Otolemur_garnettii Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii EIF4A2
Otolemur_garnettii
EIF4A2
GeneScaffold_3821
SNORA63
4690..4817
8800
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAACCTCAGAGTGACGATCTCAGGATCATGAATCTGTAGCTAACCGAAGAGCGATGGG
AAAATCCTCCGCAAGAACCGGGTTCGGACCTTGAGCGTATATAAAACCGGTGGCGCGGCC
CTGCAGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCTGCGG
ATTATAACAGGTATGGCGGTCTTTCGGTGCTGGTGTTCTGTAGCTAAGGTCATGTGGCGC
CGGAGGGGAAATTGTAATGGATACTTTGGAGGCGAGAAGGTCCAGGTTCATGGACGTTTC
CTTGGGGTACAGTTCCCCCGTGTCCTTCGAGAAGCTTCCATGGTGGGTAAGGCCCCAGAT
TGTGTGGAGACAGGACTTGGGTGCGAAAACACAGTGGCTAAAGAGTGTCATTTCTCCCAA
AGGCGTAGTGAACTGTCAGCCTCTTCCTGGTGTGGAACACGGCAAACGTTTAAGAAAAAG
CCGTGGCGCAGTCTGCGTTCGGGAAGGGTAACGGGGTGCCGAAGCTTTATTTGGGTCACA
GCACGAGTGGGTGTCAAGCTTACGGCGGGGGGATGGTGCGGCGGCGCCGCCCGCGCGGGG
CGAAGGCAGTGGCGACGGACGGAGACCGGCTCCCGGCGAATCGTTGGCACGCCGGCGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGGCCCTTTAAACTGC
GTTAGGCGGTTCGGTAAGGGGGTCGTGGTCTACTGCGGTATTCTTGTCGGCAGAGAACAT
GGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGAGACGGGTGTGGATTT
GGAAGCTCTGGAAAGGTGAGTTTGTTCGCCTTATTTATTCCTTTGTTTTTCGTTTTTAAA
ACACAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCT
CTTCTTCGGGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATTCAGCAGAGAGCT
ATTATTCCTTGTATTAAAGGTAAATTCTGACGTTTTTAAAAACGAATTCGTTGTTGTACG
TAGACGTGGACCATAAAAGGGATAGTGACCTTTGGGGGACTAGCACCTGTTTGTATTCCT
TAAAGTGAGATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAGATACTCATTG
CTGATCACTTTATTATTTTGGGCATAATTCATGTTCCAAATGGAATACATGGTGTAAAGT
AGAAGTGACGATTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGAT
GTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTG
CAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAA
CTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAAACTGCTTGCGTGTTGCATAGGTTT
CAGGTTTCACAACTGTGAAGAATTTAAAAAGTGTAGTATAAATGGTCCTGTCAGAGCCCT
CCTTTTAATTGTCCATGCATGCAGGGAGTTTTTGTTAAAAGTTAAACAGGAACTGGGTGC
TCAGGAATGGTTTGTAGGGTAGTATACCAAAAGAAAGAGAAATCTGAAGCTTTGTGTTCA
AGGTGTACTAGATTTATTCCCATTTTTTAAGTTTAAATGCAGTTGTGCAACATGAAAACT
GCAGTGACATGTTAACATTTTGACTGTCTCAGTAGTTTGTGATGCATTTGTTGCATGCTA
CGTTTTCAAAGCTTACTGCTGTATTGGCTTTGAATAAATTCTTCCCAATAAAGCTGGTTT
TATTAAGGTCAAAACTACATAAGGCACAGTACCCTGTGAGGAAAAATCAGCATCTGCCCC
AGCTGTAATTGTAGAACTCAAGTTTTGATAATTTACACTCCTTAGTGAGGGATAACGTAG
GAAATACTAGTCCTTTAATAGCGTTACTGATAATGTGGGGTAACAGCATTCCAAGTTTGA
CAAGGCACAAGAAAGATACTAAGGGAATTTTATTTTGAAGTAGCTCTTAAGTCCTACATT
TTTAAGCTTGGAAGTAGTTTTGTGCTATGCATGCATAAAAGCTGTTGGCAGACCAGATAC
TTGCTGTTATGCTCTGGAAGTTAGTCATAGAGCTTGTAATTATATGTGATGATAATTAAG
CTTTCTGTTTTTTAGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCAACT
TGTCATGCTTGCATTGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTTCAGGCTGAA
GCACCACATATTGTAGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGGTAC
CTCTGTAAGTACTGTCTTTTTTTTTTAAGAGTAGAATGTTTTTACTGTGTTACATAGTTA
AGTTAAATAGTATTTTTAGACAATAGTATGACTTTGTTCTTAACAGCTCCAAAATGGATC
AAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAAATC
TATGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTAAGTCTGTCCCCTTAAGTGGAA
GTTTGGTTTAATGCAGGTCCTGTTACAATATAACTGAGGTGTTAATATTGTCGTTCCCCC
TGCTTAAAGGAATTGATACATAACTATCTCTGTCTAACTCCATTCCATAGTAAGACAGAG
ACGCTTGGTCTCAAACATTTATCCTTTGGGAATACTGTGAAAAATTGTGCCACAACATAA
CATTGTCAAAGGTTGTGTTGCTTAGTCTCTCAAAAATATTTTTTTTTCTTTAGGCAGCTC
TGTGACAAGTTGTGCTACATAAAACATAATCATTGTCTTGTTTTTAAGGTTGTGTTGCTT
TCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATT
CGAATTCTGGTGAAAAAGGAAGAACTGACCCTTGAAGGAATCAAACAGTTTANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGATATAAAGAAAGACTTTTTAAAAACCATAGAGGCGATAGCAGCAGTTGATGGCG
AGATGGCACTCACAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGC
ACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGATTAT
TTAGGAGCGTAAGTTGCTCCTGCTAAGGCATTTTTTATATTAGCATTTCTCTTAGGGAGC
ATTTCTGCTAGGTGGTTTGGATTGTCTGGTTTATCAGGAAGGTAGGGTAGAAAGCTGTTC
TGGAGGTAAACACGTTTTTGAGTAATTTGAGTTTTAACGGGTGAAACTGAGCAAAAAAGC
AGTGATAAGTTTGGGTTACCATACCAAATCAGTTTTCCCACTGGAAAAAGGTTGTAAATT
TTAGAAAATAGTTAACCTTGCAGCATTTGTATTTACAGTGTACAGTTCCAGAATTGCGTC
GAAATGGATTACATAACTGTTCTTTTTGTTTTATCCCTGGTGTTTACATCTGTCCCAGGC
TGACAACCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTAGTTTCACTACCCCAAACA
CAATACTGTCATCTGCTTTATAATAATGCTCAAGACACCTGATAAAAATCTCATTTTGCA
GCCAGACAAGCCTTGAATCCTTCTGGCACTAACTGCAAAGGAAGATTTTTTTCTCTAGAT
ATTGATTAGCAGCTAGAGCTCCAATTAGAAGCCTGAACTATGTAACCTTGATAAGTAAAC
AGCAGCTGATGGTTAACAAGTGGATCGTCATGTTCAGTAGCTCACGTACTGTGTGAGAAA
TAACATTCTGATTGCTGATTTCTTTTTCTTATACAGAATTGGCAGAGGGGGTCGATTTGG
GAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACAT
TGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTTATTTA
ATTCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAA
CGTGCATTGTGCTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGA
AAATACAGATTTTGATAGCAAAGCGACATTAGTCGTGAGCTCTTGTGAGGAAAGGCATTG
GCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATGGGGTCTGTAAAAT
CTTTCTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCT
ATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATT
ATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAATATAGAAAGGCC
TTTAAAATTGATTTTTTTTTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTA
TTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCC
AGCAAGCAATCATATCCTAGGTAGGGTTAAATCCCCAGTAAAATTGCCCATATTGCACAT
GTCTTAATTAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAAGGTATGTACTTTG
GTCATTTTATTTTTCTCATAAGTCCATAAACAAAAAAAGTAGGTATTCTAACAATTCTGA
GTTAACTGCTGCATCACAGTTGCACAAAGACTGATTAATTGTAGATGTTCATCAGCACCA
TCTGCTAAGCACTTATCAGCTTCCTATGACGAAATTAAAAAAGAGGGTTAGTATGTCTTG
GTGTAAGAAAATGGGAAATTTCTTAGTGTGAAGTATGTACTTACAGCAAGTTTTTCTGTA
ATGATAGACTTCTGTTTATCAGAAAGGGTATCATTTTCTACAACCACATCATGAAGTTGA
TTTACAAGCTGAGTTGCGGCATGACCCTCAATTATTAAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 2813..2858, 2946..3078, 3352..3491, 4275..4443, 4546..4655, 4968..5090, 5092..5112, 5695..5832, 5933..6022, 6123..6202, 7656..7800
1001..1029, 2813..2858, 2946..3078, 3352..3491, 4275..4443, 4546..4655, 4968..5090, 5092..5112, 5695..5832, 5933..6022, 6123..6202, 7656..7797
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved