGAAACAGCATTGCCACACATAACAC
ATGGTTCCAAGAATGCTGGGTCCCTCAGCCACCACCCTCCCTTCTCTCCACACTCTGCAG
ACCCAAGGCTGGGAGGCCACTTTGACCAACAGTGGGGGCTCACTTGGTGGGATAGGTGGT
TTTAGAAAGGGACAGAGTGGCCTGGGAAGAAGGGACAAGGAGACCAAAGCGTCCTTTACA
GGCTTCTGCACCCAGCTTCAACGCCCCTTCTCCCAGAGAGGCCTCCTACCCCCCACCTTC
CTCCCACCTTGCTCTGTTTTTCCCTTCACAGAGCTCACTTTGTCCTGCCCTGCCGTGACA
TCTAGTCGCTTGTATAGGGGCAGGCTCTGCCTTCTTCACACCATCAACTCCATGAGGGCC
AAAGCCAAGTCTTTTCTAGTCAACACTGTACAGATAAGTTCTCAAACCCTGTACTAGTTT
TCTATTGCTTCTGTAAACAGCAGAAATGTATTATCTTATAAAGCTGGAGGCCAAAAGTCC
TAGATCAGGGTGTCAGTAGGGTTGGCCTCTCCTGAGGCCTCCTGCTGAACAAGGCAAATG
GCTGCCTTCCTCTGGTGCCATCACGTGGCCTTTTCTCACTCTCTGTCTGTCCTGTCTCTT
CTAATAAGGACACCAGACTATCAGATGAGGATCCACCCTAATGAACTTTAAAGGTCCTGT
CTCCTCAGTATGGGAGTGGGGATGGAGAGGGAAGGATTGATTCTAGGGCCTCCTACGAAT
ATCAAAATCTGAGGATACCCAAGTCTCTGGTTTTAAATGTGCTTTCATATAACCCACACA
TCCTCCACATACTTTAAACCACCTTTAGATCACTGTTAACACCAACGCAATGCCTGCACG
CCACTCCTTCACGCGGATTCAACATAGTACCTGGTACAGGGCAAATTCACGTTTTGTTTT
TTGGAACTTTGTGGAATTTGTTTCTTAATAATTTTTGACCCATAGTTGGTTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGTCAACTTAACCAATCCAGGCACAC
TGAACACCTCATCACAAAGTTCAGACATGAACTGGGCCCCAGAAAAGACCCACCCATCTC
CAGGAAGCCTCCTGCTCAGTGGGAGTCTTGGAGCACACAGAAGCCACCATGTCATCTCTG
CAAAGATGACACACTGCACCAGGGTGGGACTGAGCCACCACAGCTACTGTCTGCTCCCTC
AGGACCCCAGACATGAAACTTTAGATCACTATCCGTGAGCCTTCCCGCTCTTCTGCTGTG
TCCTTGCAGCAGAAGGACAATGTGGTCCTGGATGGATTGTAATCAGAGCCCCCGTCATGA
ACCAGTATTGCCACTAAGATGGCTTTGACTCCCTGCATCCTAACCCCTCTGTTTGTTACT
TCCCATCAGGCATTGGGTTTGGAGTTCAAACCGGTAGCCAACAGTGTTCTGTTTCTACGT
GACAAAAGATGGGAGGAAGTCAGAGGTGTCCTGACTCCTGCATTCAGTCCTGAAAAGCTG
AATGAGGTAAGACATGGGAAACACTGGCTCCCTTCCCTGAAGAGCAGGTTTCTTCTCTCC
AAACTGTGACAGAGAGCGTGTTCTTGCTGCACACATGCCAGGTGGCACATCCAAACGCTC
TGCCTGCTGGAGCCTTCCACCCTCTCTATTATGCAAAAAGCCCAGAATCCTGTATTAAGT
GTCTCCTGCTTCTCCAGCCTCCCACATTCCCAGTTGCTGTAAATCAATGGTGAGTCCACA
ATTATACGAGGTATCCAGCTCTGTGCAGAGACACAGCTGGAGGAACTCTGGGAGACCCAG
GGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTGAATGCCATGTTGTCATAGCTCACAGCAACTTCAAATTCTT
GGACTCAAGTGATCCTCTTGCCTCAGCCTCCCTGTAGTTCTGTTTGTTTTTTGTTTGTGG
CCAGGGCTGGGTTTGAACCCACAACCTCTGGCATATGGAGCTGGCGCCCTACTCCTCTGA
GCCACAGGTGCCGCCCCATCCTCCCTGTAGTTCTAACACCTTCTTCCAGGGTAGGGACAT
GGTTTCTAAACAGCAAACCACTTTTTACATAGCAAGGAACCAGAGAACAGCTTGAAACAA
ATGTGAATACTGATCCAATTCTTAAATAAGGAAATGGTGGCCTGAAATTATCAGGGAGGA
GCAGGGGACATGCCTGGCAGAGTGCTAGGTGGGCACATGCGGGTTAACCTCAAGGCCAAG
TCCAAGGGAAGGGCCAGCTCCACAACATGCTGCCAGCTCTCTGAGGCCCTGGGTTCTTTC
CTTTCCCTACCCAATGGCCTGCCTTCCCAGCTGGCTGTGTCTGTATTGCCTCCTGGGCTG
TCTCCTGTACCCCAATCCTGACTGCTGGGTTTTATGTGCAAGCCTAATGTCTCCCTCAAT
TTCCCGTCTAGCTTTGATGCCTGCTATTCTGAATTTGGCAACAACTCAGAAGTGAGAACT
TGAGCCCTTCTATCTTTGAGTGGTTAAGAGACTCCCTCTGTAGAGTCCCAGGTACACCAG
CAACTCCAGAGCAGGCGGCCTTCTAAAGCTTGGCTGGAGGGCACTGAGCCTCAGACATCT
ACCTCCATCTGACTGTTTCAGAATGCCTGGGTGTACAGTAGCCTGTCTTCAGTTCAATAA
ATGAAAGCTACTTTTAGCTGAAGCTCAAGATGCTTACACATGTGGTCCTAATTGAATTCC
TATAAATCTTTTGAAGTCCCCCAGAAAAAGAAAGGGTTCCACACCTCATAACATCCAATT
AAACTCAGGCAGAAACTAGTGATCCTGCCCATTTTCAATGCGGTTTTGGTTTGCTGTCTC
CCTAGGTCACCTTTGGTATTTGGGGGCAGAGCACATCACAGTTCACAGAAGCAGCTCACA
CTCACCAGCTTTGTGTACCAGGCACCCATCCAAGTGCTTCCTGTTTGTATTATAATAACA
CACTTCATCTTCGCCACATTCCTGTGAAATAGATACTGTTATGATTATTATTATCACCCC
CATTTTACAGAGGAGGAAACTGAGGCACAGAGCAAGTAAGCAGTGTGCTCCAAATCACAC
AGCTGGGGATGGGGGCTGAGCAAGATGGAGGACCAGAAGGATCGTTCAGCTGAACTCTCC
TAGAATGACTGGGGAAAAATAGATAACTCAGCCATACCTGGTGTGGGGACCTTATCTAGA
GTCATAGCTCAGGGAGCACAACAAGGAGGTGGTGAGCTGGATACAGCATATGATCCAGAG
CAGTGGAACTCTGATGAATTAGACAAATGATTACAACCTGCTGGGATTGGCTGTCCTCCC
ATGGAGCTCTGGGATGGGAAGAAACCTTTCCAGAGTTTTCAGTTGCTGAGGGAAGCTACA
CATTAAGTGGAAAGCTTAGAAGAGTGGGCAGACTCCAACAGTATACAGCAACCCATATTC
GAATGCTGGTTGGAGTGGATTTGCCATAGGTTTGGTGGCTGGCAAGGCAGCCACACTGAG
GTCTCAGCAGCCAGGGGGCTGCCATTGTGGGAAAGTGGTGAGAAGGTCTTAGCAGGGTTC
TAAAGCATGGCTGTCTTCATTCCACCTGCCAGGATCAGATCTTCACACTTGGGAGAGGCT
GAGGGACTCCTGCACCCCATGGGAACAGGGGGCACTGTGAGACCTGCCCCTGAAGGATTC
TTGTGAGCTTTAAGATACCAACCTGGCAGGGTCTGAATGCTGAGGAAATAATCAGGTGAT
TACCAAAGGCAACTAAGTTTGGAATAAGAACCACAGAGACTGCTGGCTGTGCTCCATCTT
CTAAAAAAACCACAGCACCACCTGGTGTCCCAGCAACATACTGTCATCAAGAACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAATAAGACGAATAGAACTCCACCACAC
TTATTAGTTCTCCCAAAAAATGTCAATGCACTGAATTCCCTACTGAAAAGGCACAGGCTG
GCTAATTAGATTAAAAAAAAAAAAAAAAAGCCATCCATATGCTGTCCCCAGGAGACACAC
CTAGCATTGAAGGACAGATCAAGACTCAGGGATGGAAAATAGTATTTCAAGCAAATGGAA
ATCAGAAGAAAGAAGGGGTTGCAATCTTATTTCCAGATACAAGTGGATTTAAAGCAACTA
AAGTTAAGAAGGACAAAGATGGACACTTTATATTGGTCAAAGGAAAAATATAACAAAAAG
ATATCTCAATTTTAAATATTTATGCACCCAACTTAAATGCATACAGATTTATGAAACAGA
TCTTGATAGCTCTGAGCAATATGATATCCCATAACACCATAGTAGTCAGGCACTTTAACA
CCCCTGTGACAGAACTGGATAGATCCCCTAAACAGAAACTAAACAAAGATACAAAGGAGT
TAAATGTGACCCTAGAATAAATGGGATTAACAGACAACTACAGAACACACCATCCCAAAG
CTAAAGAATATACATTTTTGTCATCAGCCCACGGCATGTACTCCGATTCTGACCACATCC
TAGGATACAAATCAAACCTTAGCAAAATTAAAAGAATAGAAATTATACCTGTATCTTCTC
AAACCACAAAGCAATAAAGGTGGAACTCAACTCCAATAATGTTCATCTCCACACAAAGAG
TTGGAAATTAAACAACCTTATACTGAATGATAGTTGGGTTCAGGAAAAGATAAAAGAGAA
AATAGTTAAATTCCTCAAACATAATAATAATGAAGACACAAGTTACCAAAACCTGTTGGA
TACAGCAAAACAGTCTTAAGAGGGAAATTTATCACATTAGATGCCTACATGTAAAAAAAC
AGAAAGAGAGCACATCAACAAACTCATGAACCATCCTATGGAATTAGAAAAAGAAGAACA
ATCTATCCCAAACCCAACAGAAGAAAAGAAATAACCAAAGTTAAATCAGAGAGGAATGAA
ACTAAAAACAAAAGAATCACTCAGAAAATTAACAAAATAAAAAGTTGGTTTTTGAAAATT
ACATAAAATTGGTAAACCTTTGGCCAGATTAACTAGAAACAGAAAAGTAGCACTTGGCGC
CTGTGGCTCAAGTGGCTAAGGTGCCAGCCACATACACCTAAGGTGGCAGGTTCGAAGCCA
GCCCTGGCCTGCCAATAACAATGACAGCTGCAACCAAAAATGGCCGGGCATTGTGGTGGG
TGCCCGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTTGTTTGAGCCCAGGAGTT
GGAGGTTGCTGTGAGCTGTGATGCCATGGCACTCTACCCAGGGGGACAGCTTGAGGCTCT
GTCTAAAAAAAAAAAAAGAAAAGAAAGAAAAAGAAAAGTAAAATTTCTAATAACCTCAAT
CAGAAACAATAAAGAGGAAATAACAAGATATGCCACAGAGATACAAGAAATCATCTCTGA
GTACTACAAGAAACTCCATGCCTAGAAATTTGACAATGTGGAGGAAATGGATCAATACCT
GGAATCACACCCTCTCTCTAGACTTAATCAAGAAGAAATAGATCTCTTAAACAGACCGAT
TTCAAGAACTGAGATTGAAGAAACAATAAAAAAAATCTCCCAACAAAAAAAGTCCTGGTC
CAGATGGCTTCACACCAGAATTCTATGAAACCTTCAAAGAAGAGCTTATACCCATACTGC
AAAAATTATTCCAAAAAACTGAGAAGGAAGGCATCTTCTCCAAAATGTTCTACAAGCAAA
GGAAACATCTTCTCCAACATGTTCTACCCAAACCAGGAAAAGACCCAACTAAAAAGGAGA
ATTTCAGACCAATTTCACTAATGAAGATAGATACAAAAATTCTCAATAAAATCCCAACCA
ATAGATTACAGCTACACATTAAAAAAAAAAATTTACCACAATCAAGTAGGTTTTGTTCCA
GAGATGTAAGTCTGGTTTAACATATGCAAGTCCATAAACATAATTCACCATTACCAATAG
AAGCAAAAACACAGACCATATGATCCTCTCAGTAGATGCAGAAAAAGCATTCAATAAAAT
TCAACATCCTTTTCTAATTAGAACTCTGAAGAGTATAGGCATAGGCGGCACATCTCTTAC
ACTAATTGAAGCCATCTATGACAAACCATAACTAATATTATTCTGAGTGGAGTAAAACTG
AAAGGTTCATTATGATGTGTCTTGGAAAAACTGTTTGAATTGAGATGACCTGGGGTTTGA
TATTTATCTAGAAGGAGTTTGTCAGGGTCTTCAGTAAAACTTGGGAAGTTTTCATTTATG
AGTCTCCAGTAGGGCTTCCATTCCTTTGGAACAATCTTCCTCTACAGGAATCCTTATTGT
CATATGTTTGAACACTTTGTGGAGTCTCATAGTCTCTAAGCACCTGTTCTGATTTCTCTC
TCTTGTGCTCTTTAACTACCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCTCTGTTTTGAATCTTCATGTTTAAAAAGTTGTGCACCACTATTCTACTTCACCT
AGACAAGCTAGGTGCAGTATCCCCCTTTATGACATCCAGCTGCTAAAAGGTTGAGTTAGC
CAAGACAAGGCCAGGGGAAGGGAGGTGAGGATGGTGAAACTATGGCTGAAATCTCTAGCT
CCAACATACTGTGTCATATGTCTTTATTTGTTGAGTAAGTAATGACTTCCATAGCATTAT
AGATGGAGAAAGAACCTCATCATCTGTGGAAAATAAGTTGGTGTGGTATCTGAGAAAAAG
AAAAAAAGAAAGAAAAGTAAAATAAGGAGAACAAGTTCTCACAGTCTCCAGCTATGGTTC
TTTGATTCAAGGAATCTCATCAGGGTCTAGATTTCTTTAGCATCTTATAGAGGGTATCCC
AGAAAGTGATACAATATCACTTCCTAAGCAAATCCAGTGTTTCTAGGATCTAATCATCTC
CTTCTGGTCCATAAATTAAATCCTCAGTACCTGAATCAGTTGCAGAAAATAAATTTCCTC
CAGGATGTTCACATTAAGATGCTGAGAGAGAGCATTAATAGACAGAAATTCCCTAAGTGT
CCCATTATGTAATGATCCTCCCAATAAACTCAAAAGGTCCTTGATGAGACTACAAATGGT
TAATAATGAAAAGTCCGTTGAAAGTCACTTTTCTACTCCATACAGTTCAATTTAGGCTCT
TGGTTTGGGGTTGGAAGGATTCTATTCTAGAGGATGGGGTAGTCCCCAGCCCTGAGAGTT
TAGACCTGGCCAGCTAAGGTTTCTGGAGCATCTAGCATCTACAGGAAAAGTGCTGTGCAG
GTCTGGGGCTCAGGTGAGAATGGGGGGAAAGACTGTCATGAAAACACAGATACAGATGCG
GTCACCCAGGGAGTGTGTGTAGCATAAGTGGAAATATGGTCTGGGAGAACCACACGTAAG
GGAGGCACAGAGGAGAAACCTATAGAGAAGGCTCAGGAAGGACAGCCTGAAAGGGAAACC
AGGACTATGTAGAAGGGGGAAGTATTTCACAGAGGAAGGGGCAGCTCAGGTGTTAAGTGC
TGCTTAAATATAAAGAAATAACAGGACACAGATCACGTTCTGCACTTCATGTTAGCCAGA
AGGCCAAGACAAAATTACAGATAAACTCTGAAATGTGAGAGCAACATATGTGTGTTCCAT
GGTCCATGGATCGTGTTTCCTGTGATCTCTCCTACCCACCAAATCCATGGCACCACTGCG
TCTGAAGGTGCCTCTGAAGGACACTTTTGTGCTATCCAGGACAAAGAAGTTGGTGCTCAG
ATTTGAACTGTGCATTAGGCTTTCTGGAACCCGGGTGAGACAATGATTTTGGAGGCCAAG
CTTTGTGAGGGGAGAAAAAAGTTTCTCTAATTCCAAAGGCAGCTTCCTTTTGTGTACGAA
GAGCAGGGCTTTGAGGCTCTGAGCACGGAGGTCTCTGAGCGAGGTGTTGCAAGGTGCAGG
TATGAGGTGGGGGTGGTTTCTAGCCCATGCAAGATGTGGGGAGGGAAGAAAAAGGAATGC
AAGCTGCCCCACAGGCATGCCCACACTGAGTCCTTCCCCACACCCTCCTGGCTTCTTCCT
TAGACTTTAACTTCCCAGTCACTTTGTTGTCTAGGTCACTGGTTCTCAAACCCTATGGGA
CCAAAGGCTGTATCAGAATCAACACCCCCAGCTAACATTCCATTTAGTTTACTTGTTTAT
TGTGTTTATTTCGTGTCTCAGTCTGCTGCATGCATGCTTTGGGAAGACAAGGGTAACATT
TCTTTTTTTCTTTATCGTTAACTGCACACAGTAGGTCCAAAATAGGCACTTAGTAGGACT
GAGGCATGGGTGGCTGGATAAGAAGCAAACACTAGGAGACTTCCTACCAATTCTCCCTGA
GGATGTATGATAAGACTAAGATTAAAAAGAAATAAAAGGGAAATAATTTCATCAAGGAAA
AATGGAGAGGATGTGGCAGATTGCGGGCTTTCTCTTCAGAGAGCCACGGCAGGTCACAAA
GACACAAAGAGGGAAGCAAGGAGACACATAGAGACAGGAGACAGCTCAGAGACTTTGAGC
CACAGATCCTCGCTGTAGGCACCTGAGCCAGTTTTCCCAGAAATAGCTTTGAAATATCAA
CATCTCTAGTTTTCCCAGAAATAGCTTTGAAATATCAACATCTCTAGTCCTTGTTGAATT
TGTAAGCAGCTTTTGGATTTTTGTTATCAAACATCAGGGTTTATTCTTGAAATAAAGGTT
TGTTTTCCCTTGGAATTCTGAGGCTTTTTCCTTGAGAACCTTGGCAGCCTAAGTCTCTCT
CTACCTGTGTCTTTAAGTGTCATTAATATCCAAAAGCTCTGGATGGCTCTATCTTTATTT
ATGTGGATTTTAGGCTGCCTCGGTCAACAATGCTTGGAAATTACTTTAAAATCAGCATTA
TATCATAAAGCCATATTTTTATTTAAAATAAAATTGGTTTTTGGCTCAAGTCTTACCAGG
GCTAATATAAAGAGAGAGAACCAGTGAAAATGTGATTGATGCCTCCCTGATGCAGGAAGG
ATGGACCGTCAGAGTCATAGCCAGTGACAGACAAATCATTGGCATTTATATTAAAGGATT
GCCAGGCTGTGCTGGGAAAACAACTACTTTTTTATCTGAGGGCAAATTTTGCCTGATTAA
CTTGCCACCGTTTCCATCCCTCCCCCAAAGGATTAATGCCTTTAAAAGGGCAGCCAGTAG
ATTTATTTAGATTTTTATAATCTTTGTTAGTGAGCAACCCTGGGATCATGTAAAACTTTA
TTATGGATCCAGAAGTAAATAGATTTCATTTCAGGAAACAAAATTGGGAGTAAATTGGCA
CTTCTATAGGGGAAAAATATAAACAATGTGATCCCCTAGGGACCCAGGTTACATATTTTT
AAATTATGTAACTCATTTGAAAGAGGGAGACCAGAATGAAATCTATATATTTGTATATTC
CTCTAAGCTCTTCTGATTTGAGAAATATTAAATCAATAGGAATAACTTTCTGAGACTCTC
TTAAGATTGTGTAAGTCAGCACAAAAGTGCCAGGTAACCTTCAGTATAAGCAAGAATAAA
AGAATACATTTAGGAGAAAAGCATCTAAGCTATACATACACGATGACAAACTTCAAGCTA
TGAAATCTTACTGAGGAAAAGGATTTAAAATCACAGAGGACCAGAAAGGCCCCAATGGTC
AAATAATTTGGTAAAATATTGCAAACCCTCTTCTTTGAGATTCACCATGTACCTTAGCAT
ATTAAAGTCTTGGGAATGACCTGCAGTAAATAAATCTGTTTAACTTTGTTCTAAGCTCGG
ATAAGTTTTCAAAAGGTAAAAACATGGGTAGTTAACTTCATAGGTGACTATCATGAGAAA
TAAGCATCTTGGCACTGTACCTTTGCAGGTGGTCCCCCAGGGGGATTTCTACTTGTGAGT
GCCGCTGGCAGAGGCCAAGCTCCAAATTGGACGGCCCACGGGTCCAACCCAATATGGCAG
CACCTCACATGTTTGCAGTCTTCAAAGCCCAACATAAGTACTGATGGGCATTTCCTCATT
CGCCCAGAAAACTCAGAACTGGTGGTAACCCACTGAGCAGATACAAAAGACCAGGTAACT
TAATATGGAGAGGGTAGCCTAAGGATGTATGTGTCACTCAAGAGTAAATAAGCAATCATA
TCGCTGAGCTCGGCTGCCAATACAGACAAGTGCAACAGGGGAGGCTGGTATCATGCACAG
CACTGAGAATCCAGCTCTCTGCCTAATTTTTCACTTTTCATCCAGATGTTTCCTGTCAGG
AAGGCGTAGTCAATAATGTATGAATCTTAATGGCAGAGGAAGATGTGCTTATTATTCCCC
ATAGGCCTTTCCTGCCTTGGAGAAGACATGTTACTCAAGAACGACTACAATTTTTAAAAA
TTTCAGCTGATATAGCCGGCTCATGAGTAAAAGCGTAGCTACAACCATTTCAGTGCAAAA
GTCATTGCAGAATTACAGTCATCATCACAGTTGAGTTTGGCCTTTAAATTTTCCCCATAA
GCTCTTCAGACAATCACATTTGGGGACTTCTTAAGCAGGACAATTTTCCAATAACGTTAG
AGCAAGTAGTTTCCTCTAGGCAGCAGCCTATTTTTAATATTTGTTTTTATTTCTTAATCC
TACAGAACAACAGAAATGAAAGCCGTTATAACCAGGAGTGGCTGTGGCAATAAATACTTC
AGGGTCCAAAAATACATTGCCCCTGCCTGACCAGTTGCCCATTTTCCAGAAAGTCTGGGT
ATTTATCCAGCAGCCAGAGACCATTATCCCACAATGCAGTTGCATTCCACTGACACCTAA
TCTCCTAATTAAAATCAGTATAATGATGGACTGTTTAAATTCTGGTTAAAATGTGCCTTT
TCCATTTGCATTTAAAAGAAAACACACTCTTCATCATGGGTACCCCGTCCTGGGTTATAA
TTTGGTTTTCCTTTGCCGGAATTATAATGTCACTCCGACTTGCCTCTGGTTAAATCTAAA
AGAGCATCTAAACGTGCCTCACAGCTTGGCTGTTGCTTAGCAACACCCGTAGACACTTCC
TCATTGGGGTGAGTCCTAATTGGTCACAACTCTTGACAGGAGCCACTGACTTATTAGAAA
TGACACTTGATTATTCACCTAGATGGCTAGAACTGATAGCCATCAGCAGGAAATTTTGCA
TAAGAATGAGTCCTGGATGTTTTTAATATCTGGGTGGCTTTTAGAAATGGTGTAACGGAA
GAAAGAAGTGATAAGTTTCATTAGCAGGAATTAATTTTTCATTTGTTAGTCACCAGTTTA
GAGCACTTTAAGGTATTAATTTTTCTATTTTTTAAACCAGCAATGTTGTTAAATTGCTCC
CCTCCTCCCCTATTAGCTGTCCCTTATTTATTCAGAAAATCCCCCCTCTGACATCAGTTC
TGAAAACAACATTGCCACAGGTCTACCAAGCACCAAATAGGATGAAATGGGAAATTCATT
AAGGTCAACAAATATTTACAAGTTCCTGTTTTTAAGGAATGTAATGTAGACGGGCAACAA
GGTACATAAATTACTACAATATTGCTGAGTAGCAGAAGATGGTGACAGAGCTCATGTCCT
GTGTGGAGCACCAGAAAGCACTTTGGGGGCAGGTGGTAGCTCCGCAACCTAACCCTGAAG
ATCTGGCTGAGTGTCGGGAGGGAGAAGATGCGTTGCAGGTGGGGTGAGCTGCAGGAACAA
AGGCATCTGGACAGAAAAGTACAGGGTGTGTTAAGGGAGTAGGGGAGTGCAAGCTGGCTG
GAACACAGGGGGCGTGTGAACAATTAGTGAGAGAAACAACTGGAAAAGTAGGTGGAAGCA
CGTGGAGTTCACTGTTCTGTGCCAGGGGCGTGTTTGGTGCATACTTTGCTGCAGCACAGG
AGCTATTAAATACGTGAAGGTGGGGGAGTGACCCGCATAGGAAAAATGGCTCCATCTCAG
CCGTTCAGCCTCCAAGACGCCAGACATTCCCCAGACTCATAGGGAAAGTCCTCCTAGAAC
AGATAAAGGGGAACTACATATCACACCCCTCAAGTCTCTTCTCTGTAGCCCCAAAGCAGG
ACAGACTCCCAGGGGCCGGTTTAGGTATCAGACTGTCAGTCTCTACTTCATGTGTGGATA
AATGAATCTCCCGGGCAGTGTGTGGAGATTGTCTCAGGTTAGATGTGTAGGTAAAAGAAA
TCTCTCCTTCCTTCTCCCTGTGGAGGAAAGAGGTTTTCCCCAGCACTCAGCATGGTCTAG
ACTTCCAGGAAGTCCAAAGGCCTAAAGATGGTGGGTTTCTTTTTCTCCTGTCTTTTTCTC
CATGTCAAGTTCATGACATCAGATCTGCATAGAGTGAAATTATAGCCCAGAAGCAAATAA
ACGGAGGAAGAAATGAAATGTGGACCTGCTGTTGGTGGGAAAGTGTCTGGAGTGCTAATT
TTCACTGTCATAAAACTAGCTGAGCACAGAAACAACCAGACTCAGCTCTTTAGGTCTTCC
TGTAATTCTGAAGTCAGTGCATGAAAGAGATGGTGGCTTTGTTAGAGGGGGGATGTGCTG
TAGCAAGGAGACGGGCCCCAAGGTCTCACATATTACTGCCCCACACTAGGAATTAAGCTA
CTCTTCCCATGGTCCCAAGCAAATGTCTCAACCGGATGCTTTGTGATCTGCTTGGAATTG
TAGAATGTCAGTGGAGAGAGTGTTACAGCTCTTTACAGTCAGCCTCTCCTTTTGGGGAGT
AAGGACCCGAGTTCAGAGAGACCTAGATACCATGACCAAAGTAAGAGGTAAAGTCCTCAT
CGGTTTCAGGTTCTCACTCAGACCAGTTTCAGCAAAATACACCTGTATCATTTAAGTGAT
TCTTGAGCCACTCTCTATGCCAAGGCTCTCAAGGAATGGTGTCAGCAAATCAGTCATCAC
ACAGATGTTTCTACACAGTCCATTAAGTGAAGCACACCATGCCCATTCCTTAATGTAAAA
AATACCAAAACTCCAATATGCATGATAACATACCCAAGTTACCACAAAAGAATAGCGTTG
AGAGCATGTTAGTTATTGCCATGTAGCCTAGGAATGGTGGCTTATGCCTATAATCCTAGC
ATTTTGGGAGAATGAGATAGGAGGATCACTTGAGGTCAGGAGTTTGAGACCAGCCTGAGT
TGCACAGTGAGACTGTCTCTACAAAAACTTAAAAAATTAGCTCGGCATGGTAACATGCAC
CTTATAATCCCAGCTACTTGGGAAACTGAAGTAGGAGGATCACTTGAGACTAGGAGTTTG
TGGTTGCAGTGAGCTATGATCACACCACTGCACACTAGCCTGGGCAACAGAGTCTCAAAG
AAAAAGAAAAGAGAAAAGAAAGAAAGTAAGGAGAGAAAGAAAGAAAAGATTACCCCTAAA
ATTTAGCAGCTTAAAACAAACCTTGGTGAGCTCATTGTTCTGTGGGTCAGGAATCCTGGC
ATGGCTTAGCTGGATGCCTTTGATTCAAGTTCTCTTGTAGGTATAGTCAAACTGGACTGG
TCTGTGGTCTCATCCGAAGGCTTGATGGGGGAAATTGTGCTTCAAAGTTCATTGGCAGAA
TTCAGTTCTTAATGGGCTTTGGAAGATAAGATGTTTGTACTATGTTCTTCAGTCCATGGA
GATCTCCAAAGATTTAAGCAAAGCATTGCTCAGATTACAAGTATTTTTAGAAAGCCAGTC
TGGTGACTGAGCACAGTTTGATCAGAGAGTTAAAAGACAGGAGGCCAGTAATCTCTTTTT
AAAATTATTTTTTTAAATGCACCTGTGTGTCAGACACTGTCAGAGTACTAAGACTACAAA
GATACTTAAGCTATAGTCTTTGCTCTCAAGAAGCAGGGTAATGGCCATATTCCAGATGAC
AGGTACCAAAGCTTGGATTAGGGGATGACTGGGGAGATAAAAGTGAAAGGGACAGATGCA
AGAAAGGAAGCAATGTTAACGTGATGAGTCAAGAATAGGCAGCTCCAGTGGAGAGTTGTC
TGTAAGGAACAAGAGGAGAGAGAACAATTCCAGATGTCCACACCCATCTGGGAGGTTGGG
ACTCGGACAACTACCGTGTGTGGACATATTTTGTTTTACATATTTTGTTTCTAATCTTCG
TCACAACTCTTTATGGGAGGTATAATTTTTCTCATTTTGCAGATGAGGAAACAGACTCAG
TGAAGTTGAGCAATTTGCCCACAAGATCACACAACTATAGAGTGACAGGGAGAGGAAACT
CAGTAACGGGCAGTGCCTTCAAGTGTTTGTCCTCTTTCAGGGAAGGGTTCTTTAACAGAA
CAGAACCTTTTACTCGAAGAAGGAACTCAGTGGTAAAAATTCTGGGGATCACCTAAAGGG
AGAAGAGCAGAAAGCCTTTGAACAAACAGGAGATTTTCTCAGCCCTTCTTACGTCATTAC
TCCATAAATTGTCTCTTTGGGCCACTTACAAGACCCTCCTACCTTGTGGAATTTACTCAA
TTGCCCTCTGTCTACACCTTTACCCAGAAGTCCTTGCACACAATTAATTTGGTAGCAAAT
CCTTTCTTTCAAAACTGGGCATTTCAAGTATATAACAATTTCCAAATTCTGGCTGGGTGC
AGTGGCTCACCCTTTATTCCTAGCACTCTGGGAGAGAGAATCCCTTGAGCTCTGGAGTTT
GAGACCAGCCTGAACAAGAGTGAGACCCCATCTCTACCAAAAATAGAAAAATTAGCCAGG
CATGGTAGCACCTGCCTATAGTCCCAGCTAATTGGGAGGCTGAGACAAGAGGATCACTTG
AGGCCAGGAGTTTGAGGTTGCAGTGAGATAAGCTGATACCATAGCACTCTAGCCTGGACA
ACAGAGTGAGATGCTTTCACAAAAAAAAAAAAAAAAAATCTCTAAATTCTTTCCTTAGAG
AATTTTCTAGGCTGAGAATAGTGCTTTGCTGTCAATGGTTATTGCTAATTACCAAATAGC
TGCTCAGCCAAGCACTGAGCTTAACCTCTAATGGGAACAACCAATATGAGAGATGAGAGA
ACTAAAATGGGAAACTTTCTCTCCAGGCTTAGCTGCTGGCCCATAACCCCTGTCTTAGTC
AGCTTGTCCTGCCACTACACAACACGGCAGACCAAGTGGCTGAGCAACAGACATCAATTT
TCTCACATTTTGGAGGCTGGAAGTTGGAGACTGGGGTGCCAGCATTGTTGATTTCTGACA
AGCCCTCTTGTGGTCACATGGCCTGTCCTTAGTGCACAGGAAAGGGGAAAAAAAGAGGGA
GAAGAAACACCCACACTCTGGTACCTCTTCTTATAAAGACACTAATTCTATCAGATCAGG
GCCCCATCTTCATGACTTCATTTAACCTTAATTACTTCCTCAGAGGCTCTAACTCCAAAT
ATAGCTATATTAGGAGTTAAGGCTTCAACATGAATTTTGAGGGGACACAAACATTCAGTC
TGTAGCACCCCTCAAGACTAAATAATTTTTAAAAACCTAATAACATGAATATTGTATTTG
ATTCTAAGTGTAATATATGTGTATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTA
ATGACCCATCTACACACACTTTTGTATGATGGATTATTAAACTGATGGTTTGTGAGAATT
TAGGAAAGCATGCAGTGGACAGGAAGAGTTGATGCAGAGTTACTAAGAATAACCCAGGGG
AGTGATGCTCGCTTCTTTTCTGAGTGGACTTCATGCTAGGCAGAAGAGGTAAATCACATT
TCTGCTTCAGCAAATCATTTGACCAAGTCTTCCCCAGCTGACTTAGCAGTAAGATGGTGC
CTGGCCGAGTATTTACTTAGGTTCATGCACAGCTGGCTAAAGAACCAGAAACTGTGATGA
TGAGCAATTCCACGGCTACCTAAAATAGCCGTCTAGTGGAGGGCCACTGGGCTCTGGAGC
TTGATCCTGGCCACACAGCAAGGAGCTGAATGAACCTGAAGACTTAGAAGGCACATTTAG
CAGATTTCAGACAAAACAAAGAGAGAATAGCCAACGTTAACTGCTGATGGGATTTTTCCC
CAATGAACAAACACCCCAGCATTCTCAACCCTCGCAGCTTGATAAACAGCAAATCCTTTT
CCCCACAATTGCCCTCCCTCCATGAGTCTTGGCAACAAGGGAGGGTCCAGATGCTCAGCC
ATCTCTCTGCCTGGGTGTATTCTGCTCTGAATGTTCAGCTCCTTGAGCTGTTGTTTGGCT
GCCTGTAGATGCCACGAAGGCCATTGTTCCTGCCTTGGGGACCTCCTCCATGGGCCAGCC
TTTGTGGAGCCAGCACAGCCCTGAGCTCAGACCACATGCGCTCACTCAGCAGGACTGACT
CCTTCAGAGAGGGAACCCATGGCAAAGCAATTGTGCCCCTGAGGACACAATTGTCTCCTT
CTACCAAAGAGTACATAGGACTGGCTTAGATGGGGCCATGGAGGGAAAAGTTCCAACAAG
GCCTGTGTCCCCTACCCCACATCCCTCTAATAGCACCCAGACTGCGCCCCTCTGCCAGGA
ATCTCCAAACACCCAAATGTTCCAGGGAAGTTAAGAGATTGTTCTGGTCAGAACACATGG
TAGGACCACTTTTCACAGAATAAAATGCAATGTATATATAAAGCCTTCCTAATGAATGGA
CCCTCAAGGGCAACATTTCAATTGCATCTGGTATGATTCGTGGAGGACCCTGTGGTTTTC
ATTGACCTCAACTTCAGTATTCGCCTGTGCAGTGTGTCTTCTGAAAAAGTCAGCAGAAAC
CGGGCTTTGTGATTGACTCACAGGCTGCAGCCCACAGGCAGTGGTCTGTTCACACCTGAA
ATGCTGTGTTCCACTTCCGGGGCCACCTTTTGGGTGACCGTGATAAGGAAGAGAGCAATA
AGACTGGAGAGGCATGTGCAAACCGTGTGGTAGGAGGAGTGATTGAAGGCACGCGGAATG
GTGGCCCAGGAGAACCTGAAGAGGAGATAGATCCTCTACCACGTCTGAGTGTAGGGTGCA
CTGGCACATGTCAGAGAACAGAAATGAAACCAGAAGAAGGTTGTCACAGGAAGTCAGATT
TTGCCTCAATACAACAACATGCTTCCTGATAAGTAATTAACATTTTATAATATTTCCAAT
GCCTCGAGACTTTAAAGGCAAAGAGTGGGTATTCCATAGTCAGTAAAATTCAGTCATTCA
GCAAATAAATACTATGTGCAAGACACCGTTCTAAGTGCTGGGGATACGCAAATGAACAAA
TGAGATAAATTCTCCCCTGCCCTCAAGAACTTAATATTCTTGTGTTAAAATAGTAAAATC
TAAACATAGGTAACATCTCCTAACATGCTTTCCGTAAGAAATGCTCAGAACGATGTATGA
TAGAATGTGGCTTCCGCTATGACGCTGTTTGAGAATGTGAGCTGGTTAACATGATTCCTT
CCCCTTGACATTTCCAGTGTGGCCTTTCAAACATACAGAGAAGAATAAAATGTCACGTGG
CTGCCCAATAAGCTTCCCAAAGGATCCCACCTGCTCAGTCGAGCCTGTTGAGATCACAAT
TGGTGCAACCAAAACTAAGATCTCAATTTGCTGAAGCCGGGTAGTAGCTATAGGAATTTC
ATGACACCATTCTCTCTACCTTTCTGCGGGTGAGGGGTGGGGGTTAGGAATTTTCCATAA
TAAAAACAATTTAATATTAAAAAATGAAATCCAACAATTGCCCTGTGTGGGCATTGGAGG
CCTCTTAAAGTCAAGGGTTCCAGTATACTCAAAGACTTAAGCAGCTCAAGTGTAAATGAA
TAACCATCCATCAGAAAGGCTCTAAAAATAATTTCTGTGCTAAACAAGAAGTTGAAATGG
ATGACCTTAGGTTCCTTTACATGCTAAGAGTATATATTCCAGTAGATAATCTAAAATATG
ATTGGAACAAACAAGCAAAGACTTGGACTAATTCCGGAGATAGCACATATAAACTGGAGT
CTGTTTCCTCTCTGCTGTTCATCAAATGGCATGAAACTGAGCACTGAGTCTCACTTTTAT
CTGAACATTTAATGATCATTTTCATAATTATTTTGATATTTATATTCTTCTTTCTTCCAA
GAATAAAAGATTGCTTAAGCTAAACTAGATGCTTACAGCTATTGTATTTTACAAATATTT
GTGATTTTTTTTTTTTTTTTGAGACAGAGTCTCATTCCGTTGCCCAGGCAAGAATGCTGT
GACATCAGCCTAACTCACAGCAACCTCAAACTCCTGAGTTCAAGTGATCCTCCTGCCTTA
GCCTCCTGAGTAGCTGGGACTACAGGAACCTGCCACAATACCCAGCTAATTTTTTTGTTT
TTGGTAGAGATGGGGTCACACTCTTGCTGTGGTCTGGAACTTCTAAGCTCAAGGGATTCT
TCCATCCCATTCTCCCAGAGTGCTGGGATTATAGGTATGAGCCACTGCACCCCGGCCATA
AATATATGTGGATTTGAGATCTATCCCTTGAATCTTAGCTGTGTGAAAAGTACCTTAAAA
AAAGAAAGAAAAAAGCAACATCCATTTTCCCAGAAAGCTGTGCATATAACCTCTTGTCTG
AAGCTAATTTAGGTGTGTTCCCAGCATGGTGCCCTAATTACACCTTTGTTATCCTTTCCC
AGTTAACTCCTCTCATCAGCCAAGCCTGCGACCTTCTCCTGGCTCATTTAAAAGGCTATG
CAGAATCTGGGGAGGCGTTTGACATCCAGAGGTAAGGGGGCTGCACTGCTTCTGAATTGC
TGCTTCTTGTAACTGTACGTAATTGCTGGACAATTACCTTGGGACTAGCAACTGTGGAAA
CGCTAGAAGCTCGTAAAAGCGTGGAGGAACTGACTAATGAGAAGAAATGAAACCCACTTC
TAATGGGAGATGGATGTGAACAAAGCCCATGCATGTGTGGCCTGTGGAGGGAAGCCGGGA
CCCTCACAGGCAAGGGCAGGACAGGCCTGGCCAGAAAGGACAGGGATTTAGGGAAAACTG
TGGTACGCCTCAGCCTAGAGCTGTGACTTAGTGGTGGATGCCAAATCTAAATCGTCTGAC
TTTTCCCCTAGAAATCCTTAGTTGTTTTAAGCCAAATCATGGCTTACAACACATCAAGAA
CATGGTGGGGATGTCAAATCAGTCAGAAGTTGAGTCCTTATCATTACTAATAAAATAATA
ACATACTCATCATCAACATTTCTATTGTACCATGTGTTTACAAAGTCTTCTTGTCCACAT
TTTCTCTGATTGTAGGATGCATGCGTTGGTTAAAGATTAGGTGGCCTTTTCACCTATAAA
AGCAAAGTAAATAGCTCTTAAAACCCTTAAATCTTCAACCATCAGGGTAGGATGCAATCG
CATGCAATAGTCTCATTCTTGTTTTTACTGTAGCAGGGAAATGTGTAATCACATTTCGAT
GAAAACAGTCAAAAATTTTTTAAAAAGTCATCTGGAAATGTCATTTCTTCCTTAATGATA
AGTCAGTGGTTATGTAACTTAAGCAGAAGGGGAATGAAGTTAGTGCCTACATCAAGGACA
AAAATAGACTCTTTAATTATAAATGGGTATTAATAACCCAGCTGTTAGCCTTTTTAAAAA
GAACTTAATCTGACTATTCCTATAAGATAACAAAAAAGAATAATTCTAGTTTAAAATGGC
CTTTGGGGGACAGGTTCCCTATAGCTTAAGAGGTTAAATTTTCTGAAGCTACTGCCAGAT
ACTTTCTCTTCTGTCTGTTTGGAAAGTGCACAGTATGTTTTCTGTAATAATATACATGTG
TTCACGAAGCCTGTCCTAAAGTTTGTCTTATATTTATTTGAGTGTGAAGAGCCCTTCTTT
TTTGTTTGTTGCTCTAAAGAAAACTGTAAAATCATTAGGAGAAAGAGGGAGATGAAGTTA
ATGAAACCAGATGATGAGCTTGTTAATTTATCAATGACAATTTCATCTATATCAATTCAT
CATTAGATTCTGGCCTGAGATGGGCTGGGCAGAGTCTTGGGGTGAAGCTGTGGGCTGTGG
GCCACCTATTTGCCCTCCTGCACAGGGAGGAAAATGTGAAATGTCCTCTCTCAGTATTTG
GCTGTGTTCTGGTTGATTGCAGCTGCCTGAAGTTCTGGTTGAGTAAGCCTTGCCTCCCCC
TCTGCTGCCCTGGTCTTTGTTTAGATAAGCTGGCTGCTGGGCCTTCATCTCCTCCCATAG
TCCTCTCCGAGGGCCTCAGCCCAGTAGCCCCTCTCCCTCCGCCTCGCTGTAGATCCTCAG
GAAGCTCCTCACCAGCCCTTCTGCAGGGCTGGGAGTCCTATTTAGACACTGAAGGCAGGC
TTCCTCAGGAGAAAGGATTTGGGGACAAGCTTGCACCAGAGTGCTGTCTAATCCCAGTGT
CCCCATCTCCCACAGGTGCTACTGCTGTTACACCACAGACGTGGTTGCCAGCGGTTCCTT
TGGCACCCAGGTGGACTCCTGGAGGGCTCCTGAGGACCCCTTTGTGGAACACTGCAGACG
TTTCTTCCAGTTCAGCATCCCTAAACCTCTCCTGGTTTTAATCTGTAAGTACAGCCCCAA
CCAAGGGCGAACCAGGGGCAGCTCTCTGGGTTCTGCCACTGACACTAGGAAAGGGCACCT
TAGATGCCCTCTAGTCACCAACCTAAGACCACTTATTACCAGTGCAGGATCCCTGTCCTT
GCCAAACACCCCACCTCAGTGAGAATGACCCCGACATGAGGTGCTAAGCTCTCCATGTTT
ATCACTTCACTTAGTCCTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGTAGAAGTGAGTTTTTGCCCTCTGGCCAATGCTAGTATATCTTCTTGCTTTTATGAG
TGCATTGAAGTGTTGTTGTTATTCATTATTGCCATGATTTCTAACCATTCTGCTGGGCTG
GTAAAATTCTATCCATTCCTTGATCAGGTCATTCCCATTTCTGAGCCAATTTCAGAGGGA
GGTTCTGTCATCCCTATTAGCTCTGCCCTGAAGTTGCAGGTCGAGTCACTGTGCGGAGTT
TGGGCAGTCTCTCCCTTTGCTTCTCACTGCACCCCACCCCAACCCCCTACTGAACCCTCC
TCCCTGCTGTGTTATATTGGTTCAGGCCCCTGATTTGGAAAAGGAGCTGTGCATTCTGAG
AGCCTGTGTGTGCACTCAGCTTGCAGCCCAGAACCTCTACCCAGAGCAGCCCCACCAGGG
CACCTGGCAGGTAGAGCCCGAGCTGCAGGCAGCCTCCACAGGAGGTACCCACAGAGGCCG
GCACGCTCAGCAGCAGCCACAGCGGCAGCAACAGCTCTTACGAACAATTCAGGGGTCGCT
CTGGGGATCATCATCCAGAGGAAAAACATGCAAATAACCAGAAAGTTTAAAAAGTAAATC
CACTTCTCCCACTTGCTAAGACTTGAAACAGCCTGTAATCTGTTCTCCCTTGATGGAATT
CAAAGACCTTGGGTCCTCCTATCTAGGACCTGAAGTATGAAGTTGACCTCTGGAGAGCCA
GATGGAAGTGAGGACTCAATTTAATTGTCCAGATGTTTACTGAGTACTTACTATGTGCAA
GGAATGGTGAGGAGCACAGAGATGGAAGAAGATCCTGCAGCTGTTTTTAGGAGTCACGGC
AGTGGGGTGGGAGGTTGGGAGGGAGGCATGCTCTAAAATGCCTCCAATCCAAGGCCCATG
TGCTTCCCCGTAATAAGTGTCTAATGGTCCTGGTTTATTACCTCCTCCTTCTCAATGCCA
CTTTTGTTTTTCTCTTTCAAGTATCATTTCCATCCATAATGGTCCCACTGGCCCGGATTC
TGCCCAATAAGAACCGAGATGAACTGAATGGCTTTTTTAACAAACTCATTAGGAATGTGA
TTCCTTGCGGGGCCCAGCAAGCCGCGGAAGAGGTAACGTATTTTAATAGGACACCGCCTT
GATATGGAATGGAACCTAATTTGGCATCACTATCTCTTTACTCTCTCTCCTCCCCCAGTG
CCGCATGGCACACCACTGTCCTTTGGCAATCTACCACTGAGTCGAGCTTCCCAGGGGCAG
GAGAAAGGACAGAGAAGGGCGGAGGATGGTCACACAAGAAAGAGCAGGTGGGCTGGCAGC
AAGGTGAGGCCCAGAGCAACTTGTCCATCCTCTGACTTGGGCGCGTAGAATGAAAGCCAT
CCCCAAACTCTTTTTAGTTTAAGCATCGCCTCAAGAACAAGTTACAACAGCCCAAAAGAA
TTTTCTAGATAAATGTGCCCATATGCAATTTTCATGAGCATTTTTTTTATATCAGGCCAT
CCTCAGATGGAATTTATCGTGTGCACTGCATAAATANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATGAAGGGTAATTTCCATCCTGGATATGCCTGTGCCCGT
GTAAGTGCTATCCTCTCAGGGCCGGGTTGCCTGGAAGAAAGTTACTTACAAGGAAAAACA
GGGCTAAAATGGCTGTGCCTTAACTGATTTGTGCAAGGTGCAACTTTAAAAAGGGTTTCT
CAACAGGGTAGCGCAGAAGAGTTCTGAGGTCCAAAGGCTAAGGCCTTGGCCTGGAATGAC
ACTGAGGTCAGTTGGCAGCTCAATGCACTGAGAAGCCTGAGGCAGAAGTTTGTCCTCCCC
TGCTTCACATCCTGGGTGCTGGGCAGCAAACATGCCTGCATCCAGAAAGCACAGGAAGGT
ATAGGCAGGCTCACGGCCCCTTGGTTCACACCACGTGAACTCCATCTGAATGCCCTTGGA
GGTGTCAGCTAACTGGCATCCTTGGCGGGGCTCTGAGGCCTGAAAGGACAGGACAGATAT
TCTTACCTGGGTTCATACTTCTCAGCAGAGTGAGGATGGAGCCCGGGGGAGGAAGAATGA
AGAAAGAACCATTTTCAAACCTCAACATTACTACGAAGGGCTGTCCTTTGAGAGCTGTGT
CACATACAACACACAGACACACATACACACACTCACACACACAGCCTCCAGCCCGACTGT
GGAATCAGGCTGAAGATTTTAAAACTGTTGCCCTGAATGACTTACTAAGAGGTGAGAGGT
TATTAAAGATCCAATTACTGGGATTGCCTAGAGCTTTTCCTTTTATAAACTCTAGTGCTA
TTTGTTTCAAACAATGAGTTGATCTGAGAAAAACCTCCCAACCACAAATCCAGGACCGCC
CGTGTCAAGACAGAGCTATACGGTTACTAAGAAAACTTGCTTTCAAACCGTCTGAACTCT
GTATACATTCCATCAAGCAGATGTGTGTTTGCGCAGTGAAAATGCGGCACAGATGTTAAA
AGGTAAATATTTTTCTAAGCCCTAGCCAGTGGGTGGATTAGACACCTACATCTATCAGGG
TGCGTATTTTGCTTGGGTATAACCATAAACCAGTGCTGTTTCAATCCTAAATGAGCAGTG
TTCATTTAGCCTTCAAGACACACTGGGAATAAAAGAAACCCGTCTATACTAATGTTCCTC
TCCAACGTGCAGGCCCTAGAGAGCGGCCTTTTCCTCTGGCCTCCTACAGAGGTCAAGACA
GATTTCTACAAGACTCCAGCAGCTTGTCTGAGCCGGGATAAGAGGACAGAATGCCAGCTG
CAGTTCTGCCCCAGAAAAATACACACTGTGGATGCGGCTGTGCCCTCTTCCCATCATTTC
CCCTCCCCTACCCCCACAAAGCATAGCCAGGCCTCAGGGACCACACCGTATGACAGCTCC
AGATGGATGGGCTGAGAGGTCTGGGGTGTTCTGGGATTTCAGGAGCTGAGGGAGCAGAGT
GCCCCCAAGTGGCATCTTGTCCTGCCCCAGCTCTGCCCCCAGGGAGCAGACCCAGATGCT
GACCAAGCAGCAGGAGGGAAGCTGAGGAAAGCCAACTTTGCTATTTGGAATTCAGAGTGA
GCAAGGCCAGGGTGGAATGAGGAACCGTCCATCCCCAACCCTTTGCCATTTCCTCAGCTG
TTACAGCACAAACAGGCTGGTAGAAAGCTGAGGTTTTGCCTCCTTAGCCTCAAGGTTCAT
GACACTCACCATATTGACCTCAGCAGGCCCCTTGCAAGGTCACAAAGCTGGGAAGCAGTG
GAGCTGCAAAGGTCTCACGACCGAAGGCCCCTGCTCTAAATAGCACGCAGCTGTAGTCAC
ACCCAGCACATCCGTCCTTAAAATGCATCTGTTGCATTGTTTTTTTATCGGTGAAATTAT
GGACTGCATTCCTAACATGTGCTCAGTGCGATACTAGGCACAGTGGTTGGGGTGAGGGTA
GGGTCCTGACCTGGAAATGCTTCAAATATTATGGAGGAGAAAAAGAAACCACATACGAAA
TGACAACAGTCTTAAAAGTTGGAAGTAGATACTAATGTGTGTGGCATAGATTATTAAGGC
AAAGGAAATTCAGAAGCCAATATGTTGAGAAAATGCTATAACTCATAAAGTACTTCAAAA
TTATAATATTTTTCTGTTGGTGGATCTGATACTCTCCTTTCGCCATTTTAGTCCCATAAA
CTTCAGAAAAAAGCAACATATCAGTTGTCATTCATCACGTTACAGAGCATTTCAAAGAAG
GGACGTGCCAGGAACAGACTTTGTTAGCACTAACGCAATATAGAAATGCTTCTATTGTTA
CAATTAGTGGTGGTAGAAATATAAAGAATATGCAAACTACTGATAAAAAGGTAGGGGAAA
TGGTAAGGAAGCTCTAACCACTTAAATGGGGTAGGGCAACAGTCCCCAGCCTTTTCAGCA
CCTGGGACTGGTTTCATGGAAGACAATTTTTCCATGAAGACCAGGAAGAGGGAGGAATGG
GTTTGATATAAGTCTTCAAGCAGTTGATTTATTATGGTCCCTGTGCAGTCACACCTCTCT
GCTAATAATAATCTGAACTTATAGTTGGTCCCCAGTGCTAGCATCACCACCTCAGCTCCA
CCTCAGATCTTCAAGCATTAGATTCTTCTAAGGAGCACAAAACTTAGCTCCCTCTCATGC
ATAGGGTTCTCCCTCCTATAAGAATCTAGTGCCACTGCTGATGTGACAGGAGGCGGAGCT
CAGGCCATGATGTGAGCAGTGGGGAGCGGCTATAAATACAGATGAAGCTTTGCTCACTTG
CTTACCACTCACCTCTTGCTGTGCAGCTGGTTCCTAACTGGCCATGGACTGGTACATGTC
TGCGATCTGTGGGGTTAGGGACTGCAGGGGTAAGGGATTATGGAGGGAACAAAAAGGAAC
CAAGACAAAGAGACTAGGCTCCAGGACACAGAAGGCACCATCCACAGGCTTTGAAGACAA
GCTCCAGCAAATCCAGTTTCCTCCCCACACCCCAGTTCTGTTAACTTGCTACCATGGGAG
GAACACATCCAGCTGCCCCTATCAGTCTAAAGTATGTGTAAGGGAACAGTGGAAATCATG
CTTTGATATTTTGCTGATGGAAATCCAACCAACCAACCAGCAGCACAAACCTGTATAAAG
GAAAGATTGAAAGCTCCTGCCCCTGTTTTCTCTCTTCCTCCAGCTCCAGGAACTGTTGGG
TAGGGAGGTTGCAGAGTATTTCCTATGCATAGATGGGCATGCACTTTCATAGATGCATGG
TACATTCACTGTTTGGACAGAAGTGACAGCCACTGTGCCTGCGTAGTATCGCAAAAGCAC
TCTCCAGCTCAGGGATTAAAATTTCCAACAGCAGATAGACGCTGTCTTCTTCCAGCAGCA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGATGCCCGAAATTCTTCCGAGCCCTGTGGGTGTGGAGGACTTTGACATCGTCCGA
GAAGTCTTCTCCTCTACCAAATGCCAGGTGGATCCCTCCCGACAGCACCCACCCAGGGCC
CTGTCCCAGCCTTTGAGTGTAGATGAGGTTGTGGCCAGGCCTTCATATTCCTCATTGCTG
GCTATGAGATTGTCACCAACACGCTCTCTTTTGCCACCTACCTGCTGGCTACCAACCCTG
ACTGCCAGGAGAAGCTCTTGAGAGAAGTGGACCTTTTCCAGGAGAAACATGTGAGTACAA
AGTTGGTCCCAGCTGCCCAGCTTGCCCTTGCCACAGGGCAATTGATTCTGTGTTGGCAGA
AGTGAAATTTATTTTAATAGCTTGCTAAAGTCACATCCTAAGTTTCTAAGATCAAATAGG
AACATTTCCCAGTTTTTCCATCTCTCTGGGTTAGCAAGTAAAATGAAGTGATGAGAACAA
CAGAAGGAAAAAGAAAGACAAATTGTGTGTGTACCTTCACTGTCTGGGCCAGTCCGTGAT
GCCAGGCCTGGCTGGTGGGTGGCTGCAAAGACTCAGGATGGAGTCAGGTGGAAGGTCAGG
GGCTGGGCCCGAGGCGGGCCTTCCCAGTGCTCTGTAAGAGCTGCCATGCATGGAGGGAGG
CACAGGTGAGCCCAGAAATGGAGCCGACTGGAAGGCAGGGGCGGACACAACATGGGCCAA
CCTGAAGCAGGAACAAAGATGGGGGTTGCTGACAGGGAGGGCTACAAATGTGGGAAGATG
AAATAGGGCCGGTCAGCTGCACCAAGCCTGGATTCTGAGTGTTCCGTCTAAACGAGGCCC
CTCTGGGTGGACTTGCTGCAGACCTAACAAGGAGGCTGGGCTAAGCTACTTTCTCTCCTG
GTTTTCTCTCTAGATGCCCATGTGCGTACCACTTTGCCTTATGAGTGGTTAAAGAGATTT
ATTTTAAAAATCTGTGCTTTAAAAGGAAGACCACCATAAAAGATAATGTTCCTATTACAT
TCTGATAAAATTGCTATTAGAGTCACAATTTTGGAAGGTGGCTTATTCTGTTATTGGAGC
CATTACAAATTTTTTTTCATATAATGAGGGAAAATCACTTCCCAGAAAATTCCACTTCTG
TATCCTACTGGGGAAGTAGAGGCAAGGTTAGTCTTCTCTTCAGCAGTTTGTTAAATTTTT
AGAAACATTTACTGTGTTACTTATTTCCTCAACTTTGGACTCAATGCAAGCTTATGGTCA
ACTTCAAGTTCTGTGTGATTGCGACAACTGCCAGGCTGGGGCTCCCCAGTCCACTGCTTA
TATGATTGATTTTTTTGAGCAAGAGTTTATATTTATCTTTATTACTGTTTAAGTCAGTCA
AAATAATTTTGAATCTTGATTCTGCCATCTGTTATATTAGCAATTCCTCCAGCTTTGTGT
CATCGGAGACTTACTAAGCATGTCTCCTATTTTATCCAAGTCATTGATTAAAATGTTGAA
CAGGATAGAGCTTCCCTTAAGATTGACATTGATCCATTAATCAATATTCTTTGGGCATGG
AATCTCAACCAGCCATGAATCCAAATCACCCTTCTACACATCTTATTGTGTTTGATCTAT
ACTTGTTTATTTATTTGTTTTTAAATTGAGGAGAGGAGAAGGGGAGTGAGCAAAGATGGT
GGGGTATCGCTTCACTGCAAGAGAGGGAAGGGGAGCTGGTAGTTACATCTCTTAGGACAC
ACTGAGTTACAGGTAACAAAACCCCAGCTCAAACTGATAGAAGCTGAAACAAAAGAAAAA
ACAAAGGAAAAACTCTTAAATTCATATTTATATGAGTACACCTAATTGAGCCTCTCAGGC
AAAACTTTATCAAGGCCTCAAAGTTGTGCAGAGGTCCCAGTCTCTCTCTTCCCCAGTTCT
TGGCTATGTTTTTTTATAGTGACCCCTTTCTCAGTAACGCTGTCCCCTTGAAGTTCCAGT
AACCTGCCAAGGGTGTCCAGGACTACTTACTTCCATGCTCATAAGAGGGACAAGGGAGGG
TCTGTGGCCTACAACTCTCAGCAAGTCATGAGAGCCACTCGAACCAGAATGCAGAGGTCA
CTGTCCATTCTTGAACCAGCTACTGTGGCCAGGGAAGTGGGGACACTGATGAGCTTACAT
CAATCAGACCCCAGTCTGAAGGTCAATCAAACTCAAGTCATGTGATCAAGAACTTGGGAG
GGTGATTTTCAAAGGACGATTAGGATGTTGTCCTAGGAGGACATTAGAAGGAAATCTGGT
TCCCTGGCCTGAAATAAACAAGAAGGCAGGTCAAATAAAGGAGCTGGAAGTTGTAATGAG
TGCCAGGCTCTAACAGGCAGAAGTCAAGAGCCTTGCTTCAGGGAATTTAATCGCCAACGG
AGAAACAATAAGTTATGGCCATGAAACAGTATCTCCCTGCCAAACAAACCCTCCAGGGAA
ATAGAAGACAGTAAATTATTGAGTCTAAAATGTGTGGTGTCGTTTAGAGAGCTGCCAGGC
TTTGGAAGTCTGTCCCACCAGCTACAACCCATAGTTATATCTGGTTATATTAACCTACCT
GGAGGACACAGTGTGTCCATCTGAAGGCCCTCAGGCACAAACCCCTTCCCTCTGGCAAGG
CTGTAACTGGCCGTGACCTCAAAGAGGGCGATGGTGTCCCACAAACTCTGGCCACCTTTA
ATCCCTCCAGCCTGCAAATAGGGCTTCTTCCTCCTTCCTATGGGGGAATGTCACCAGGCA
CTGAGGCCTCATGGGCAAAAAAAGAGATTGTAGCAGGAAAAGTTTTTCAAACTTTAGTAT
ATACCGAACAATCTGGAAAGAGAATACATATTCTAAACAATATAGAATTTCAGGGCCCTG
CCCTCAGGAATTATAATTCCTCAAAGCTGATCCCAGGGCTGGAGCCCAGGAGCAAGAATT
TTTAGTAAACATTCCCAGAGATTCTGGTGCAGGTGGTCCCTGGATCCATTTTGAGAAGAC
AGCCTTTGACTCTCAGGCCCACAATCTTCTTCTAAGAAAACACAAGGTCTAAAGCCCCAT
CCCAGCCATTAAGCCCCGTTACCTTCTTTCTCTAGGTAATAGTTGGGACAGCTTCTGAGA
AATGGGAATAAATAGAGGTTGTCTCTTTAAAAAAATTAATTTGGCTACCGCCAGTCAACC
CACCATGCTCCTTTCCTTGTGGGGGCTGGGTACACAGTGGCTGCAAAGAGCAACCCCCGC
AGCGTACGCAGCGCGTGTGCTTGTATGGGTCGCTCTAAGGGACCTTGGGGTCAGATTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGTGGTCCCAAGATTAAAAGCTGCTA
CTTTCCAGTTCCTTGTTATGTGATCACCCTCACCTTCCCTCTGAGCTTTTAAAACCCGGA
TTTCCAAAACCAAAGATCTACATCTGACAGTGCCTAGAGCAGCCTGCACTTCTTGTAAAT
GATGTGGCCATTATATGCCAAGTGGTCAGCAGGTCCTTATTGCAGCCTCTACCACTCAAA
GAGTATAAACGTCAGGCCGGAAGGTCAACAACAAAGATACTCTTCCTGTAACGGAAGGAA
ACTTCTGTCACATCCAAGAATACTGTGCCATGCTCTGTACACGTTTGGCAGCCCACATGT
TCTGCCCAGCAATAGCCCATCTCCTGCCACCTGTTGTGACCCAAGTGATCTTGACTGTTC
TTTCAGTCTCTAAAACAGTTACAATGCCCTTTATAATTCATGTCTCCAGGCTGCTGCTTT
CTCAGCCACATGACTTTTCTTCTAAATCACCTGGCTTGGGAATTTCGTCTAGCCCTCCCT
CCCTTAAAATCTTCTTTCTCCTGTCTCCCAGTCTCTTAGAGAACTCCCTTGTTTCTCCAT
GTTGCCTTTGTCATATTGAAGAGGAGGTATGTTCATTAAATTCAATAGTGAAGGAGCAGG
AAGGGTCGGTACCATTTGCAACACTGATAAAATTGAGAAAACACACCAATTATTTAATAA
GGCCTTTGTCATGTGGTTGCTTCATTGCGTTCTCCAATATACAATTTGAAAAGGATGAAA
AAGGGGAAAAAAAACCCTTGTTTTCATATAAATTGCTTTTGTTATAGCTTTAGCACTTTA
TGTTGAAATTATTGACTTTTGATCTGGCTGACCAGTCTCTTCTCTTCCCTTTGGTTCCAG
ACTGTGCCCAGCAAAAATTTATGACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTTCTACTAGTGGCATTTCCT
AGTAGTTTTTTTTTTACAATTTAAAGCATCTGAGAAATTTATTTGTCTTGCCTAATTGTC
CACAGCCCCCGCCCTCTGAGGGTCACTGGTGCAACCTCTGCAGAGGACAGTCACTGTCCT
CCCTCTCCTGGTGCGCTGTCAGCACAGGCTTGACGCCCACCCTAGGCAGCTATTTTCATT
TCAATTGAGAAAAGTCCTTGGGAAATGGGTGTCCTGAGGCTGGGAATGTGCTCCCTGCCT
CCCACCCAGGAGACAAACTTCAGACAACCTGAGACAGTATCAAGTAACAATATCAAATTC
CTTTATCTATCCTTTCCTGCCCAAGACCCAGTCTCATCATAGGCCCACATGCAAATCAAG
GCCCAAGAGCAGCCCGGGGTATTTCCATGTCCGCAGGAACTGCTACAAAGTTTTCATAGA
TGCTTGGGAACCACACCTGGAGATTTTGATTTAGTCTGGAGAGAGGCCTGGGCTTCCTAA
AAGCCCCCATGGGAGTCTAAGATATGGTCAGGGTGAAGAAATGGCCATAGGCCCGTGAGG
TGTAGATGCAAACCTACTTAGTGACCTTGGGTTGCATTGTCAATGGCAGGACTGACTTCA
TGAGTATTCTGCATAATTATTGGAGCCACTGTTTGCTTTTGAGAAAGTCAGATTCTCAGG
AAGTAGTGGGGTGTATGTGACCATTCGGTGGTCAGATCCAGCACATCCAGAGAACAAAAA
ACAATAAACAGGAACAAATCCCTGGCAAGCTCCACGAGATGATTGCTCTAGTGACACTGA
GCATATATGAAAGCACCTCACAGAATTATACTAAACCCAAACCCAAGAGGTCGTCTGGTC
TGTACCCCAACTCTAGGAGTGTGAGGGGCCATTTTTGCCTCTTACACACAAGACAACCGA
AACCTAGGGGGTTCCATTGCAGACCCATGCTTTACCTCGGAATTAGGAGAAAGGGTTTCT
GGCTGTGGGGATGGAGCTGGAGAGTCTCTCTCTTTCTTTTTCTCTCTCTCTCCTTTCACC
TTCCTCTGAAAATCTCATTTGATGATTCCCTAGCCTGGCTGCAAATTAGAAATTTGTAGA
CCTGAAAGCTGCTAATGATGGTTACCACCACTACTACCATCATAGCAGTAAACATTTATG
GAGCACTATAATTATTCATAATCATTTTTATGTGTTAAATAAATCTGACCCCACTCCATA
AAGAAATAGGCCCTGCTGACCGAGAGTATTGGGTAAATTGAAAGTCTCCTAGAGTTTTCT
AATGGCAATATCCCACATTCCATAACACTTGTGTCATTCAGGGTTTGTTTCTGGGCTTGA
TTCACCGAGGGCCACTTGCACGATTTCAGGGAGTGTCATCCATCTTCTCAGTGCTCATGC
TGTGGCCTTGGCCGAGTGTAATTCCCTGGTGTCTGTGCTGTCAGTGTTAAGGTCTGCTAT
AGGAACGCCTTGGTTCCAGCTTGCTTTCATCAAGCAGTGATCCTTTGGGATCACGTATTC
AGCATCAAGTGATATTGATAATAATTATGATAGAAACGATAAGAATTACCATTCATTGAA
CGTTTACATGCTCTGTGCTTGGTTCTCAGCCAGGCAAATTTAATAACCAATGCTATTATT
TTCCCCCATTTTAAAGATTAAAATGAAATTGAAACTCAGAGAGTAAGTGACTAGCTCAAA
GTAGACAGACTGTATTTGAATCCAGGCTCCAAAGTCCCTTGGTGTTATCTCAGGAATGAC
CGCTGGGTCTGTGGGAGAAACTTCTATGAGAACAAAGGGGAATGGCACACATTTCCATAC
ACGGTGACTTCTGTTTTGTCACCACTGTGGTTAGCCAGATCTCTGTCAGGATGTTGGGAA
AGTCTCCAAAGTCATTTTTCCCTCTCCCCAGGGGTCCTCTTCCCTGTCTGCCACCACTAA
ATCCCTAAGGACATTAGAATAAATGGCATTTTTTACTTGTGTCCTTGGCTTATAGCAACT
GAGAAATCCTAGGAATTCAGATTGTCCATATTTACCATTAAAAAAAAACCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTAAAATAAAATTCTATCAATATTTCCATGTAACACTGGGTCTTT
TTCTATGTAAAATCCACCCTATCAGGTAGTTCTTTATTCATTCTGTCCCTTGGGTTTCAG
ACAGACAGCTTCTTCCCCTCGGGAATAATTCATGTGTCAAACCTGTCAATTTTCGCCGTA
TCTAGTAGCATTTTTCTCCCCGTCCCTTAAATTTTAGCTTAAAGCCCACTTAATAAGGCC
TGTGGGTGTCCTTCTCAAGCTCATGAGATTTCTAGTGATATAGACCGTAATTTAGCAAAA
CAAATCGTGCCTATTGCTGGCATCTAAACAGGATCCTGGTAAATTTCCATATTTGCTTTT
CTTCTCTAAAGGTATGACCTTCAACTGAAAGAAACATCACCAGGCCTCCTAGTGTTATTT
CCTGTGTACAATTTCAAAGCCTTTGGAGGTGCAAGGCAGGTTTTCCTTCATGTGAACCCA
CTGAAATGGGAGTGGTCCTTGGGTCAATCTGTCCCTGCTGCCCGTCTCAGGTGCACACTT
CCAGAAGCCAGCACCTCGCTGCTATCCAACCTGGTCATCAGTGGCCTCTCGCTCCTTGGC
TGGGAGAACGAATGACCAAGGAAAACACAGTTTTTTCCTGCTTGGAACTTACCTTTCTTA
GTCATTTTCAGAGAGCTGGAAGCCAGCCACCTGAGAAGGACCTTCCTATCCTGTCCCCCC
ATCCTTCTCAGAGGTGGGATGACTCACTTCTGCATGTTGGCCCAGGCAAGCCCAGCTGTT
GGCACCCCGAGCGGCATCCTCTTTCTCATCAATTCATGTAGCGGGTGCTCAGTGTTAGTT
GAATGAATGAAATTTAAAGTTGAAATAAACTGAGAGATCTGTTGTTAATCTAATCCCTTT
ATTTTGTACCTGAGAAAGCTGGAGCAAAGGATATGACCCAGATGACATTGTGTTTTGGTG
AGTTTCCTGACTCCCAGACCCATGCTTGTTGTTCCGTGTGTCTTAAGAACCTGTCATCCT
CTCTAACTGTGCCCTTTCTCCTACACCCCCATTTTTTGGAGCAGGGAGAGTCTGCATTTG
CCGTGAGCAAGCAAGCCCAGGGCCACGCTGACACACCAGCTGGACACCTTCCTCAGTGTC
TCTATTTCTGTTTTAGATGAGCGAAATTATTTGTAATTTCTGTAAACAGCCTGTTTTCTA
AGCCTGGCCTGGCATTCTCCAAAGGGTCCTGAAGACCCTGTGGCTTCCTGTCCTCCACTG
AGGTTCACTGTCTGCACCAATCTGGGGGGTGACACCAGCCCTGAGCAAGATTACCCTCCT
CCCACCATTTTAGCACAGACATGGACATGTCTTCCACAAGCAGTGTTCCCCAACTATTTT
TTTTTTTACTAAATCATAGCTGTGTATATTAATGCAATCATGGGGTACAATGTGCTAGTT
TTATATACAATTTGAAATGTTTTCATCAAACTGGTTAACATAGCCTTCACAGCAACCACA
ACTTTTTTATTTTTTTATTTTTTTATTTTATTAAATGATAACTATGTACATTAATCCAAT
TCTGGGGTACAGTGTGGTGTTTTCATATACGATTTGAAATATTTTCATCAAACTGGTTAA
CATAGCCTTCATGTCATTTTCTTCATTGTTGTACTAAGACAATCATATTCTACTCTTAGA
AAGATTCACTTGTACCCTTGTAAGATAAACCATAGAAATGATACCTCCAATCACCCTCCC
TCCACCCATTCCCCCCCCTCCATTTTCCCTTCCCCCTCCCCACAACTTTTTTTTTAGTTA
TAAAAACTAAAATAAAAATACTGATAGGGCGGCGCCTGTAGCTCAGTGGGTAGGGCGCCA
GCCCCATATACCGAGGGTGGTGGATTCGAACCCGAACCAAGTCAAATTGGAAACAAAAAA
GTAGCCAGGTGTTGTGGCAGGTGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGCAAGAG
AATCACCTAAGCCCAGGAGTTGCTGTGAGCCATGAGGCCACCGCACTCTACTGAGGGCGA
TACGGTAAGACTCTGTCTCTTAAAAAAAAAAAAAAGCAAAAAAGTGATGGTGTATGAGGA
GCCTTTAAGAGGATGACAGTCATCAGTAATGAAACTAAGCCAATCAATGTAAAGATAGGC
TGATGGAGCACAGCTATTAGTGTCCTGAATATTACATTAGCTGACCAGTGGACATTCACT
GTGCTGTAGAAAGGGTAAAACTCAAATGGCTTCTTTTCCTTTGTGTGTAGTCACCAAAAC
CCGGGACCGCACAGAGATTCAGATCGTATTATTTGCCTGTTGCTTGCCCCGGACAGCCCA
CCTTCATATTGCACAGCAGGGTAGGAGACAGCCCACCCCTAGCTGAAAGGCAGGGATGCT
CTCGCCTGTTCCTTCAGCACTAAGCTGTGTTTCTTCTGAAAGGCCTTAAAATGGAGAGAA
AGCAACCACTGGCCACTCACTGCGATTGTTCTTGAGGATTCCAAACAGACCATAAGTAAT
TCAATGAGTCACTCACAAGGAACTGGCCCTGTGAGTGTGTGGCTGTAGCATTCAGGCAAA
CCAGCGGCAATCAGTGCCACCAAAATGCCTAGTGAACTCTTATCAGGAGATGTCTTTTTT
TTTCTAAATGCCATATATACCATTTTTATTGGGGAATGATGACAGATAGTGAATAACTTA
ACATAAATTTACATAACACAATAAGGCTGTTAATTTATGATCATATTAAAATATGAAGTT
TTGTACTTTGAAGCATTAAAAAGTCTTAATCTTCTGAAACTTTCCCTCCTGTTTGCCAGA
TAAAATACAGGTGTCTGGTTAAATTTAAATTTCAGAGAAACAGTAACTAACTTGGGGGTA
TATCTTTGCAATATTTGGGACATACTTATACTAAAAAATTAGTCATTGTATATCTGAAAT
TCTCATTAGCCCATGTTTATATTTTGGTTGGACAAATCAGACAACTCTATACTTCACTTC
ATAAATAGCTTAACCCCTCCTGGTTCTGCTCTGGCAGGGCAGAGGGGGCTTCTCTCCTAG
GGAATGGTACCAAGTAGTGCAGCGGTTCTCAACCTGTGGGTCGCGACCCCTTTGGGGGTC
GAACGACCCTTTCACAGGGGTCGCCTAAATATATCCTGCATGTCAGGTATTTACATTACG
ATTCATAACAGTAGCAAAATTACAGTTATGAAATAGCAATGAAAATAATTTTACAGTTGG
GGTTACCACAACACGAGGAACTGTAGCAAAGGGTCACGGCATTAGGAAGATTGAGAACCA
CTGGACTAGTGGGACGTTAGCATCTTTATGCTTTCAGGGAGGTTGGCTTTCCCAGGGACA
CTAACAGAGTGAAAGGGACCAGATTGTGAAGGAGAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCATGTGCAGCTGCTCTCTTTCCTGTTCAGCCTATTTCGTGTCT
TTAAATGCTGCTCTTAACCCCCTAAATTGAATCCATTCCCCCTAAGGCATCACAGCCCAC
ATGTTGAAAAGCACTGGGTTAGAAGGTTATAGTTTAGGAAAGGGAAGGAGGAGTTTTTCT
TTTTTAATCCACTTTATAAATGAGGAAACATAGCAGGTTTCTTAGGAGCCTTTCTGGGTC
CCTTTTTACTCATTTATGAGCAAAGCAGGAATAAAACTGAGGTCCCCCCAACTCCCAAGG
TGGTGTTTTTGGTTTCATTCCTCCACTCTTTCTGGTATCCGTCTTCCTGGTCTCCAAGTT
ATAAAACACATTCTGGGACCCACATTTATTTGTTTTATTTTATATAATTGTATTACTTGT
ATACTTATCGCTTCAAATTCGTCTCAAATTTCCAAGCTCTATATCATATCTGATCTGAAT
AGATGATATCCTTGCTTATGGCATCCACTTGACCTGTATCAGTGTTTAAACTAATTCATC
TTGGTCTGCACCCTTTGACCTTCAGCAACTTACTGCATGCCTCATCCCACCCGTAACCTC
GTCTTACTATTTTGGCGCCTCAGGAGATCATGGTAATGAATATTCCACATGTGCTCAGTC
AGGGACATAAGAGAAACACAGTAGTACAACTACGACTTGGTAGCACTTGTTCTCCCTAGT
CTATGAAGCAGCTAGGGTATCTATTGTAAATATTACCTTGAGAGTTAAGGAAACAGAGGC
TCAGAGAGGTTAAGTGCTTTTCTCAGGGTCACACAGCAAATACAGAACTCGAGTCTTCCC
ACTCTATCTCTTATATCTGTCATCAGGACAAGGGGCTGCTGAGCCGAGACAAGTAAACTG
GCCAGAGAAAACACTAACCCAAGAGATCTCTCTGTGTGGTGTGTATTTTTCTCAAATAAT
TAGTCTAGAGTTTCAAGCCACATACAGAACTTTCTGGAATCTTATCATTGTTTGATTTAC
TATCCTCTGAATCCTTGCCATAGGCCATTCATTCTGCACACATTTTTTTTTCCAGTTGTA
ATAGAAAAGTTCCAAAACTGTGCCCTGAGCCCCTTGTTCACACTTCCACAGCTCATCCGG
GCTTACAGAATCCTTATTCAGGGGTTCCTCTTAATATTTTTATTAATTCAGTAGTCAGTC
AATTTACACAGAGAAGTGGGCTTGGTGCTCTCCTTCCATGTGGGGCATGCATGTTTCTGT
TAGTCCTTCCTGGGATCAGCAGCTTCTTCTACCTAAGCTGTTAGTGGAAGAAATGGTCCT
TTCTGTCCCCCTGGGGACTGTGACCCAGGAGCTGGCAACCCACTCCTTGGGGAGGGCTGG
GCAACCATGCTCAGAGCAAGGATCACACCTGGCATCTGCAGGTGCCCCAGCCCTCAGCAA
CTGCATCTCCCCCACTTGGGCAGAGGCAGGCTGATGGCCAGGAGACAGACTTTGGGGCCC
AGCCGCCTACCTCAGAGCCAGGCTGGCTCCTTCCCCAGCAGGTGTCCATGGGCCCCTATG
AGGATCCTCCCTAGGTCAAAGTTTCTGCATGTTAGTTAAGGGCTGATTAAACAGAAAAAC
ATATAAAGTAGTCAGTACAGGCTCGGCGCCTGTGGCTCAAGTGGCTAAGGCACCAGCCAC
ATACACCTAAGGTGGCGGGTTCGAATCCAGCCCAGACCCGCCAAACAACGATGACGGCTG
CAACCAAAAAATAGCTGGGCATTGTGGCGGGCGCCTGTGGTCCCAGGTACTTGGAAGGCG
GAGGCAGGAGACTCGCTTGAGCCCAGGAGAGTTGGAGGTTGCTGTGAGCTGTGAAGCTGC
AGCACTCTACCCAGGGGTACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAGTAGTCAGTAC
ACAGCCTGGCACCTATCTATTCTTTTCTGTTTGTTATTATTGTTTCAGATCTTACAAATC
TTCCCATTATTCCCATTTACAGAGCCATCTCAGAAACTTTAGCCATGCTTTTCTCCCACA
TGGCTCACCATGTCCTAACAGGGTGCCTCTGCTCCCCAGGGGCTCAGCATGTGCTCTGCC
CCCCACCTCCCCTCCCTGGCCCCCATCGGCCAGGGCCCCTTCCCTGCCATTCCTAGTTGC
TCCCTCCTTTTGAGCCCAGAAGTTTTACTACCTTTCTGCCCCCTAACCAAACTCACATTT
TTGGGTTTTGGGGGGTTTTGCCTTAAAATAACAGAGATTTATTATCTTATGGTCTTAGAG
GTCAGAAGTCAAAAATGAGTGGACAGAGCCTCATTCCTTCCATAATTCCATCCATAGCCC
ACAAAAAAAGGATAATTTGTTTCTTTGCATTTTTTAGCTTCCAGAGGCTACCTGCTTTCC
TTGGCTCATGGCCTCTTCCTCTACCTGTGAAGCCAGAAGCCTAGCATCTTTAAATTTCTC
TCTCACTCTCAAATCTCTTTTTGCTTCCATCATTCCATTCCCTTCTTGTATCTTTCCCTT
ACAGAGACCTTTGTGATTACTTTGGGCACACTCAGAAAACTCAGGGTAATCACTTGTCTC
AAGATTTGAGCTTAATCACACCTGAAAAATCCTTTATTATGCGCTAATCTGAGGATTAAG
ACATGGACATCTTTGAGGAGTCATTATTCTGTCGTACTAACTACCTTTGTGCATGGAAGG
TTTTGGAATAACAAAGAAACTTCTGTTGCTATAAAGCAGCACTGAGGTTTTAGTTTGTTA
AACAAGCCTAGGCTGTTTTGACTGTTTTGACCTCACATTTTTGATACCCATTTCCCCGTA
TGCTATTTTCTCCTAAGGACCAATATGATAATGATCAAATTATGAGGATCTGAGGGCCTT
TAAGGATCTCAGGGATCCAGAGATTGTTGGTGGATTCCAGAAACCAAGGCCCAAATATCC
TCCCCTAGGCTTCTACTGCCCATCCTGCTGACCACTCCAGGGACAATGGGCTTGCCTCTT
CCTAAAGCCAGAACTTCCAGTGCACATGTCTGGACCAGACCAATGCCCTTCCTATAATTC
ATGTACCTGTGGATTCTACCCAGGGCTTCAAACTGGGAAGAATTATAACCCTTTAAAAAG
CTGGGGACTCGGCTTGCACCTGTGGCTCAGTGCTAAGCGCCAGCCACATACACCTAAGTG
CAGGTTCGAATCCAGCCTGGGCCTGCAAACAACATGAGCCAGGCATTGTGGTGAGCACCC
GCCTGTGGTCCCAGCTACCTGGGAGGCTGAGGCAGGAGACTTGCTTCAGCCCAGGAGTTG
GAGGTCGCTGTGAGCTGTGATGTCACGATATTCTACCCAGGGGGCAGCTTGAGGTTCTGT
CTCAAAAAAAAAAATAAACTTGGGGACTCTAACCCATCTGGCTTCTGCAAGTTCTCCTAT
ATGGCGGGTTTTGAAGACCCCTGCCCATCCACATCCACCACATCCAGTGTGACAGTCTGT
GTCCCTAGAGAGTGACACAGCCAAGTGGCAGCAGACCCCTCTGGGCTGGTGGTGTGGAGT
ATCCTGGCTGCTTCTGTGATGTATGCTTCCAAAGGCCAGAATGGCCTCATTAATAACCCA
TTACCAAGTTGTCATCCCTGGATTCATCTAAATTTATCTCAATAATTATAACCCTAGAGT
AGAGTGATAAGCCCTATGTGTTTAAAATATGCTGGATGAAAAGGGTATTCCTTTTATTTG
TTCAAAAAAAGTAATTCCTTTGAGTATTCTGAAGTTTGGTGAATAATTTCCTACTTACAC
TCCTAAAATCTTTTCTTCAAAACTTATTTATTTATTTATTTATTTATTTTTGAGACAGAG
TTTCACTTTGTTACTCTTGGTAGAGTGCACAGCATCATAGCTCACAGCAACCTCAAACTC
TTGGGCTCAAGTGATCCTCTTGCCTCAGCCTCCCCAGTAGCTGGGACTACAGGCGCCTGC
CACAACACCTGGCTATTGTTAGAGACAGGGTCTCACTCTTGTTCAGGGTGATCTCCAACT
CCTGACTGCAAGCAATCCACCTGCCTCAGCTTTCCAGAGTGCTAGGATAAGGGGTGTGAG
CCAACTCACCCAGCCCCCTGAAACACATTTATTGATGGGCTTAATCTGCCTCCCCCACTA
GACTAAAAGCTCCATGTAGCCCATTCTAGCATCCCCAGTGCCCAGCACGGGATCTGGGGC
ATCATAGACACTCTCAGGGTAAGTAGAAGAGCCACTATTATAAATCATGAGCCCGCTTCC
TCCTGTCCAGCTCTATCCCCTTCCCTGACCTGTGCCAGACAGTCAGGGGTCTGAGGACTG
AGGTCTCAGGTGAGTAGCATCTGAGATCCTGTTTCCAGCTGGCCTTCATGGCAGAGTTTC
GTCTCCAGGCGTAGCATGAGCTACTAAGTGAGCATTTGGTGAGCATCTTCAAAGAGCACC
CTGATCAAAGCACTGGTCAGGCCTACCAGGGCTGTCGTCCATCTGAACAGGCCAGCCAGA
GAGGAGGAACCCAGTAGAATAGACATAGGCCATAGAAGTCAGAAACAGCAGAGGTGGAGA
ACATTCACCAAGTTCTCTCTGTGCACCAACATCATTCTAAATGCTTTCCAAGACCCGTGC
TTTATGCTGACTATAACTTTTGGGGGTAGGACTAGTGTGATCCCATTTTACTGGTTGAGA
AACTGAGGCTGACAGAGTTAAGCTGACAAAAGCAACACAGTTGGTAAGTAGTGAAATCCA
AATTCAAACTCGGGCAGTCTGATTCCCATATTCTTTTAACCGTTCTGTGACATTTGGCAA
GACTCAGTATGCTGTTCCAGAGCCGTGAGCTTGGGCAATGGCCTGAATGTTTATAGCCAT
GAGTCAACTCACAGTGACTATCTCTCGAGGGATTTCTGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCCAGAGCCCAGGGCCCTCAGGGAGCCT
AGAGCTAGGGCCTTATTTCTGTTCTCCCAACCAAGACTGGGGTTCCAAATCTGCACATAC
TGCTCAGGGGGCTGGGATGGATCAGGCTGGGGTGACTGTGCTCTGTCTGAGACTAACAGG
CAGTTCTGTTGGCCCAACTCACGTGGCCATTATCCTTGCAGGGGCGCCGCAGGCCCCTCC
CTCATTGCCACTGGTGTCCAGTCTCACCCTGGGTTTCCCAGCTTCACTCGCCATAAATCA
GTTGTCAGGGCCCCTGAGCCTAAAACACTCATCTAATTATAAAACACATGTTTGATTATA
ATGGAATCCTCCCACTAAGACTACTCATCAGAAAGAAAAGTAATTCACTGGGATATTAAG
AGCTTTCTAAAATTAGTTCCAGACGTTTTTGCCTTAAATCTGTATAAGTGTTGCCCTATT
TTTAATTTACTTTAAAAAATACATTGGAATGCTAAGTAATTGGGGGCCCTGAAGATTACA
GAAGATTGAACAGGCCCTTTGCCTTGGTCTAAAAGACTTTGGGGACCACAGGGCCCTCCC
AGGCATTAGAGGGCAGTGGCACCACCATAAGGAAATGGTGTTTTTCCATCAGGCAGATTA
TCAACCTGCAACTCCAGCCCTACCTACTCTTAGTATAAGTGTTGGGAAAGAATCCTCTTT
TCTTAGCCCACTGGGAAAAACATCACAGCATCCTATGGGCTGGGCCAAAGTAAGTGGACA
TCAAAATAACCTCGCAGAGGGATGGTCCAGCCCAAAGAGGCCTGTGCCAGTGGGATGCCA
GGGGACAGGGTTCAGAAGGAGGCAGCTCACAAGCTGAGCACAGCTGCAGAGGTTTTCTTT
GGCTGTTTAAACTTGAATTAACTGCCAAAATTTAAAAACCAGGAGCATTCAACAAAAATC
TAGATTCCAGCTTTACTTGATGGAACTCAGGGTGCCCTGAGCCCATCTCCACCAGCAGCC
ACCAGCCAAATACATGCCTCCACTTACCCTGAGTATATCCACTCCCCTGTCAGGGCCCAG
ATGCACTGGCCCTTCTGTGTCACACCTGTGCCATTCTGACCACTGACTCACACAGCCACA
GTGCCTGCCCAGCCCTAGTCCTTTGGGGTTTATTCCCCGGCCTCACCTCCCTCTGTTGAT
CCTGACTCTGACCAGCCCCAGGCTCCCTGATTCTGCCCTGATACCCTGGGGCTGTTCCTT
CCAGCCACCCATGCTGCTACAGGATAGGAACCTCTGCCTGCTTCAGCTGCCTACCAGCCA
GCTCCGAAGCTTTGGCCGCCCCTCAGCGCAGGTTGTGTTGACCCCTAGGGTATGTCTGGT
GCTAACTTGTTCATGATTCACAAGAATTCTACCCTCATGGTTCCAGCACACCTGCCACCC
TGACTCCGGTCCTCAGCTGAACACCTGGGGTCCAGGCCAGAGGGCAAAGAGCACAGCCAA
GGAAATGGAACAGGCACCCCATGTGGTGGAGGCAGGAGCATTCTTCCCCAGGGTGGTGTG
CAGTGGACGCTGGGTGAGTGTCCCTGCTGGTCTGGCCAGCAATGGGGAAGGGAGGTTCCC
CTAGCTGTCTATGCCGGGGTAGAGCAGTCCCCAAATCAGGCCCAAGGGAGAGCTCTCAGT
GGTCTCTGGGGAAAGAAATGGCGTGTTGTGGGTTAGTGAACCTTCAGAAGCTCCCACTGG
GGCCCTCATCCTGCTCTAGACTAGGCCCATCTCCTCCTGCCCTGCCCATAGCAGAAATGA
GAACAGCTGGGCACCATGCTATTTTCAGGAAAATTTCCAAATAGACTCATGAGTCTAGCC
AAGACCCTCAGGGGTTCCCCCATTGGCCCTCAGGTGGTCTCTAAGCAATAGCTCTTTGTC
TAAGAAGCAGTCAGCACCTGCTGGGGGCAGAGAGAGGGGGTAAGCAGACGAGGCAGCAGC
CGCCTCACTGGAGTTGGACTGCAAGGGGCAGGGAAGTCACTGTGTCGTCCAGGGTCAGAG
AGTACCACAGATGCCCAAGGCTGAGAAAAGTGACACCAAATCTGCCCATGTCCCAAGCGA
GGGCTGCGGAATTCTCAGGGGCTTCCTCTCCCTCCTATGGGGCTCTTCCTGCCTTTCTGC
CATGTGTGATGAGACCAGCCCTCACCAGCCCTCACCAGCCACAGTGGCCTGTAGTCAGCA
CTGTGCCAGGTACGGGGGAGCACCTGAGAGATCCCAGCAAGGGCTTCTCGAAGCCTGGCT
AGCACAGACCCACAGCATCCGCCGCCTCCCTGGCCTGGGTTTAGGAATCACCCCTAAACT
CTGCCCTCCCAGCTCCTTTCTGTTCTGGATTCTCCTGTCCCAAGAGGGGCACACTGGTGT
GTTGCTAGCTTGGTTTATGCCCTGCCGAATGAAGGCCCTACTCTGATTGTTCCCTTGACC
ACTCACCTGCCGCCGTCACCTGGCAGCATGCTGAGCACAAGCTTGTGCGTCCTGCTTGAT
AAGGAAGAGAAAATGATTCCTGTCTCATTCATCTTTGCTTGTCATTGTCGTAGGCTTTAG
AATTGGCCAGACTTGGGTTTTCATTCACTTAATGTGATGAGCCCCTCTTCATGAAGAAAC
CCACCATCTCTATCCACCAACCTTAAACACAAACCCCTCTGAGCCTCAGTTTTCTCGTGC
GGAACATAAAAATCAGTGACATGGTACAAAGGGCACTCACCCCGTGCCCACCCCACATGT
TAGTAAACACGCAATATAGTCGTGGGACTTTCCCTTCTTATTAATGATGCTGTTGGCCCG
TTCTCTACCCATCCTCCAGCCAGGTCCCAAACTGGCACCCCCATCTCCTGCCTCTCACTC
AGGGCCAGGCTCTGAGGGGCAACCCTGAGACCACCTGCAAGGGTGAGCCCAGCTGGCAGG
CAGCAGCTGGGGTTGAGGGTATGCTGTCCCAGTACAACCACACACAGGTCCAGTAAGTAT
GAGCCAGAGACACCAGGTCCTGCATGAAAGCTGCTCACAGCCTGAGTCTCCCAGAGAAGT
AGCATCCCCAAGTCTAAGGGTGGCATTAGAGGCTCCTGCTCTGACATGGTTAACCAGCAG
CCTCCCAGACCCAGTTCCTTTCTGGGGGTGCAGGATCTTCAGGGACGCTCTGGTGGCTTC
TCTGTGCCCCATCTCCACTCCCCACACTCCCCACGCATTGTGCTTTCCTCCCTTCCTCCC
CCTATACCCTCAAACTGGTCTGCCAGGGGCCTGGCTGTGGATTTGACCTCTACCCCTGGC
TGCCTGGATCCTGCAAAGATCCTGGCCCTGCCCATAGGGTCTCCCTGGTGTTTTCAGAGT
CCCCTCTGATCCCCGAGGGACCCCAGCCTGCCCCCACTTCAGTGAGCCCTCGAGAAACCT
AACCCCTGTGCGGGGTGGGGGGGGCACACGGCTCACCACAGAGTGCAGCAGACAGGAAGA
CAAAAGGAGCACGTGATTCCTTCCATCCACGCCAAAACAAATCGCCCTAATTAACACTTG
CCACTGCCACGATCTATGGGCTGCCACGTGGCTGGAGCGAGTAGAGAGGCAGAAACCACA
GCGTGCTCCAATAAAACAGCGATAAATGGTGCGGTGTGATGGAACTCGTTTCAGTTTTGT
TCCAAAACCTTGTATAAGTGCTTTTATTGTTTCTGTATGAAAGAACACAAATACTTTTTG
AAAATTGCTTTGGCACAAGCCTCGTCTTCTCTGGGAAATCTTTTTGATCCCCCATCCTCA
CCCCAGTAGGTAGGTTTGTGGCCCCAGGAGGCCCCTGTGATGCCTTCTCTGTGTTGCCAC
AGTTTCCACACTTCCCTGTCCCCACTGGAGAGTCCACTGGGCCTCTCCACCCCTAGAGAC
TGGGCACCACTCACCCCCACCCCAACCCTGGGACAAACTGGGCTGGGGTGACCAATGTCC
CAATGGAATGATTGTCATGGTCATGAGAGAGGCCATTATACATCAAGGGAGTCACCAAGG
TTGCTAAGGGCACCCTTATAGGATGAAATTCTCATTAGAAAAAATCAGGGTTGATTTCTC
AAAAAAAAAAAATCAATAAATAAAATAAAAGCATAAAGACGTGGGAACACATAAACAAAG
AATCTTTTTTCATGGGAGTGTAGGGAGTGCTGCCTGGCCCTCATGTGGCCAGAGTTACCT
TTTGAAGTTTTGCCCTGTTTGAAGAATAGCCCTATAGCAGAGGTAAGAAAACCAGAACAG
GCAGTAAAAGTTAGGCCCAGAGTCAAGACTGTGTGGAAGCCCAGTGGGTGGAAGCTCCTG
GGTGGAAGCCCCCAAGTCCCCACATGGCTTGTCCAGGTGAGAGGCTCTCCACCCCTTCTC
CAACCAGGTCCCAAACTAGCACCCCCATCTCCTGCCCCTCCCTCAGGGCTGGACTCCAAG
GGGTGACCCAGCTGGTAGGAGAGAGTGTGCTCCCCTGTCATAAACCACACACAGGTCCAG
TAAGTAAGAGCCAGAGACACCAGATCCTGCATGAAAGCCACCTGCAGCTTTAGAGGGGAC
ATGCCCCTTCCTGGATGCCCTAGGGCTGCAGAGACCCAGTTTGCCAGAAGATGGGGGGAA
GGGAGTGGAGTTTGGGTCTCACCTGCAGGGCCTCCCTATGCTGGGACCTCCCTGGAAGGA
AAGAGAGGATGGCATAGAATAGCCTCTCTCTCTCTCTGCCACACCCTTCCTTATCTGCTC
TGGTAATATGCTATGGAAGAGGGGGATCCACCATATCCATCTCCAGAGGCCAGTGGGACC
CCTGTAAGCCAGCTGGCAGCCCCTCTTTGCCTGTGGCCCCACCTGCATGTGGCAGGCCAG
AGAGGAGGCATGGATTCAGTACACATCTGCTTTGAGCAATCACATAAAGTCTAAGTCTAT
GGAGATAAGAAATTGTCCATCAAGACTCTGAGGCATGAGCTGTCTTTGATCTGATATGTC
CACTCCCACTCTCAAATATAATTAAGGAAAAAAAAAGCCTTCCTTCCCAAGATCTCATTC
TCATGTATCCAAACCCCCTCCTCCAACTCCCAGAAGGAAGGGCCACACTTATGTAGAAAG
GCCCACATTAATGAGGCAGTGCCTGCTAACCACTTCTTTGGGGCCTGTTTTTACTTAGTC
TGACCACCATAGAGGCTATTCTTGGCAAGAAGTTCTTTTCACTAAAAGCCACCAGCTGCA
GAAAAAGGAAAGGGTTGAGATAGCACTGGGTACAAGAGGCCTGTGTGTCAGAGGCAGGCA
TGTCAGAGGGGGCCCTGGAGACAGGCCTGGTTGCAATCCCAGCTCTCTCTCTATTTCCTC
CCGTGCAAAGTGAGAAGCCCCAGCAAACACAGGGCTTGGACTTGGCACAGGGAAGCCATT
AGCTCAAAAAAGCCCAAAGTGTTCACAAGAGCCTATATAAAATAGAGAAGTCACTAAAGG
CATCTCTGTGAGAATCAAAAGGAAACAGAGGCCTGGAATAGTGGCTTACCTGTAATCCCA
GCACTCAGGGAGGCCAAGGTTGGAGGATTGCTTGAGGCCAAGAGTTAAAGACCAGCCTGG
TCAACAGTAAGACCCTCTGCCCACCACCACCACCTTAATCTCTACAAAACTAATTTTTAA
AAAATCAGCTAGTCATGGTGGTGCACATGCTTGTAGTCCCATCTACTCAAGAGGCTGAGG
CAGGAGGATCACTTGGGCCCAACAATTCAAGGCTATGGTGAGCTATGATTGTACCACTGC
ATTCTAGCCAAAAAAAAGAAAAATCATACTCTTAACCAGATTTGTAAACATTTAAAAGCT
TAGCTGATTTAGTGGAATTATTTGTCTACAAAACAAAAGTAACAAGTGAAGATTTCTGTG
TAGGCAGAAGTGAGGTCGAGTTACTTCATCCTCTGGGCTGAGGCTCCTCATCCACACTTT
GGAGGGCTGAACTCCTGAGGCCTCCACATCTCTTCTGCTCTGCTCTTTGCCTTCTGACTG
GTCTCCCCACTGTGTGCCTGCAGTACTGGTCCAACTGCATGTCTTTCAACATTAGCATAA
ATAGTACTACCACCCTTGAGTTGCCATATTTAGCAAATACAAACATAGAACATCTAGTTA
AAAAAAAACACACAATAATTTTTTGTTTGTTTGTTTACAGTAAGTCTGTCCCATGCAATA
TTTGGTTAAAAAAAGTATTTACAGTTTGTCTTAGTTAGTTCACACTGCTATAACAAAAAA
ACGATAGCCTGGGTAACTTAAACAACAGATATTTATTTCTCATAGTTCTAGAGGTTGGGA
AGTCCAAGATCAAGGTACCAGCAGATTCAGTTTCCACAGTTCACCTTCTCTCTCAGCTCA
TGTGGGCGTTCCTTGGTGTGCTCAGAGAGAGAGAGAGAAAGAGAGAGAGAGCTTGTTTCT
TCCTCTTTTCGTAAGGCATCAATCCCATCAAGAGGGCCCCATCCTCATGACTTCATCTAA
CCCTAAAAACATCCAAAGGCCCAAAAAACAATTACCAAATATCATAGAGAGGGGCTTAGG
ACTTCAATATATGAATTTGGGGGAAGGGGACACACACATTCAGCCCATTGCATAGGGTAT
CTCAAATTCAAGTTTAAGTGAGTGTCCTGAGTTTTATTCGACACACCTATACCTCCTGAC
TGTAAGCAAAGCCCCTGAGCCTGCAGAAACCAAAGCAGCTATCCATGAATACAGGGTATT
GAGAAATGCAAGAGCACACTGCTCAAGTTCATCTCCTGCTCATCCCGAGGCTCTGCTGCC
TTGAACTAGAATGGACCCACTTTTCCCACAAGTCTTTATCTTCCTTGAGATTCATAGGGT
GACCCAAGAAACATGGTCCACAATTTCCTATAAATTGAACACTGAAAATACCATTTAGCT
ATGGTATCCCTAGATGTCTTATCCTGGTTTTTGTGGTTAAACCCTGATGTGAGCAGAGAG
GAGATCTCTGTGCCAGAGCCCGGCACTCCCTCTGCCCTTCATTGCTATGTGGCCTGGGCA
AGCACTTGCCCTCTCTGGGCTGTGTTTCCTCATCCATACAACGGGAGAGTTGAACTCCTG
TAATCTCTCAGTCCCCTAAGCTCTTTTCTTCTTACTTCCTGTGCACAACTCCCGCGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACCCACCAGCTGAGACCCTC
TTTTCTCCTAAGCTGCGCCTCTCAAAGGGACCTCACTTCTTAGCAATCATTAGAATCAGA
CACCATTTAGGCCTCTGGACATTATCCTGGGGCAAAGGAGGCTTATTTTTTCCTAGCTCA
GGCCTGGCCCTCCCCACTTACCTCCTGAGCTGTGAAACCAGACTGAGCAGGCAATAGGGA
ATTTAAGCTGAGCTGAAAAAAAATCCTGCTACAATAAATCGCATCACAGTGGAGATCTCT
TTCTAACCAGAAAATTCTGAGCCCAGACAATGGCTCATTTATTTCAAACAATATTCAATA
CAACAGAAATCCAGGTCAACAAAAGGATTTCTACACGTTTTCGGAATTGGTTGCAAAGGG
ATTTAACCCACGTAGAAAAGAGAGCTGTTCAATTGCAGATTCCCCGTGTGAGGGAGACCT
TATTAAGGAATCCTGAGGTGGGCTGCTGAAAATGATGCTCCTTCCTCTGGGGGCATCCCA
CCTAATGATAGTGTGAGACAGAAGCACCTGGGGGCCAGCCCGGGAGGGCGTTTGGGTAAA
TATTTGGGTAGAGACGGCTGCTGCCGAGATGCTGAGCAAAGCCCAGAAGCAGAGCAAATG
GCCCCTTCTCCCAGGCCCTCAGATGATACATTTTTATAAACATCCAGGAAGACTGGCTCT
AAAGACTCTTGGGCTTTACAGACACATTTTGTATTCTGGAGTCGGAGACCCTCCTCCGAG
CATGGGCGGGAAAGAGGAACCAGGAAACAGGAGGGGCAGGAGGGGTCTGGACCGGCTTTC
TAAATTTAACATGCGGTTGCTTTTAGGCCGAGTGGATAAAAAATAAATTCCAGTGCTTAA
AGCTCTTATCTTTGTTTACCATTTCCCCAAACAGTTAGTGACCTGCACTCCCTGAGACTG
AATTATCAACCAGAGACATGCAGACACCAGGGGTGGGAAATCCTGGCGGGGGCAAGTGAT
CACTCTCCTCCTCCATGTGACATTTACTTGGCCTGGCAGGGTGACCAGGCTCTGCTAAGG
TCACCAGCTGCTCCTGAGCACATGGGGCACAGTCGTGATGCATCAGAACAACCCAGAGGT
GGAAGGTAGTTGGGGGTCACTCAAGTCAGCCTCCGACAGATGAAGGGTGTAGTCATATCC
TACAGTGACCTCTTGTGAACAGCTCCAGTGAGCCTGGGCTTGCCCGTGCCACTGTTAAAT
TGAAGTCATTTGAAAATCTTTCTCTATGTTGAGGCAAAATCTTTGAGGCCTGGTCACACC
CTCTGCAAGGAGATGTGGCATAACCTTTCCCTAGGTTGCCCTTGCCCTGTAGACATGTGA
TGATGCTCTCTGTCTCCCTCGGGCTGCTCTGTTCTCTTGTATATACACAGTGCACCTGGT
GGCTGTAGCCAGTCAGGTTCCCTGGACGCCCGCTCTCGATATCACCTCTCTACCTGCATG
CACATCCTTTAACCCACTAATGGAACGTTGGTTTCCCTTCTCCTCTAGTTGGTGAGGGCA
ATGTCCTTTCCAAGTCCTGAATCTCCCAAGCCCTATCCAGGAGATCTGACACATCAGCCA
GGGTCCCTTTCTTTCCAGTTGCCCTGCCACCCTCCTCTGGGCCACACTTATGGTACAGAC
CTTGGCCTTGTGCTTTTCTTTCTTGCCCAGATCCTAGAAACTCATCCCCCTCTTTGTGGT
GAAGCTGGACACCATCTTCCCGCCTCCAGGCCAAGCTGCTGACTGTCTCCCTAGAGAGTT
TCCGACACAACCCTGCAAGTGCTGAGCTCCTTCCCATGGATGGTGAAGCCCCTACCTGCT
ACTTACTGGTCCTATTTCCATCTTTCTCTCAGCCACCCAGGAGTAGAACCTGGGAATCAC
TTTTATCTCTCTTCATGCCCTGACCTCTTGTAGCCCAAGACTCTACTTCTCTGGTGAGGC
TTCCTTCATGACACTGATCCTGATGTCCAGGCTATACATCATGCCACCTGGGGAGCTTTA
GTATGATACCACTTCCTTCACCAAACCCAGACCAGTTAAATCTGAATGTTGTAGATGGAG
CCCCAATACTGGTAGGGAACGGCCAGGATGAAGCCCCTTTTCCCTTCTGAAACCTGACAT
TGTGATTGGAGCTCATCCCTTGTGCCTGGACTATTCCAACAACCTCCGTCTTATTGACCC
AATTCCCAACTCTTTCTGCTCCTGCCATCCTACAAGTCATTGTCAGCTCACACAATACCA
TTGCCAGTGCTGTTACCTCTACTCATCAGAAACCTTCAGTGGCTCCCTATTACCATAATA
ATAACTCTTTGAATGAACAAATAAATGGTTCCCCAATGCAGAATAAGCTGTGTGTGGTGT
GGGGCTGTATCTTATCTCTTCTTTCTTATTCACCCCCACACTCTGTTAAGCAGAGTAAAT
AGAGGGAACTGAGGATCTGTGGAGTGAGTGAACAAAGATATTTTCTTTGCAAATTAAATG
CAGTCCTCTCTCTCCCCAAGGCAGAGAAAGTGGGCTAGGTGATTTGACTATCCTTCACGG
AGGGGCTTATTTCTTTCCACATCATATACAATCAACTGTGAATGTTCCACACTAATGGAG
AGAACAGAATCCTAAATACTACAAAACAGCTGATAATTCAAATACTACAATCTAGTTGAT
GTTGGAATGCATTTTTGCTTATGAGTGCTTGTGTCAGTTAATTGGGACAATTTTTTTAAA
TTAGGTAATTAGATGTGTCTTATTTGTTCCCAGTTCGCCCCTCTGCTACACACATACTAA
AGGAATAAATAACTCAGCTCCCAAAATAATAAATAATACCCTATTTTTTCTCTCAGCCCT
TTCCTGGAATAGAGATAATGGTTAGATTTGAGAATTTTGGCTGGGTGGGGAGAGAGAAAG
GCGGGGAGGAGCCCACAGTTAGAGTGAATAGAAAGAACTAGACGTCAACAAGCTGCTTCT
CAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAGGCACCAGCGCT
ACAGAGAAAGGGCAGCCGGCCCTGGGCTTGAGAGCGCTGAGCCGTCCCGGCCTGATTCCC
GTTCTTTTTTCACATCTCTCACCTAATCCCTTAATGGCCTGGGTCTCAAAGTACAAGGGC
CCCTGGAATAGCCTGGGGGTTTGTGTGAGATGAAGCAGATACAAGCAGATGCGAAGTGCA
CTCGCCTGTGTTTTCTAAGGTGTAGATTCTGCCAAATTCGTGAATCCGGCACAGAGAACT
TCCTGAGCACTGGCAGGGAAAGCCACCACAGTGATGGAAAGACTTCTCACTCCCACCCCA
TACCTAAAGCTTCCTCTGCTTCTCACAACAAGCCTGAAACCACTGAACTCAAGATGACAG
ACCTGTGGCACCTCAACGATGAAATGTCAGGGCCGAGAGGACCTCAGTGCCCCGAGAGGG
AGAGCTGGCCGATGAGGAAGGCGGGCCCCACCTCATGTAACTTGCTCGTCTTGGAGACCA
GTCACGTGGGGAGAGGCTTTGCTTCCAGGTTTATGGTCAAAAGGGCAAAGCTGAGGTCTC
CGTACTTGCCACGGTTTGGTTTCACATCATAGTCTTATGTTCCCCAGAGAATCAGAACCA
ATGGAAATCCTTATTCTTCGTGTGGCTGCATTGCCCCCAGCCGCCCCTGTGCTTAAGGGA
TTTCCAGTTCCCTGCTTCCAGAGAGCAAGGGCCAGCGTGGCTTGGCCACGGTGTACATGC
CAAGTCCAGCGATGTAGGGCCAGCAGCTATAATACTATTTGATGTTGCTGCTACAACTGC
TCTGGAGACACAAAAGCGAAGCCACTCACTTCTATATCCTCTATCAAAATAGGAAAATGG
TAATTTTTTTATTAGGTCTCTGAATCTCCAGGAAAAATCTCTATGAAAGCAATGACATTT
TTATTTTCTTTTTCCCATTTATACTCCAGATCATATCTGCACACATACGCAGTGTGTGGT
GTATGTGTGGGTGTGTGAGTGGCTGTGTGTGTGTGTCTAGCTTTCAGAGAAAATGATACA
CAAAATTATAGATATGGAAGAGCAAGATTAATAGGAGAGGGTGGTATTATTTCCTTCTTA
AAAGGATTTATTAATAGATTTTCCATAGAGTTCTCTAACCACCAGGTTTATCTATTGTAT
TTAAATATTGGTGTACAGGGCGGCACCTGTGGCTCATGAAAGTAGGGTGCCGGCCCCATA
TACCGGAGGTGATGGGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACTATATGGCAGAAAGACTAAGCGATCA
AGAACCTTAGAAATAAATTAGAAGTCTCTACCCATCAAAAATCAAATATATACAGAAAAA
TCTCCCTGAAAGTTGAGAAACTCTGGTTTGAGAACGTAAACCACGAGACAAAGATTCCAC
CTATTTTTAAAATTATTTTTTATTGTTTTTTGTTTTTCCCCAATATTTTATTTTCAGTCT
TCTGAGAGCACAGTTATTTATTTTATAAAATAAGTCCCAGCTGAAATGAATTCTCTAGGA
CTTTAGAATTTCTTCCTTAACACATCCCTACCGAGTTGCTCAGTCGGGAGAACAGAATGA
CCCATGTACAGATGAACTCTTTGCACTGCGTGTGTCCAAACAGAAGTGTCACCCGCCTCT
GGGGCACATTATAGTTTCCAAAGACTTTTCCCTTTGTCATCTCATCCACCCTCCTGTGCA
AGATGGCTCGGACATCACAACCCCAGATTACAGACCAGGCAACATATAGATGTTGTCTTA
GTGACTGGGTCAAGGCCACGGCTGAGGGCAATGGACCCACAATACGTCCCTGTCCTTTTC
CCCACCTGAAAAGATCTGGGGGCATCCCAGGAGCCAGGCTATGGTCAGGAAGAGAGGCTG
CAGGGGCTCCTTGTTGGGTGTAAGGTAGAGCATGGTGCTTTTAGGATTCCTCCAACTCTA
ATTCTCAGTAATTTGGCCAACAGGAGTCAGAGAGAAACACCCCTCCCCACCCAGCTCACT
CTTTAACATTATCTTTTGGAAACACAGAAGCCTAAAGTGCTTCCAGGCTTGAAATAAGAC
ACCATTCAGCTCTACTTCCCAAGTTTTCCTGATACTTCCCACCAAGCCAACCCACCACAA
CCCCCACCAGATACCAGTTAGATAGGTGCCTGGAGGAGCTGACAGAGGGCGGAGAGTGAG
AGGGCCGAGGGTCTTGGCATCGGGTGAGCAAGGCCACAGACCCAGCCTGGAGCTCCCATC
CCCCGGCTATGCAGATGCTGCTTCTATTTAAGCATGTGGGGTGAGCCAGCCAGGCTTTCC
TTCCCAGGAAAAGCACTTTCTTCACTAAGCTTTCCTTCTTCATCCTTCATTCAAACTAAT
TTTATCTTCTTCCCCCAAACAAAATATCATTTGTTCATGTCTTTTAGATGCCAAAGCCCA
GAAGGGATGCCCTTCCACCCTCTGTGCCTGGTAAACACTGTCCATCCCGGTCCAGGTCCT
GCCTCCCCTCAGCCAGCCGGACAAAACTATTCTTAATCCTTTTGACACATCTTAGAGTCT
TCACATACTCTGGCCCATACACCAGGATACTTAAACTGTTATTTAGCATTTCCACTTTTT
ATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTCAAGTTCCCTGA
TTGAAAATCATACTTCACTGCAGCCTCTAACTCCTCCAGTGATCCTCCTTCCTCAGCCTT
CCAAAATACTGAGATTACAGATGTGAGCCCAATGCTTGGCCTATACTTTTTGTTTTAGAT
TGGTTTGCTTAAATCAGCATCCAAGCAAGCCCACCCGCTATTCATGGCCTAGTCTTACTC
ATCATAAAGATCTCAGCCTAGACCTTGCTTTCTCCTGGCAGCTTTCCCAAATCCCAGATA
TGTCCCACCCTCATCCACTTGTCTGTATCTTGATAGACTAGAAGCTCCAAGAAGTTGTGT
TTTGAAGTACTGTTCCTGGGCCTCCTTACACAGTGCCTGGTCAGTAGTATTCACCAACGT
TGCACGTATCCCCTAAATAAGTGAATGAATGATCTCCCAAACAGAACCAGTTTTCAAATT
CCCGTAAGCCGGTTCTGTAACACTTTACACATCAGTATAATGATTTCCGTAGAAATCAGA
ATCCCCAGCTGGCAAAGACTTCATCATTTTCGAATCTTGGCCCCTAGCCCAGCACCTGAC
TCTCACAAGGTGTTCATTGAGGGACGGCTGAATGAATAAGGACACTTAGAACAAGCTCTA
TTTGTGAGCCGTTGGGTTCACAGTCCTGCACACTCGGAGTCTCGTTTTTCTCATCTCTAT
CATGAAGAATTTGGATGCAGTGATTTCTAAGGTCCTTCTCGGGGACTGGAGAGTCCTCAT
TTGCCATGTGCTTGCTGCCCTCTGCTGGAGGATTCCTCAGGTCTCCTTTGTCCCCGAAGT
TCCTGAAAGTGGCATAGGGACGGGAAGTTCCTTGTCTAGCTAGATTAGACTCAGACATGG
GGGTGTGACTCTCTCAGTGTGGAGAAGTGCCAGGGTGAGTCTCAGACAGGGGAAAAGACT
AGTGTAGTGGTTCCCACACCCCCGGCTGCACATTAGATCAGCGAGGGGGTTTTACAAGCA
GAACCAGTGCCCAGGCCCCACCTGAGGCCAAAACTCCACTTCCTGGGGAGTGGGGCCCAT
ATATATATTAAAAATTATTTTAAAATCCAGCTGGTTCTAACATGCAGCAACATGGGCAAG
ATCACCTTTATGTATGTATCTTGAGCTAAAAGCTCAGAAAAACAGTAAAATGCCCATCCC
AAGAAAGAATAAAAGAAGGCTTTGATTCCATAATACAAAGTCCCCTTAGCTAAACTTTAG
AGTTTTCTTTCTTTGACAAACTTTGACAACTTACAACCCGTACAACTTTATTTGGGGAAC
CAACACCATCTGGTTTCTCTTTCTTTTTGAGATAAAGTTTTCTATGCTTATATATATATA
TATATATATTTCTGCAACTCCTTTAGTTTTAGATAATGCACCAGGGAGGGGAGGCATGTT
TTGGGGCCTAGACATACTGGGTGGGCTGGGGGAGTCCAGACCCTCACAGGCACCTAAGGG
CCCTGCCACCACGAGACCTGTGCACCAAGACTTAGTGGGGGGGGAGTAGGGAAATTAATC
CAGGCATCTCCTGTTCTCACCCACTCTTTAAAGATCTTCAAACCTCTGGACAAACCCAGC
ACCTGGACCGGGGGGTGGGCAGTGGCTTGACCCCACCAAGACACAGCCTCTGGACAGTCC
TGCCACAGACCCATGAAGTCCATGGTCAGTATTTTAGCTAGTCTGGACCTAGCCATCTAG
GGGCAAGGATGTGCCCACCATGCCCACCCTGAGATGCTGTGGAGCACATGTACCCCACCT
AGCCCTCTCTATACCTGTTCCCAGGGCCCTGCCAGGAGTATGGGGCAACATTGGTCCTAC
GGCAGGGAGGGGCAGGCCAGGCTGGGTGAGGCTCCAGAGATCAACAGCCTCAGCACAAGT
GGGGCCAGGCAGGAGTGTGCCTCCAAGTCCTCAACACATGCTCTCTTATCCTTTCATACT
CTGCTGTCCAAGCACAGATCAAAGATAAAGTTACTAGGCCTCTCAGACAGCAACCACAGA
GCAACCCGCAGGGCCCCGGGCCCCTCTTCTATGGCTCAAAATGCCCCATCCACCCGCCTG
CTGGGCAACACTGGGGTGAGAAGTGGGTAGTCAAGTGATAACCTTCAGAAAGGCACAGCT
TTCAGGAAATGCAGATGGAAGGGCTTTGGGTAAACCAATCGGATGTTATTTTTTATTACA
CAGTGGACATAACTCCCCGGCTCTCTACATTCATAAGCATGCACAGACCTGGAGTTATAC
TCCAGATACTTTCTTCAGCTTAATTTAGGGACATGACTGAATGGCTACATCATATTCAAT
GGCAGTATGCAACAGACTAGTTAAAACACTGACCATGGACTTCAAGTCACCACCTGTCCT
GGGCCCTGCCCTTTCTCCCCCCACCCTCCCCTCTGACCGGCTCCACACTGCTGCTGTTGG
GGGCTCACTCTGAGAACACTGGCTCAGACCCCAGGCAGGGCAGCCACATAGCAGCTCTGG
GACTGGAAAGGGCTACAGAGCCCACCCTTGGAAAGTTGGTGGCTGCAGAATGGACTTGAC
CCTGCTGCTCTGGAGAGGGGAGAGAACAGAAGAAAGGGATTCCCTAAGTCGGGACTCCTG
GATTAGCATTACCTAAATGGATGAAGTGAAGCTGTCATCTACCAACCAGATAATGCATCC
ACCTCTGCCAGGAAGCCAGCACGGCAGCAAATAGGCACCCCATGCCCCCATGCTGTCCCA
CCCTCACTGCCAAATATGCCCCTCCTCAGGCCATGCTGCTCCGGGGGGTCACCAGGGGGT
GTGAGGAGCCCCCAACACAGGGTACTGGAGTTGTGTTGGAGTTGGGTTTGGGGTCGCATA
CCCCAAAATCTAATCAATACTTGCCAACTTTCTCTAATCTTATATGTGTATTTTACACAC
AAATGGAATCTCATTGTTTTAATTTGTGGTTTGCATCCCAGCAACTTGTATTTTTTCTTC
TGGGTTTTGCCTGTTTGAATTCTTTGACCTGTTTTCTAGGGAGTTATCTTTTCTTACTGA
TTTATTGTGGCTTTTCGGTTTTCTGTTACTGTTAATCTTTTATAGATGTGGCAAACTAAT
TTTATTTGCTATTTCACTGTCTTTTAACTGCATGATATTTAGCCTAGCATTGCTGTGGGC
ACCTTTAGTCCCAGCTACTCAGAGGGCTGATGCAGGAGGATGGCTTGAGCCCAGGAGTTT
GAGGTTGCTGTGAGCTATGACACCACTGCACTCTAGCCTGGGCGACTGACCAAGACCTTG
TCTCAAAAAAAGAAAGAAAAGCCCTATATGACGTATCAGTTACTATCCATACGACAGCCC
CTCCGAGCCTCCGTTTCCAGATCTAAGACATGGGAAAGCAGCCATCACCTTGGCTTGTTG
AAGGATCAAACGAGGTAGTATCTGCACAGTTCTTAGCCAGCCACATCATCAGCTCCTAAT
AAACACTAAGAGCTGCTGCTGCAATTTATAACCAAACTTCTCTGTGTCATGCAAGAAGAC
CTCAGTCCCAGGCCACATTTCACAGCGCTATCTCAGTAACAGATGGCACCATGAAATGTA
AGCACAACAGAACCCAGGGTGCTGTCAGATGCTATCCGGCTGTATATACTTTTCCTTCCG
TGGGGTTTTCACTTAGATGTTTGCCAAAGTTGGGGCAAAACTCTGAAGAGCATGGAAAAG
ACCAAATGCTTTGAGGCTCCAGCTGACTCGACCTTCTTCCTTTGTCACTGCTCCTCCACC
AGGCAGCCCCTGAGTACTGCAGCCTCCAGGAAGGCCTGCCCTACCTGGACATGGTGATCG
CAGAGACGCTGAGGATGTACCCACCGGCTTTCAGGTACGCACAGCCCTGGCCGGCCTTCG
CTGGACCTCCCTATGTACCGCCTTGCTAAGCACATGTGCTGCTGCAAGGCAGGGTCTGAG
TCCTCTGGTTCCTTTGCCTCCCTCAGGGCTCCCTGAATGACTGGCCCTTTTCCTATAGGT
TAATGGCCTTCTCATAGCACCACTGGCCTTTTCTTAGCATGGCCTTCCTCTCCAACCCAA
GCCCATCGCCTTGGCCTCCTAGCCTTTGATGGCTTTTGCCATTCACCCTGCCTGTTCATT
CATTCATTCATTCAGCAACTGTTTATTGAATGTCTACTTTGCACCAAGCACTGGAAATCA
GCTGTGTATAAAACAGATAGAAAGCCCTGCCCTTGGGCCTGACACTCCAGTAGGGGACTG
TCTGAGGACTGGGAGCTCCTCCCCACCACCCAGCAGCCCCACCTGTCACATCCTGGGGCT
CAAACACAACTCACCACCAAGGACGTCTGCCTCAGGCGCGTCTCACTCGTTCCTCCCTGC
CATCCTCCCTGGCACTGTGAGCTGTAGCTGCACTTACTATTTTCTTGGACCCATTCCCAC
CACACCACAACATTTGACTGAGGTACTGGCAGTCACACCAATTTATAAGTACTGTGACAG
CAGGAATTAAGTCTTGCACTTTGAACTCTCCCCGAAACAAGGCACCGCCCCAGAGAAGGA
CATTTTAATTCAGGTCCCCAGACTCTTAGGGAAAATGAAATGATGCAGATTTCAGGTTCT
ATAAGTGGAAGCTGTGCACAGCACCAACTATACAGTATAAATTCCACTCAGCAGGTCTGT
GAATTAATATTCCACACGAACCACACAGAGATACTTTTACAATTTTTAAAGAGAAAATGT
AGGTGATCTGAGGGTATCTCAAAACGATATTTCAAACCAAAAACATTACAAATAGTGTGA
TTGTAGATATTGTCCAAATGTTCAAGTCCAAAAGCAAAGAGAAAGTTCCAGTGGTGATTC
AAATTGCATTGTCCTCAAGCACCCAGGGTTGCAGTCTCTTGGTGGGGGAGCAGGCCAGTA
ACTCAGGGGCTCTCCACACCCTCTCCTGACACCAGCATTAAGTGCTGGTGCTTCTCTGGG
TGCAGTGGCTCACTCCTGTAATTCCACTGTTCTGAGAGGCTGAGGCAGGAGGACCGGTTA
CACCCAGGAGTTCAAGCACAGCCTGGGCAACATAGTAAGACTCCAACTCTACAAAAACTT
TTAAAAATTAGCTAGATGTGGTGGTAAAGACTTATAATCCCAGCTACTTGGGAGGCTGAG
GCCGGAGGATCACTTGATCCCAGGAGTTCTGCAGTGAGCTATGATCCCATCACTGTTCTC
TAGGCTGCGTAACAGAGCAAGACACTGTCTCTAAAACAATCTTAAAAATAAAAATGGTAA
GAAAAAGAACCGCTGTTCCAGCCCTTCCCTAATTTCCTTGGGAGCCTCAAGGCAACTGTC
ACTCAATCTTTTTTTTCATGATTTATATCCAGCTTCCTTTCATGAGGACTGCGGGCAGCT
GGTGTACATGGTAAAATGAAGTTCAAAACAAAGCATTCAGGAATCAAACAGAACAATGGC
TGATTACAGGAGAGAAGCCTTTACTGGGCCCCAGAGATGGCCAATAGCTGGGGTCAGGCG
TGGGCTTGGTGGCCAAGGCCCCTGGCAGACGGGGAAACCAGCTGAGCTGAACAGCTGTGT
CCTCCAGGGGGAGGAAAGTATATAAACCAATCAAAGAACACATTATTGCTTGGATCTAAA
CTCAATCAAGAATTCATCACGTGAGACAGAATAGACGACATGTTAAGTCACAAAGGGGAC
ACGCTCAAAAAGGAAAAAAAAGCAGTGGACGGGTTCTTCAGCAAATGCTGTGGCCCATTA
GAAATAGCAAATTACAAGAAGAAATTGGGGCAGGAGTTGCTCTGGGGACCCAGATGCTGA
TGCTCTCAGGACAGAAATAGAGAATCTGGACCAATTGGCTCAAATTCCCTCCTAAAGGTG
CACAAAGTGTCCTGTGCCCAGAGGACACCAAACAAACCGCTCTTGCTCTACTGTGTGGTC
CCGGGGGAGCTCTGCACTGCTTGGCACATTTCCTCCCCTGGGTTAAGTGGGGACACACCT
GCTCTGCTTGCCCCCAGAAGCAGCTGAGGCCCAGTGGGTAGTATGTGAGCAAACCCAACG
TCCTCTGGGCCGCACGCAGTACAGGTGCGGGGCGAGGGGCCAGAGGCGCTGGGCGTCCAG
CTGAGGTCCTCATACCTGTTCACATTTTCTTCCCATGGCTCAGCTGGCTTCTGTTTACAA
ACACCAGAAATGGGAGAGAGGGAGAGGCACCATTCTCACCCAGGGAAGAGGATGGTCCAC
GTCTGTGCAAAGGATGTGAGAGGGAGTGCAGGGAGAGTGAGCATTTGATTCGATTTGATT
ATTTTCTCTCATAAAAGCATGTTGACTTTTCCCAAGCACCGGCACAACTTGACTTATCCA
TACAAGAAACTCAGAACAGCCCTTGTGGAAAACATAATGCGTCTCAAGTGTGACTGATGC
GAGTCGGCTTCCGCACTGCACAGTAGCAGATGTTGCTGGCCTCTCCTGGGGCCTGGTCGA
GCTGGACAGGAGGCCCAGCAGCACAGAGAAGGGAAGGCCTATTTTCCTGCTTCCCAGGTC
CTGTATCCAAGTCCAAGCTGTCTCCAGTAAAGATGAAAAAGCAAGAGTCAGGGAACACCC
TTATCTGACCCCCTTTGGAACTAGGGGTATAGACATCACAGCCCATCTGCCTGTCCAGAT
TCAGTGCTGCTGTTGGCCACTGGCACAGAGGAATTGCTTTCATCACTTGGGGTCTGATGG
GTTCCTACCACCCTGGCCTGTCATTCTTCCTGACTGTTTATGGGAAAGGCTCATAACACA
GACATGAATGTGGTCAGGAGCCATGGGTTATTCTTAATATTTTTTATAAGCAGGAGCAGG
GCATAGCTATAATTAGTGTAATGACTGTAATTCTCTAAGATATTTAGAGAAGCCCAATCC
CATATATAACTTGAAGTAAAAACTAGTATAGAATTATTTTCAATGTTTATATTACCAAAA
GAACATATTTATACTTAAAAAAAACATTCTAGCCCAGGTAACAGAGCAAAACCCTGTCTC
AAAAATAAATGAATAAATAAATAAATAATTTTTTTGGAATCCTAAACAATAAAGGATACA
AAGAAAAAGAACCCCTGGGACCCCAGCCATCCTCTAGGCCAGTGCTGTCCCCTAGAGGAG
ATAACGGTGCAAGCTTAGGCATTCTTCCAGAAGTTTTATGTTCATAGGCAGAACACAAAG
TCTATCCTTTAAATATAAATAATTCATAAAAGAAATTATACCATTGGGTAAAATAAACAA
TCTTGGTCAGACGCTTTCCTCTCCAACAGAAGAGGCTGTCTGTGGTGATACAGACCAAAT
TTCCTTTAGGTAAAACCTCACCGGGACTTACCCAGAGCATCAGATTATATAGACACAGAG
TAGAATGGTGGTTTCCAGGGCCTTGGGTGGGGTGAGGGGGACAACTCAGAATCAGTGTTT
AACAGGCACAGAATTTTGGTTGAGGAAGATGAAAAAGTTCTGGAGACAGATGGTGGTGAT
GGTTGCACAGCAATGTATGTACTTAATGCCATAGAGTTATGCACTTCAAATGGTTAAAAT
GGGAAATGTTATGTTATATATATTTTATCTCAATAAAATAAGAAACAAGTAAAGAGATAA
ACCAACCTCACCAGGACCAACTCTGGCATTAAAACATTCCAGAATTATTATTATTGTGCT
GACCTGGTCAGATGCCCTCATGCCCTATTGTTACAGATTTAACTCTCAGAGTATTTTCCA
TCTGCTCCAGGCACTTGCGGGTGCTATGGTCACAGGCAGGGTGGAAGTTTGTGTGTAGGG
GGTACACGCACTCCCCCCAGGATTCCAGCCATGTTGGAATGTGGCTTTTTCTACATAGGT
AACTCAAGGCCGAGTCTTGGCAGAGGCCATGACTGGCATCACCTCCCAGTGCTCATGTTA
CCTGAGGTCTGACAGGTGAGTAGGGTGGGAGGTGGGCTTTGTCTCCTTATGTGGGAGAGA
TCCATAAGAAGTGGGGTGACGCTGAATCAGAGAGGAACTTCTCAACCTAGCGCTATAGTC
ACAGCAGTCTCGGGGGCGGGGAGGCAGTGTAAGGGGGGAGCGATGAAGAAGCAACTATTT
GCTGTCACTTTGCTCTTGTCCTGAAAGGCTCTATCTCATCTTTAAAACGCTAAGTAAATT
ATGACCAGAGTACTCAGGAGCTTGTGCTAGACAGTAAATGTCCAAAAGCCTACATTTTTG
TATCCTAAATTGAGGAAAAGGGTTCTTTGGCCCCCCACCTCTAATTTTGTTTATGGAAGA
TTGTGTGTAGGTCTGAAGAGTGAGCATGTTTTGAGGGACAGAAACTGACTGAGAAAGCAG
GGCGGGGTGTGTATAGGGTTTGGAGTCGGGGCTGAAGACATTTAAGGTAGGTTTTTCATG
GCAGGAAATTGAAATTGGGCAAAATTCATGACATAATGGTCTAGAAATTAGTGGGTACAC
ATAGGCGAGTTGAAGGGAGACTTGCCCGGCACAGCTGCCATCTGGTAAGTGAATCTCTTG
CACAAGCCAGCAACCCATTGTCCTGATAGGAAAGCTGTTTGCTCAGTTGTTATTAGTTTG
CATTAATTTCCTGACGCAAACAGTGATGTTATTTCTTGATTTAGTTTTAGAGTCTCATCT
TCCTGGGCAAGAATTTGCTGGAACAGATAGGAAGTCATATTGACATAGGTGGTCTCAATA
CTCAGTCCTGAGGGTTGAATTATATTCCTACAGGTAGACTCCATTCTTGGGAGACTGACG
GGTCTCCCTTGAGAACTGAGGGGTCACAGCCACCAAGATGAGGCTTAGTTGTGGTGGGTT
TCCGAGTCACAAGGAAATAGAGACCTGCTCACGTTTTCTTGAATAGTGGGTGTTTTTTAT
AAGAAATTGTGATGAGATAAGGAACCAAGGATGGCCATCAGAGACAGGCCTCATGAAGGA
GACCTGAGCTGGGAAACTGGCTGGTGGTTCCAAAGCCACCCCCTAAGCAGTTAGACTTGG
GTGAGGCGTGGTCAGCACTGAAGCCCAAGTACAACTTCACTATGCAAACATTGAGGGCAG
CAGCCAGACAGCTGGGCTGGCCCGTGACACAGAAGAAGAGGGAGCAAGGGGATGTGGGGG
GCAATTTAAAGAGGCTTGATTGCAAATGGGAAGCTAAGGGAGGTAGGAGCCAGGGAATAA
CCCTGCAAGATCCCCCCAGAAATAGGTCCCTCCAAGGCACCATTGCACCTCAACACCAGG
TGCAGGGAGGAGTGCATTTTCACCAAGGGCCAAGCACGTTTGAAGAGCCCAGGGGACTAA
CTGTAGGCTCCTGGGCAGTGAGGGTCAATGTGAGGAAGCACTGCCTCTTCTGGGTCACCC
TGAGCCCCTGTCCCCTAGCTTTGTTCACACTCCATGCCTGCACAGCTGCAAACTCAGACC
CCCCCCCCCCGACTTCCCAAGCCTCTCTGGACTGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGGTTGAGAACCACT
GTGCCTGGAGAGATACTGAATGTGTGTTAGCAATAGAGGCCTTAGCTAGGAGGCACAGAG
TGAGCAGAGTTGTTCCCCAAAACATCAAAAAGTTATGGTAATTCAGATTGATGTTAGCAA
AGCTTAATTTCCAAAGGAAATAACTACTATTTTTAGAAGTTCCAAAAGGAATCCAAAGAT
TTAGCCTTTTAGCAGCACTGCATGCAAGAAACAAAGCAATTCCAAAAGTTGTCTTCTGTT
GGTTCACGACAGGACACAAGACACAGGATTGTATTTTGGGTATACACTGGAAAGTAACAA
AACAGTTCCTTGTTTAAAAAAAATAGTGGTTTTCTGGCTGGCGCCCATAGCTTAGTGGTT
AAGGCACTGGCCACATATACCAAGGCAGGCGGGTTCAAACTCAGCCCGGACCTGCTAAAC
AACAATGACAACTGCAACCAAAAAAAATAGCTGGGGGTTGTGGTGGGCACCTATAATCCC
AACTATTTGGGAGGTTGAGGCAAGAGAATCGCTTAAGCCCAAGAGTTTAAAGTTACTGTG
AGCTGTGACACCACTGCACTCTACCGAAGGTGACATAGTAAGACACTGTCTCAAAAAAAA
AAAAAATTCAAATTAAATAAATAAAAATTAAAAAATGGTGGCTTTTGGGACACACTTAGA
AGAGGGACTTTACCCAACAAATGCAATCATTGTAGCCAGGTTCTTTGTACCCTCAATGAA
TCCCCAACAATAATAAAAAAGAAAATTGGTGGCTTTGGCCAGGCACAGTGGCTTATATCT
TTACTCCTAACACTCTGAGAGGCCGAGTTGGATCCCTTGAGCTTAGGAGTTGGAGACCAG
CCTCAGCAAGAGCAAGACTCCATCTCTGTTAAAAATAGAAAAATTGGCTGGGCATAGTAC
TGGGCACCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGGTTCACTTGAACCCATG
AGTCTAAGATTACTGTTGAGCTAGCCTGATGCCATAGCACTCTAGCCTGGGCAACAGTGT
GGAACGAAAAAAAAGAAAAGAAAAATTGGCAGCTTTGCCAAAACAGTAGTATCAGCTAAA
TTTCTCCAGCACTCTAAATTTATGAGATCTCGTAGTAGACCTTCCTATCACCTCCACAGA
TTTAGTCCTTGTCAAATTTCATTTCTAAGATTTTGGATTGGAAATGCCTGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCCCTGTCCCAGTTCTCATCAGACGGGTCAATGTCCCTTCCCTGTGTGATCTG
ACAAAGGCAGGGCTGGACAGGCAGCAGTGGTTCTTGCACCTTTAATAGCTCCAACTGAAC
CCGTCCCTACTCTATAGCCCAGTCACTGGGAAAATGTGGGCAGAGGGAGTCTAGGTGATT
AGTATTCCCTTGCCAGCTGCTCCTGTAAATATGGCAGCCACAGGCACAGTGAAGTACAGT
GGTAGTAAGAGTGTCCCCTGAGCACATGTGACAGGCAAATGCTGCAATTTGGTAACAGAC
TTAGCAGCTCTGAGGAAAGGCCTCCATCCCTCAAAATGCTGCAGCTTCCAGGTGGTGGCT
GCCAGTGTGTTTTGAGAGACACTGGGGGGAAATAACAGGACACAGCCCCCAGGGAGGGAT
GGTAGGTGCCAAGGTGCCTGGGACTGTGCTTAGGAAGTTTGCGGCAATGGCTGGATCTTC
TTCTGGATGAGAAGGGGTGTAGCCAGGTGGCCCTGGCCCTAGTGAGGGCTGTGATCACCA
TGCCCTCACAAGGAGAGGCAGGAGGGCGTTGTTGACAGTCCAGTGATTCTCTGAATCCAG
CAGTGCCTGGGGCTATGCAAGACAGCATTGAGAGTGGGGATTTCACCAAGGGGCTACACC
TTCCTGGAGGAAAGTGTCAGATGAAGCTGCAGAGGGAAGGGAATAGGTGTCCTGGGCCAG
CCCTGACCACTTGCACCTTCAGGTTCACGGATGAGGCACAGCAGCAGCGGCAGCCTTTCA
CGTACCTGCCCTTCGGGGCTGGGCCCCGGAGCTGCCTCGGGGTGCGGCTGGGGCTGCTGG
AGGTCAAGCTGACACTGCTCCACATCCTGAGCAAGTTCCGGTTCCAGGTCTGCCCCAAGA
CTCAGGTGAGGCCCAGTGCTCAGGGGCAAGGGGTGGTTACTGGGCCAGCCTGGGGTGGCA
TGGGGCTCTGCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGCTCAGAACTGGGCTGAGGCAGGCTTGTGAGATTA
GGCTGTGAACTAATGGATGGCAGGTTAGGAATGAGGAAGGAACTACCCCAGTTGGACCAC
TGTAGGCAAGTTCCTCCAAGAAGCCCTCCCTTGACTGTGCCAGCCCAGACTGACCTCTCC
TTTTCTGAACTTCTGTAGTATTTCAAATTCATCTGGAATTAGCCACTTGTGGATATTCAC
ATTTTAATTATAATCAAATCAAAGAAAAAAACTCGGTCTCTGATTTGCACTGACCACAGT
GCAAGCTTTCAAGGCATAGGTCTATACCTTCTTATTTCTTGGGCATTTTAACTCACCTCT
TGTCCCACAACCCTCAAAGGCATCCAAAACAGCCTGCAAGCTCCCACATTAAGGCTCTGG
AGATTCTTTGCAGTGAAGGGTTCACATCAACTGGGGAATCATCATTTTACACACAGCTCC
AGGGGAAACCCAGCTTCTTGAGTCTTTGGCTTTTCTTCGAAGCCCCCAGTCTGCCCTCAA
CTCTGCCTTTGAAGTTGGACATGGGAAAGTTTTCTGGACATCAGCAAGGCCAGACCATAG
TATTCGTGAGCAACTGCACCAACTCACTCTTCTTAGTTACGGGGCTAGCACCGGGAAGCT
GGGTGAGGAGGGAACAGCAAGGAGGGTTAGAGTGGTTGAAAGTCAGAATTGAGGGCTTTG
CTCTCCATGCCAGTTGTGTGACCGTGGACAAGTTACATGGCCTTCTTGAACCTCCATTCT
TCATTTGCAGGGTGAGATGCTACCTCTTACCCAGCCTCACCAGGTGGATAAATGCAGGAC
AAAACACACTCTTGGCCTGGGCATTTCACTAACATGGGAAAGGGGGTGTTAATGTTACTC
ATTAACAATGTGCTTCATGTCAGTCCCCAGAAGGTAGCTTCGTTGGTTTTTCCAGTAACT
GTCCAATTGGAGGCAGTTCCTTGCTCACTCCTAGCCTGGCCATCCTTTAGTTCATAGCCA
AATTTCCACAAGCCTGTCTCAGGCCCAGTTCTGGAGCATAGATAAGGTTAACTTAGACAC
ATATTTTAATTTCTTCTATTTTAGGTGCCGCTGCAACTAGAATCCAAATCTGCCCTAGGT
CCAAAAAACGGTGTCTATGTCAAGATCGTGCCCCGCTGACTCAGAATACTGCCGGGGAGG
GAGAGGCATCTTGTGACTGTGATACTTGTGAGTCAGTGTTATCTCCAGTTCCAAAGAACC
CTGACATGGAAATTGAGATTTGGGGGAAAAGAAGTCACCAAAGTGATTAAAAGAATACCT
GGCATGCAAGTATTAAAAAGGTTATTTATGTTAACATTTCCTAAATGCTAAATAAACTTT
GATGCACTTAGTTGTGACATTACCACAAACATGGGATTTAAAGAGTTTTGCTCAGTGAGA
CTCTTATAGTGCAGGAACTGAGACACTCAGTAGCTGTCGATGCCAGTGTGCTTTTCAGTT
CTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1092, 29199..29292, 32627..32679, 62501..62597, 78309..78425, 97982..98070, 99735..99883, 101181..101281, 101284..101291, 101293..101311, 114155..114201, 114203..114332, 114335..114469, 193442..193533, 199409..199546, 202222..202384, 204924..204998
1001..1092, 29199..29292, 32627..32679, 62501..62597, 78309..78425, 97982..98070, 99735..99883, 101181..101281, 101284..101291, 101293..101311, 114155..114201, 114203..114332, 114335..114469, 193442..193533, 199409..199546, 202222..202384, 204924..204995
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved