Otolemur_garnettii Locus C17orf45
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii C17orf45
Otolemur_garnettii
C17orf45
GeneScaffold_4129
SNORD49, SNORD49
1349..1419, 1795..1865
3384
TCACCTATATGACTCCTGAGTAGTAGGCAATTATAAGAAAACTAGGGAACACGCCTGCT
TACGTGTTTAACTATCACTATATGTTTGCAGAGCTCAGGCCCCTATTCCAGCTCCCACCT
GGAGGCTCTTTATTGATATGAAGGGTAGTTTCATACTGAATGTTTCTTAAGGAGACCTGA
ACGAGTTCATATGCAGAAGGGAAAGCATCAGCAGAGACAGTTTTTTCCATCATAGGCGAG
ATAGAGCTATGGGTGGAGTCCTGTGGGAATTCGGAGGGTCAAGAAGGGGTAGAGTTTGAC
CCCAGAGGGGGAGAAGATGGAAGTGGACTCAGACAAGAGGTCTGATGGGTCCTTAACGGT
CATCCTAAAGAAAGTGATGAGGGTTGTCAGCGCGCAGGGGTTTGGGAGCCTCTGTGGACA
TTCTGAAACCATCTTGGGGAGAGACTAGCAACGCTTATTAGATTTGGAACAGCTACTATT
TACGAATGCTTGCTTGTGCCAGGGCTCTGCAGTTTCAAATGTGTTACTTCCTCTGATCTT
CAGATAAACCTCCTGGAGCGCAAGTATCTCCTTTTACTCCGAGAGCAATCCGAGGCTGAC
AAAAGATAAGTAATTTGATCAAAACCAACCAACCAGGCGGTGGCAGAGGCGGGACCCGAA
ACCCTCTCTCCCGCCTGCGCTCTGGCCAGCACGCCAGCCCCTGCGCAGGCGCCTTAGTAA
CACATCAAGGGCTTGACTACCCAGAATTCCCGGGGCCGTGGGAGAGACCATAGGCCCAGT
AGGAGGGGGAGCCCTCGAGTCTGCATTGTTAAATGGGCTGGAGTTCCCGCCAGTCCCCCC
TGCTATGAATAATGGGATGTCCCAGCTCTTTAAGTTGTTGGGGCGCCACACTCCTACCCC
TTTCTTTGTAATTGAGCGGCCGAGGTGGGTTGTTTTTGCACCTGGGGCTAGTAGCAGGCG
ACAAGGGCGAAAAAAGAGCTAGAGTTTTCATCTCCGGAGGGGTGTTTCCGGGAGATTTAG
CTGGAGTGCGGAGGTAGGCTGGCGGCCGCTGTAGCGGCGTCTCCCCGGCACCTGTGCTCA
CGTGGGCTTTGGGGCAGGCGCTGCAGCCCGGGGTTGGAGCGTCTCCCTGGGCCGCGCGGG
GCAGGACCCAGCCGCAGTGGGCCGAGGCTCATGGTTCTAGTGTTTTCCCGGGAGGGCCAC
GAACCGCGAAGGCCGGGACCCGGTTTACCCGGCCCTTAGTGGAAGTGAGCAAACCTGAGA
AGCGGCTGAGTAGGCTCTTCTGCTGTATACCCGGAGAGTACCGCACGGGGGTGCGACTGC
AGTGGAACTAGAAGGGAGACTTGGTCGACTGTCCTGATGATACTAGTAATAGGAAGTGTC
ATTAGAGGCGGTAACAGACGACGTTTATGCCTGTCTGACTACAGTTGCTGAAACCTCCAC
AGTTTAATTGAACATTACTGCTGGAATCTGCCCTCAGTTTTTGGCCTTATTCCGTTTCAG
ATGCCATACTCACTGCAGAGTGTTGAAGACAGCGTAATTATAAGGTAGGAGCTCAGTCTG
GGCAGGGTTTAATATGTAACTTATCTTAAATGCACTGAAAGCGATGTTTTTACAGTTGTT
ACACGTGTCCCCATTGCATGGTGTGAAGCAGCAGCGGAACTGCGTCTAAACCAAAGTTAT
ACGTGAATATGGAAACAGCTTCCTTAAAAAACGTCGCCAGTGGCTGTTTTTAGTGGTTTC
AGACAATGGTGGTCTCTGGTTGTAGAAGTACTGGGGAATGGTGAGGCGTTTTGACTGCTC
TGATGAAATCGCTAATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAACTATTACTGT
CTGACTGCAGTCAACAAGTCCTCACCAGTTGCTACTTCCCAGGAATGAATTTGTCTGAAC
TGTGGCTTAATTGCTATATTCATCCAGGTTGCAAATAAGGGAAGGATTACCAGCATGTTC
GGATGCTGAGTACTGGATCCAGGAGCATTGGCCTTCATGAGGTACGTTTTATTCTATGCT
GAGATAGTGTTTATCCCATCCTTGAAACAAAAGTAGTCATAGATTTGTGAAATTTAAAAT
GATATGACTAAATAGAGGTTACGACTTTAATAGAAACTAATTAGTACTTGGATACTTAAG
TAATTTACCAAAATGGATCTTTAAAAAAAGCCTCCAAAAAAAAATGCAATCGGTGTAACC
TGGTTTCTTGTATCCTCAATGAATATTCCGCCCCCCCCCCCCCCCCCAAAAAAAATTGGG
AAGAAGGAATTATATTTTGTAGGTTTGGAATGAGGCTTCTAAGAAAGTCTCCTGCCCGCC
ACTGCAGGTTTGATTTGGGGGGGCTTCTCCCTTTCCAGGTTTTGAGAAACGAGTGCTTCA
GGGCTAAAATGAGAGCTGGCTAGCCATAGCAGCTCAGCCCCAGAAAAAGAGGAAAGCCTT
GATCTGATCCCCACAGTAGCATGAATAAACAGCTGATTTTGTTAATTGATTTTAAGAAAA
GGATATCAAATGATGAAATCACCCCAAATAGCTGGAATTACCGGCAGATTGTGTAGTGGT
GAGCCTATGGTTTTCTGACGATATCTTTTCTTGTGCAAATGGCTGTTGGTTAGAGCAGGA
AGTGAAATTGAAATTCAGTTTCTTTGCAGGCTGCATCTCCAGAGGATGGATGTCAGTCTG
TGAAGGACCAAGAGCTGCTATCAACTTGGATTCTGAAAACCTAACTGTTGAACATTTGGT
GTAGAAGTATGCTTTGTGTATCAGGACATTCTCAACAAAGCTAAGAGATGTATTGAGCAA
CATTTTTCTGTAACTGGCACATTTGGTATCATTCATTAAATTTCTAGCAATGTCCCTTGC
CAGCCTGTCCAACAGGAGCTTCTTATACTAATTGGTTGTTATGTTGGGAGCTAGTTATTT
AAAATGGTAATTGTTAATTCCCCTCGAGTAATGTTTTCATTAAGTTCCCGTGAACTAATA
CTGTAATAAAGGATGGTCTTTGGTATTGGTTGTTACAAATGTATATTTGAAGAAAAAGTA
AATTTGACTACTGCTGTCAGGTATTTGCAGTCCAGCTATAAGCACTCAAGCTTGTAAACT
TCCCTAAGTTTTTTTGCTCTTAACAGTTTTAAACCTCAGAGGGCAAAAATTCCAAAGCAT
TTAAGGCATAGACACAAATGGTTCTAATTCCTGCTGCCTCTTGAGTTCTGTCTCTTTGCA
TAGCTCTGTTTGATCTCCTTCAGCATTTAAATTTCTTGTAGCCAAAATCCTTAACAGTAT
GCAAGGCCCCATCTTGCTGCCTGCCTGGTCTGAGGCCCATCAGGCAGTGCTTCCTTGCAC
TGTTTAATGACTGGTTCCCACAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1041..1058, 1060..1159, 1161..1176, 1179..1197, 1202..1204, 1206..1225, 1227..1254, 1258..1261, 1264..1265, 1500..1543, 1947..2004, 2379..2384
1001..1033, 1041..1058, 1060..1159, 1161..1176, 1179..1197, 1202..1204, 1206..1225, 1227..1254, 1258..1261, 1264..1265, 1500..1543, 1947..2004, 2379..2381
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved