Otolemur_garnettii Locus RPLP2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPLP2
Otolemur_garnettii
RPLP2
GeneScaffold_4515
SNORA52
3307..3438
5459
GATGCAGAGTCCCTGACAAAGGTTACGTGACACTAGGTCTGTCTGGACCAATGAAGCCA
GCTTCGAGGCGGACCTGTCGGGCCTTATCCTTCACAGGGCTGCGGGGCTGCCCCTCTCCT
CCGCGCCAGGGTGACGCTGACACACCACTTTGCCCAAGCCTCCTTGGTTCGAGCTCCTCT
TCTGACCACTCGCGCAGGCCCACAGGCCACCGTATGGTAGGGGAAGCCTCCCAGGCAGGG
CCGCGGTTACCAAGCCTGAGAAGGTTGCCCGCCTCATTGAGAGCCGCTTGAATTGGGCGA
CTCCGGGCCACTGGCAAAGCAGAGCACTTTACAGCGGCCCACAACCACCTCCGGGCGCAC
GTGCAGCCGCTCGCAGACCAGGACGCACGCGCACTTCCGGCAGCGGTGCACCGTGGGACT
TGCAGTTCGCAGGCGAATGAGTCCTGAGCGTGGAGGCCGCGGGGCATGCTGGGGACGCTA
GGCGCTCAAGGGTGATGACGTCCCGTTAGGCTTGCTTCCCCTCAGACGGGTTTCAGGAGA
TATTTGCCCCGTGCTACACGAGAAGCCGGTCTCGGAACTGCACTTCTCCTTCACCGGGCA
ACCTCCTGGCTTGGACGGGACAATGGTCCCCCAACTCCGCCGTCCTTAGCAGAGTGACCA
GTTGCGCCACTACTAGGCGCCCCCGTGCGGTGTCGCTCGCGAGCCCCAGAGGCTTCTGGG
TAGCGGCTTACCACCCGCCCTGCGTCGGCGACTTCCTTTCCCTTCCAGACGCCGCCGAGG
TCGCACGCGTGAGGCCTGTCCGCCGCTGATAAGTGAGTGGGGTGGTCGGGTTCGATTCTG
AGTCGGGGTACGCGACGCAAAGGCACTGGGGTGAGGGCGACCCGTGGGGCGCGCAGCCTT
GCTGGGGCAGGGTCCTCTTAGCTCGGCCGGTACGGCGCGCGGCCTTCGGGCTGGAGGCCG
CGGGGTACGACGCGGCGCCGCGCTCTCTTGTAGCATCAGTAGGCTACGTCAGCTACAACT
GCTGGCTGGCTCTCGGGGAAACCTTCCCCCCACGTCAAAGAAATNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTGGGCGCCTGTAGTCCTAGCTAC
TCTGGAGGCTGACACAAAGAGAGTCGCTTGAGCCCGGGAGTTTGAGGTTGCTGTGAGATA
TGACGCTACGGCACTCTATCCAGATTATACAGGTTACAGAGTGAAACTCTACCTCCAAAA
AAAAAAAAAAAAAAAAAAAAGCAGGCTTGGCGCCTGTGGCTCAAGTGGCTGAGGCGCCAG
TCACATACACCTGGGGTGGTGGGTTCGAATCCAACCCCGGCCCGCCGGCCGACAATGCCG
GCTGCAGCCCAAAGATGGCCGGGCGTTGTGGTGGATGCCTGCGGTCCCAGCTACTTGGGA
GGCAGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCC
ATGGCACTCTACCCAGGGTGACAGCTTGAGGCTCTGTCTCAAAAAATAAATTTAATCTTA
AAAAAGGCAAAGTCAGTTTTGGTGTTGTATTTTGAGACGCTCTGATTTCGTTGCCTTCAG
TAGAGTGCTGTTGGGGCATAGCTCACAGCAACCTCAAAACTCTGGGGCCCAAGTGATCCT
CTTGCCTCGTTTTTGCTGTTTTTAGTAGAGACAGGGTCTTGCTTTTTGGTCAGGCTGCTC
TCGAACCTGTGAGCTCAACAGTCCACCCACCTCGGCCTCCCAGAGTGCTAGGATTACAGA
TGTGACCCACGGAGACCTCAAAGTCAGATGCTGGGGTTTTTTTGTTTTTGTTTTTTGAGA
TAGAGTCTCAAGCTGTGGCCCTGGGTAGAGTGCTGCGGCGTCATAGCTAAAAGCAATCCC
CACCTGGCTCCAGACATTCTCTTATCTCAGTTTTTTTCTGTTTTCAGTAGAGATGGGGAC
TTGCTCTTGCTTAGGCTGGTCTCAAACTGGTGAGCTCAAGTGATCCACCTGCCTCAACCT
CCCAGGAGTCCTGGGATTATAGGCGTGAGCCACTGCACCTGGTTCCAAAGTCAATTTTTT
TATTTTATTTTATTTTTTTTTGAGACAGAGCCTCAAGCTGTCACCCTGGGTAGAGTGTCA
GGGCATCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAATTGAGTCTCCTGCCTCAGC
CTCCCAAGTAGCTGGGACTACAGGCACCTGACACAACGCCCAGCTATTTTTTGGTTGCAG
CCATCGTTGTTTTGGCGAGCCCGGGCTGGATTCGAGCCCACCACCTTAGGTGTATGTGGC
TGGCACCTTAGCCACTTGAGCCACAGGCGCAAAGCCTCCATAGTCAGTTTTTTTTTTTTT
TTTATTTAATTCCATTTCTATAAAATGGTCTGTTTTAATTTTTCTTGAGATGGGGTCTCA
CTCTGTTCAGGCTAAAGTACAGTGGTGTCAGCCTAGCTCACTGCAGCTCAAATTTATGGG
CTCAAGCCATTCTCCTGTATCAGAAAACAAATAATATTTAACAAAAACAACAAAATATTG
TGGGTTGTTTTTTTTTTTTTTGTATTATGTTTAGAACCCTAGTGTTTAGTTTTGGTTTAT
AGCACATACCAGTTCAAAGACCCATGTGTTGTTAATGGTTACTTCTCGGTCTAAGAGCTT
CAGAGCATATAGTACTCCACCAGCCCTACTGTGACGCAGGAAGACACAGGGAAGGCCATG
GTGCATTTGTCTGTCTCTGGTTACTACTTGTGGTTATCTATTCCAGGTCATCAGTGAGCT
AAATGGAAAAAACATTGAAGATGTCATTGCCCAAGGTGAGTTCATTTGGAGAGGGTGTTC
ATTATCATGGTCCATCCTAATTCCTGCTGGCCCCCAGTGGCTTGCCAGGTTTCGCTTGTG
GACTAGAGCATCCTAGAAGCTTCACCCAAAGAGTGAGCAGGGATTCAGTTGGCTCATGTC
ATTGTGCTTCTAGACACTCTCAGGAGGAGGAAGTGCCTTGTGTTCTCACTGGACTTGCCT
TTGGCTCCAGCTCTTAGGCCTGACGGTTCTTGTCCCTTGGCCCTTTCCTCAGGATTTCTC
TGAAGCTTGGTATCTAGCCAACTTAGCATTTATCATCAATTCTCATCATGTGCTTTCTGT
GGAAGCATTGGACTAAGGGTGCCAGAAATGGCCACAAGCTCATTTGTTAGGTACATGGTT
TTCTCTTGACATCAGGCTGGAGCTGATGGGACTTGTTTGGAAGTTGAGCTATTTGGCACA
GCTTCCCTGTCCCTGTGCACATGACCTGGCAAGGCCAACTCAGCAATCAGTCCTGTCCAT
GAGCTCATCACTGGGGCCAGAGATCTGGGTGCTGGCAGCAGATTGGTCCCTGTCCAATTA
CAAACATGTTTGTCTTCATTTATCTTTGGGACAAAGGGGCCTGATTGTAGATAGGAAAAT
TTCCTTGGTTGGATAGGGTAGGGTTGGGTTATAGAGAAGTGTCTGGCAGTATCAAAGAGT
GTCTGGGTATGTGGGTGGGGCTGTAATCCTGAGTTCTGGAGGGCAGGGCACTGTAACATG
GGGTCCCCATATGTTCCATTCATTGTGCTGTGTTTGGCGTGGTCTGGTTTCTCCAGTCTC
TAGAGCCCCATGGAGCAACCTTCTGACCTGGGCTCTTGCTCTGTCTCACTTTTCCTGTGC
TTTATGTAGGTATTGGTAAGCTTGCCAGTGTACCTGCTGGTGGGGCTGTGGCTGTCTCTG
CTGCCCCAGGTGCTGTAGTTCCTGCTGCTGGTTCCGCCCCTGCTGCAGGTGAGTGGAGGC
CTATGAATGGGAAGAGGCTTGAGGCTCAGACCAGATCTCTGCTGTGGGTGTCCACTGTGA
GTCTAGGCCTGGTACTCAAGTGCTGTGGGCTCTTGAGTCACTGTGCTCTTTGCTTTTCTA
CAGCAGAGGAAAAGAAAGATGAGAAGAAAGAGGAGTCTGAAGAATCAGATGACGACATGG
GATTTGGCCTATTTGATTAAATTATCATTTCCCTGCAAATAAAGCTTCCTTTTTATGTAT
CTCTTAGTGTACTGAGGGCTTCTTCAGAGCCTGGCCTCTGTTCCTACCACAGCCCAGGCT
CCCTCATGGGGCAGAGTATAGCAGCAGGGTAGGAGTGTCTGGGTGATCTCGAGGGCTGGT
GGCCTCTGGGTTTTACAGATGAAGGCAGCTCTTGAGCCTGGGTTGGGGGTGTCCCTGGGT
TTCTTGCAGGGGTCATAGTTCCATCTTCACGCCCTGGATTATGTAGGCAGTCACCTGCTG
TCTGTGGGCCAGCCCTGTTTATGAGGCAGGTGTGAACAGGCTGGTGGGCCATGTGCTAAG
TCCTGGGCTGCTGGCTGTGGCCTGAAATGAGCAAAAGGCACAGGCCTGCTACCCTCCACC
CCCTGCTCACCAGTGCAGTTCCCCAGGAGATAGATGCTCTGCCACTTTCTCCCCTTGCTC
AGCAACCCATCAGTTGGCTGTGGTGTGAGGCAGGCCTACTGTGTACCAGGCCCTATAGGT
ACTAGGGGCCTGCCTTAGTTGTGGGGAGATGGTACAATGATAACACTGAAGATAGCTGGG
ATGCCAGGATGGCAGCCAACCTCAAGTGATAGCCAAGACGTGAAGGGCAGGGGCCCTGGA
GTCCCAAAATGAGGGGCATCTGGACTGTGGTTTTAAAAGTCCCCTGTGGGACTGGACCCA
ATGGCTCAGATCTGTAATGCTAGCACTGTAATCTCAGCATGCTGGGAGGAGGACTGCTTG
AGCTCAGGAGTGCGAGACCAACCCTAATAGAAAGTAGAAAAAACTAGCTGGTTGTTTTGG
TAGGTGCCTGTAGTTCCTCCTACTCAGGAGGATCGCTTGAGCCCAGGAGTTTGAGGTTGC
CATGAGCTGTGGTGCCATGACATTACCAAGGACACAGAGTGAGATTATCTCAAAAAAAAG
TCCCTTCTGGACCAGGCTTGGTGGCTTATGTTTGTAATCCTAACACTGTAGAAGGTTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1018..1041, 1044..1118, 3226..3274, 4149..4247, 4383..4459
1001..1015, 1018..1041, 1044..1118, 3226..3274, 4149..4247, 4383..4456
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved