Otolemur_garnettii Locus ITGB8
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ITGB8
Otolemur_garnettii
ITGB8
GeneScaffold_5228
SNORD56
45590..45660
81761
TCCCGAGCCCCCCGGGGGCCGGGGCAGGACCACCTCTCCCCCGCCCATTGCCGGCTTGC
CTCTGTCGCATCCTCACCGGGTGCACCCCAGAGCGCTCCCGCTGCCTGGGCTCTGGGCAG
CAGGACTCCTGAGCCGCTCACTGGGGCCACAAGGACAAGGTAGGAAGCCCTCGCCCCTCC
AGGCCGGGCTCCCGCACCGCCCCCCAGCCCGGGCTCTCCCCTCCCGCTCTCCGGACCGAG
AGCTCCACTCCACACGGGGCACGGAGCGGCGATGCCTCGCTGTGTGCTTGCGGGTGCCGC
CGGCTGCTTCTAGGGCTCCCCCAGAGCCGCCTCCCCCTGCTGCTGGCACCCCGAGCTTCC
TCCCTCGCCAGCCAGGACGCTGCCGCCTTGTCGCTGCCCGCTGCTCCGCTGACGAGTCTG
CAAAAGTGCAACTAAGTGGAGTTGGCCTCTCTGCCCACCTGTGGAAGAAGCTCGCGCCCA
TCGATGCGCCATCGACTTTTTTTCCCCTTCTGCCTTGCCGGCGTCCACTCCCACAGATGC
AGCATCACCCAGTGAATGTACATTAGGGTGGATTCCCCCCCAGCTTCTGGCTTTGTTTGC
GTTTGATTGTGTTTGGCTCCTCGCTATGGCTGATTTATGCAGCAGAAACACCACCGGCCT
CAGAGAAACAAAAGCTCTTTTCTTTGTCCCGGAGCAGGAACAGAGCGTTGGCATCCGACA
CCACCCGAGCCTGCGGCAACAGAAGGAGGTGTTAAAGCGGAGCCGGCGGGAACTGCCTGC
CAAGGGTGGAGCCCGAGGGGCCCTTGAAATGCCATAGCGACCCTCGACCCGCGTACCTGC
ACCGCTCACTCGGAGCCGCGGGGTTCCGCCTGCCGGGCCTGCGGGAAACGTCCTAGCGAC
ACTCGGCCGCAGGCCCCGAGGGTGCGCCCAGGAGGCGCAAGCGCGCGTCCTCCGTCCGGA
AAGCAGCCAGGCGGCGGGCGTGGGGCGGGCTGCTTTGCATTATGTGCGGCTCGGCCCTGG
CTTTTTTTACCTCTGCGCTGGTCTGCCTGCAAAACTGCTGGCGAGGTTCTGCCTCGTTGC
TCCGGGCGGCCTGGGTGTTTTCACTTGTTCTTGGACTGGGCCAAGGTGGTAAGTGGTTTT
GTTTTGTCTTGTTTTATTTTCTTCTCTTCCCCAAAGGTCTTGGGCTGGAGCGAAGATCTG
CCCCTCCAGAGCATCCCGGCCAGGTAAGTTACGTGGCGGTGCCCGCCTGTCTGCCCTGAG
ACCTTCAAAAGGGCGACTGTGTGGTCTCATCCTCCATCTCAAGGCGGTCTTTGAGAGGCC
AGGTGTCAAGCATGTCTGCCCGGGAGTGATGGCAATAACTATTCCGGGAGTCTCTGGTGT
TGGTTCTGGATGTGGGGAAAGCAATAACAGAATGAAAGTTTGGAAGACAGGGGTTGTCTT
TACATAAAGCATTTAGGAGTTCTGGTCCATTCTTGAGGCGTCATCTGTGCAGAATGTGCT
CCCCACTTTCTAGCATTTGGATCTACCCCCCACTTCATTGGCATTTGCTCCAAGGATTGG
TGGATAATCTGGTTAGAAGAGACTTCTGAGTCCAGAAAAGAAAAAAGCAACATGCGAGTT
CCTTCTATCCTAGTGCTGAGTCTGAATGAATTAAACACAATATCCGTGCTGTAAGTCGCC
GTCCTTTCAGCTTTGTTAAACATAAATAAATAACAAGCTTTCCTAGCTAAGTGATCCCTG
GCAAGATCAGTCTCTGAGACTGAGGAGCAGCGAGAGCCCTGGGCAGGACTGACAGCTTTC
GGTCCAAGCAAGCCACTTCCTTACGAGTTACCTTCAGGTGGAGAGGTTACCTCTTTGTAA
ATTTTATGGTGTTCCTCTATAAAATGAGGATCATAATTCCTACCTTCCCTAAGTCGAATG
AAAATTTCAAGTTAATGCATGAGAGGATGTTTCAGGACTTTTGATTTTTGTAATCAAAAT
CAAAGGTAAAGTGGTAGCATTGGATGGCTACCAAACGTGAAGCTCATCCACATAGAGGGA
ATTCTTACAGATTTCCAATATAGGCCAAACATTTACTTTTGCCAGTACAATGACTATTGC
CCTACTTTTTTAAATGATTATTTCACTTCTTCTCTGCTTGGTCACTAAGCCTTTACATTC
TATTATATCCTTTCTCTGACCTCTCAGGCTCAAGGAGAGTTTAATTAATAGCTGTAATTG
TTTTGTAGACTAAAATTTACTCCTACGCTTTGGATTGATGTACCAAGTTTCTGCCTAAAA
CAAATTAAAACAGTTAAGTCATAAACATAGCGTTTAGAATGGAAACATCCAGTGAACTTC
ACTTAATTGTTGCATATATAGTTGTCTAGTATTTGTTTCAGGAAGATTTATTCAGTTCTG
TGAAATGGGGACAATTAGTGTAAACTTGTGGTTATTTTTTTGGCTTGTATTTTAATTTCA
AAATAAGTGAAACTTAAGAGAAAGGAAAAAGTAACATTTATTACCAGTTATCTTTAAATG
GAATTTGCATTGCTTGTAGCACATTTTCCACCAAGCATAATTCCATAATGAATGGTTTTT
CTACATTTAGTAAATGCACACACATTAGTGAAATGATCACAATTTGTGTCAACAGAGTAT
TTTTTTTCTCAATGCATAGGCATAAGACAAAGTCCTACTTGCCTCTAGAATGTACTAATA
GTAGTAAAATTTTTAAATATTCATCATGCCTGTGGAGATTAGTCAGGTTCTTGTGAAATA
GCATTTTGTATTTCCATCCAGAGACTGTAACTGATTTGAGGCAAATATTATGAATGGGCC
CCTCCTGCACCTGCAGACCTGAAAAGCAAATGTTGATCTGAAGTCAGAACAAGGCATCCT
TTCCCAGTCTTTGTCAATGTAAAAAATTTAAATATAGCCAGTACAACTCAGAAAACTAGA
GAACAGTGTAAACTGTTGTACTTTTGTGATATAGCTACAAGTCTCAAATTATATGTCTTT
ACAGTGCAAATTAGATGCTTCAAGCAGAATAGAAATTTAGGTATCAGTTACAAAAGAAAT
CTTGTTCCCTCTCTCAGTAGTTCACACCAAGAAAACGTTGAGGGCAATAAAGCCATCCCA
AAGAGACCATAACATGAGCTGCACAAGAACAGCATGACTTGGGATTAAATTCTTGAATTA
GAATGTATAGGTCTAACCACCCTGCTGTTTCCACATTTGCATATTTGAAAAGATCTTTGG
TTATATAAACTTTTATATAGCAGTATGTGTGACACATTTCAGAAATCTCAATTTCTTTTA
AAAAGTGGTACTATTGCAATGAAATGACACCTTCTCTTAGTAGGTATTCAGCTGTCAGCT
CTTTCTTTTCAATAACAACCAACCGGATTCATATTGTTTTCCTCTAAAACATATTTCACA
GCACAAATGTTCTCAGAATGTTTTTATACTTACCTCAAGTAATTGCGTATGTAAGAGAAA
CAAGGCATGATTTTAAAAATGCTGTTTCACAGGCCAATCTTCCAATGTATTTTCATAATA
AACATCCAAATTAACTCTAGGTTAATGCAGCTGAGACACTTAGTGATCAGTCAAGAAGTC
ATGGATTCTTGCCCTCTGTGTGAAAGCAGAGTGGCTGATAGGATTTGAAAAATGCTGGAA
AGATTCCCATACCCCCAAATACCTGCTTCTCCTGTTAAGAAATTATCTGAAATTTCACCA
CCTAATTGATTCCTTTGGGTTAAACGTGCAGTTGACTCTATTTTTTTGTTGTTAATTTTT
AACATTGTATTATGGGCATTTTCAAACATGTAACAGAAGAAGCGAGAATGGTACAAGGAG
CTGCCGTATCCCCATCACCCAGCTTCTTTAACTGTCAGCTCAAAACTATCAACCTCTTAC
TTACATCTCTTCTCCCATCCCCACCCAGTTCCCTCAAGTAAATATTTTGAAGCAAAACTC
TCAGATCATCATACTTAAACATATTTCAGCAAATCAAAATTATTACTACACACTGTTAAT
CCGAAAGTGTGAGTTGTTACAGCCGGAATATGTGACACGAGAATGTTGACCGTCTTTAAA
GGGAGGAAGGACAGAAGAGTGAGAAGCAAAGAGAGACGAGGACACAGTTTCAACCATTTA
CTTTCAATGGTTCTATGACCGTGCCACTGAAAACAGTTTCCATTACAAAGTATGCAAATG
TAACAGTTTTTGATATAAGGTATGTGAACAAGAAAAAATAACACAAGTACACTTTCCAAT
GCATTGCTTTATCCTGACGGAATTACAGCAGGTATATGTTGTTAAAGGTTCAGTTTTAAG
AATCCACCCCTCCTTGTATCAGTCAGCGTTCCTTTTCTTTACTAGATCATCTGTTCTATG
GCAGTATCTATATAGGCTACAATCTCTCTCTTCGGTTTTTAGCTGCCCTTTTGCTATAAA
AGTCTTTGAAAGAATTTTCCATAACTCTCGTTGTCTCCAATTCTCCTCACCTTCTGTTTG
AATCCACTGATGCCAGGCTTTCTTTGTCACCTCTGTAGTTTCCCTCTGTTAAGACTGGGA
TGCCCTCCTGTTGCCAAAGCCAATGGCTGATTCTTAGTCTTCATCCTGCTTAACCTATCG
TTTTTTGGTGGGTTGACACTGTTGACCTTACACTCCTCAGAAACATTTCTTCCCTTGGTT
TCCTGGACCCATACTCCCTTGGTTTAAACTTCTCCTCCTCTGATTTCCCAACCTTTGAAT
GTAAGAGTGGCCCAAGATCCAGTCCTCAGAATTCCTCTTTTCCATACCTACTGAGTCAAG
TGGGCTAATCCAGTCTTCATTCTTAAACATCATTTCTGTACTGATATGGCTCAGCTCTAA
ATCTGAGGTCAGCTCTAGTCCTGACCTTTTGTCTGAATCTCCAGTGGGTACAGCAAATTG
TGCAACATCTCCACTGAGTATCTAAAGCAAAATGAACCTTAGTGTATTCATAACCGAACA
CCCCAATCTTCTCACCCAGGTTTCACCATAACACTGAGAAAAGTAGAAATACAGTCCTCA
TTTTTGAAACGAGAGGACTGAAGCATGTGGGAGATGAATATTTTCCCAGTGTCACTTAAC
CAGTAAGTGGAAGAGATGGGATTTGAACATAGCAAAGCAAGCCTGAAATAGCCTTCATCA
TCTGAGCTTCCTAAAAAGCCTCCTTCATGTCAGACCTCTGTCTGCATTTTCCCTCTATCA
GAATCTTCCCATAGCTTCCCACTGTCTTCCGTTTCCTTAGCCCAGTATCCAGCTACTTCC
CAGCTCACGCGGGTCTAACCACGTGGTGCCTTGCTGATGCCCCGTCTCCACACCTGCCCG
TGACCTCCTTGAGTGGCAAAGCTGCACCTGTTGTTTTTTGTGTCTCTAGTGCCTGGCACA
CAGTAGGTCCTGACCTGATAAGTTATGTGAGTAAATGACTCCATGGATGACATAAGAACA
ACAGGGAGCAGTTTAAAATTGGGCAGCTCAGCCAATAAGCCCTAATCAACTCTAATCCTT
ACTAGAATTTGAACTTAGGGAAATAAAGTTTTCTTTCAAAAGTGGGTTATGCCATAAAAG
ACATTTGTTACTGCTTCTCCAGTCCACTTCAGAAAGCTGTCTCTTGACCTTGTAGGCAAA
GCTGTAGCAAAGATTAAAAGCTGAGACTTAGTACTCTTTAATCTTATTTTTTAAAGTTTG
TTTTGCTTTCAAAATTTCTGTGACCATTATTTTTATTGTTGATAATAAAGCGCAAAAAGA
AATCCTGATTCTTCACACTCAATGCCCGTTTTATTTTATTTTGTTTTTTAAATTTCCACC
TTGGGAGCGTAGATTTCAGTTGCCCTGAATGTACATGCCCCTCAGTATTAATTTTAACAT
AGATTTCTATTTAGATTACACACACTGGAATTTGTAGCCATTTTTAACCAAATACTTTAA
AAAATAACAAGAAAACAAGTATTCTAACTCATTTAATCACCATCCAGCCAGACTTTATAT
TAAAGCACCTTAAAGCTGTATTGACAGACACTATGATGACTTCTGGAATTAAAAGAATGG
CAATAGTTTAACTTTGTGGAGTATTTGCAGTAAGCAGGCACCCTCCTGAATACAAAATGG
GAAGATACATCCTTTAAGGATCACATCTCTCAGAGTTGGGTGCTGTTATTCCTGTTTTAT
AGGTAAGCAAACCAATTACGGAGGAATTGAATGAGTAACTTTTCCAAGATGTCTTAGCTA
ATAAGTAGTGGACACAAAATTCAGACCTGTGTGGTGTGAGACAGGATTCCCAGTCACCAT
TATAATTTCATATACTGCCTGTATGAGTAAAAGGAATCCCTACCCTGGGCCTTGGAGGGT
CCAGCTATGGCACCTCTCTGCCCATGGCCCCGACTACAGGCAGGGACGCCATGTGGCTGC
CCCTTCACATGTGTCACTCTCTGTAGATCAGCTTCAGACGTCTCAGACAGCCCCAGGCTA
CTTTCAGGGTCTGACTTCTGCTGGTCAGCTCTGCTCTCTGCAGCCTGTGTGCTAAACTCT
AGGTGAGGGTGGGCAAAGGCGAATGATGCTGGAGAAGAGAACAGATTTGGACCTGCAGGG
TGAGTGACCATGCAGGTGAACACAGGTTACTAGTGGCACAGAGCAAATGTAGACATTGGA
GAGAAGGAAGCGGTCACAGCCTGGAGGGGCAATGCTTCCTTCACACACTGCCGGATTCCC
AGACAGAAATCCAAAAACTTGGGAATGCTAAGCTCAGACCCTAGCCTTCTAGGTCATTAT
TAACGTGCATTTGTCAAGGAAGGAAGATGCGCTTATTTTGCCTACTGGTTTCTGAACCTG
GTTTGTAACTGTTAAATATTTAGTTTTGTCCTGCCTGCTGCCAAGTGTACCCTTGGCTCT
GAAAAAGTTCAGGGCAGACTCGTCTATTAGCTTAACTATTACTGGGGAGAAGGGTGAACA
ACAAAAGCCTCAGAGTCCATTGTGTAAGGAGAACTACGCTGTGTCAAAGTGATTTTTTAT
TTTGGTAACTAATCCCTTTTGGTAAGTTCCAAGATGTATAGAGATTACACTGAATTCTCT
CTCACAATGTTATAGTAAGAGTCCCCTGTGTCTGTATTTGTAATTTAGTTTTCCTTTTTA
TTTTCCCCTGTTACAAGAAAAAACACTTTACTGATATGAGTAACCTAATTTGGTCACATT
ACTCAATATTTAACATCTATAAGTAAATGGATATGTAGGGAGGAAAAACAGCCACACGGC
CTTCATCAAGTAAGTGGACTATTTTTTCAATTTAAAATCAATCTTAATGTGACCTTCTTT
CTCCTTTTGTGGTAAGTAAATCAGCTTAATTTACACACTAAAATAAACATAATGAAAGTC
AAAATGGCTTTCACTGGGATCTCATAATGTCATGAAAACAGTCCTATCTTTCAACAGAAG
TGCTGGGATAAATTCTTGCTAAGAAACTATGCGTATTGAACAGATGTGTTAAAATTGTCT
CCCCTGAGTTATTTAAAAAGGCCTCCAACTAATGCTAGTTTAGGAAATAAGACTAGGGTT
ATTAAATTAAAATTGCAAAGTTAAAGTGGCATTATCAGATATATTTTCTTAAGATGACTT
TAAGAGTTGCCCTTATTTTGAGTGCTATTATCCAAAGTACTAAAAGTTTATATTTTGAAA
CAGCATATAAGGATTTTCAATGTGGCCTTTCCTGCTGACCATATCAGTGAGCTGACCATC
ATTGTTACAGTGGTTTTAGAAAAGACATTTCTCTTTGCCAGGTGTTTTTTGTTGTTGTTT
GGGGGTAGTGTAATGGACAAATACTGTTAGATTTATCAAAGACAGAGTCTGTTACCATTC
CAGATCAGTATTGGTGCAGTTTGTTTATTCTAGAGGATTGCCAAAAAATTCTTAGTCCCT
AGATAGTTCAGAGTAAGAAACCAGAGTAGCTGTCAAGGCCTAGTTCAAGCCAAAGTCCAT
GGGAGAGGCTGAGCTCAGAAGCAGGAGGAAGTGCTGGTAATGAGGACAGGAGGTTGGAAG
ACTGGAAACATTTCATCACTGAAGATTTGCACCAAATATGTCTTATTAAGTATGTGAGAT
GTGCAGTGGAGTTTGGCCAGGGATGTTTTCATGTTTTCCTGATTTGGGACCCAACTTCCT
TTTAGAATACAAAGGACTGATATTTCAAGATCTTCCAGTGGTCAATGAAATCACAGTTGA
AAATACTGTGGTTCCATGTGTACGTGCGGTTCCAGGGTTCTTCCCTTGGAATTAAGCCAC
AAACATTTTCCTAGATACAAGCATTTTCCCTGCTTTTAGTGGGAGCCATAAATTTGGTAT
AATTCCTTAGTAACTATTGGAAGTAAGTGGAGAGAGAGGCTAAGTTGAATGCTTCATCCT
CATGGAATGAAAGAATCCCACCATGTAAAGGAGATTTAGAATATAATGAGGTCAAGCAAA
GAAAATAATTAAAGAGAAAAATTCAAAACTCTTCAAGGACTGGGTTAAGAAGATAAAAGT
TAACTAATGCCAAACTAAGGAATGTCTTTCCTAATTGTCTGCTGGAGAACGGCTAAGAAG
CTGGACGTTTATATGCCTGGTCATGTAAGGTATTCATTGACTGTAGGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAAGAAAGTTTAGGGATGGGCTCTGAATT
GCTGGTAGACTGGCTGGTTCTATTTGCGAAACAAAGGACACCATTGTAGCAGACCTGTTT
TGTTGGCAGGAAAATTACAATGACCTGGGTTTGGCTGGTCTCTTTCTTAGTACCCTGCAT
ACCTCCCAAGGTAGCTCTCCGTCATCTTTTCTGTGTTTGGTTTGGATTTCATGGTGAATT
GAAGATAATTTCATCATAATTTACTAAAGAGAACCCTTAAGAAAAGACAGATGGAGGCTA
CCTTCCAAGAAAATTTATCAGGAAGGTGCTATCTCACACATGGGCGCGCACACAGACACA
GGATCATCCACTCAAGAAGCGAGTCACAGTTTTAGGCATCTAGAGTTTTGGTTAAAATGA
TTTATTTTGATGAGTGTTTCAATTGTAACCAGCTAGAACAAGAGCATTAAGGTGAAGGCC
AATAGATGCAATTTCAATGCCAGTATAATATCAGAGTAACCTCATATTGCCTCTGGAATT
GGCAATAGAAATATGAGGACTAAATCTTATTGGTACAAGACCTTAGCTCAGAGGATTAGG
CATGATTGATACCTTGTGAGGAATCCAAGGCCACAGGATGCTCAGTGACATCTGATGGGA
CTGTAATGGCATGAAGGTATGGGAAGGGGCTCCTGAGAACATGTCTGTGTCCCACTGCAA
GCAGCACAGAAGAGCTGGAGAACCAGGCCCAGAGCACCCTGGTAGGGGCAGATGATGCTA
GTAGACATGTCCAGGGCCATAGACATGTCCAGGGCTAACCATGGCTACTTAAAGGTCAGC
GGAGCATTGATGCCATAGCTCACTGTTCTCTGAGGTGGGATTGTCTGGCAATAGAAGTGT
AGGAGTCATTGACTTATGGTCATTACAAAAGTCAGACATCAGGACTTTATGGATTAAATT
CTAACTCTCAGATATGAGTTGATTTCAAAGCTAAAAAAAGACAAGTGGCACTTCTCACTG
AAAGACTTGGCAGAGCAGAAAAGTCAGTTAGAACAATCACTGGACGTGAAGTCCTCATCT
TCACAGGGGAAACTTCTCAAATATTACATATGATGTTTTCTACTATATTTTTGAATTTAC
CTTTTTATTTTTTTTAACAAAAAAGCCCATATGCGAAATGAAGTTATTCTTGGGCATTTG
GACAACCTGGATGCTTCTATCCCTATGTTAACTTCAAGCTCCAAAATGCACCAGGATTAG
GCCTTCAAGTTCTGTAAGGCTGGACCTACCAGAGGACCTACCAGACCTAACACACTTGAC
GATGTTTATTAGGGGTCCTTATTGACAAGCGAAGAACTAAATATCCAGTAAATCCCCAGA
AATCCAGGCTCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCCACGTACACCTAAGGT
GGCGGGTTCAAATCCCCAGCCTGGACCCGCCAAACAACAATGATGGCTGCAACCAAAAAA
TAGCCGGGCGTTGTGGCGGGCGCCTGTGGTCCCAGCTACATTGGGAGGCGGAGGCAGGAG
ACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTTTGAGCTGTAATGCCATGGCACTCTCCCC
AGGGGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAATCCCCAGAAATCCTG
AATTGCCTTGCCTTTTGGAAGCCCACCTTTCAAGCCTGGTGACACAAATTTCCTAGGACG
AATTTATACTCCCAAACACTTTACACTTAACAGTGCAAACTCTCCTTTCCGTATTTTTTT
AGGATATTGTACAGTAGGTTGCCCAGAATGGTCCAAATGACTTGGTTATAGAGGTCCAGG
GTATTGGATATTGTCCAGATAAACAGGGACCTCTTCCATCCAAAAGATCACGGGATATGT
CACATAAACACTGGGAGACTGTCAGGGAGTCTGGGGAGGTATTGCCAATAACTTAAATAC
CCATGGCATATTTGGTAAAAGATTGATCATTCATTTATTTCCCTAAATTGTTAGCATGCA
AAGGTGAGATGTGGTGGAAATCTGGGTGCTTCAGAGTTTTCCAGGAGGCAAAAAATTAAA
GGCCACAGGTACTCATGCTGCACAGGAGAGCCCCGAGGACGCCTAAAAACACAGCTTTTA
TGAGATTGGTTGTCTAAATGGTTGGGAATCCAGACCAGAAGGGGCAGATAAATGACTATC
TCTGGAATCCACCACGGATTGGAATGTGGTCTGACAAGTTGAGGGGACATCCTATAGTCC
CAGACATGTGAGGGAGGAATTCATCCAAACAGGAGTGATTGTATATTTTAAAAGGGAGTT
TGGGAGTCTTTAACAGAAGTCTTAGGGTTGACCCTGAAAGGGGTTAAGTGTTGGAAGACA
AAAGAGGCCTGAAGCCCAAGGAGAAACTTAGCAGGAAACAGGGGGCCTTGGGCTCAGGTG
TTGTAGATGGGGCCTGAAGTACTGGATGTTGGAAGATAATTTTGTGTCTCCAAATAGGCT
GCTGCTATTTTGCCTGTTCTTGTTGATTCAGCTGCAGGGGCTGACTCTCAGTAGCAACCT
AACGACATGGTGTGATTTTTAACAGGCAGCATGTATTTGGGAGCCAGACAATGGAGATGC
AATCATGCAATAAAAGGGCCTGGGAAGTGCTTTAAGGAAGTTTTCTCTGCCCCTCCTGTC
TCCCCTTGAGGTGACATCCTTCTGTTATCTGCTGCCTGCTCCTTTTTATAGCACACTTGC
TAAGGTTCTGCCTTATGTCAGGTTTCACTTCACAAAGGCAGGTACCCTGTCCCTAAGACC
CTGCACAGTGTCGTGACTTAACTGCAGGGATTAAATAATTAACAAAAAAATTACGGATGG
AGGAATGCCATCAAAATTGTTACCGCTTCAGAAATCCTTAAATTGAAATTATTTTTTTCT
TAACTCTCAGATGATAATGTCCTTCCTCTTTTCGCTAAATCTTTGCCTGTTTTCTTCTTT
CTAATCAAGTATCTTTTAATGACACTGGCAGAGCTAGCCATGGGCAGGTGAAAAGCAGTT
CCGATGAAACCCTCGTTACTTAGAATACATGTGAAAAGTAGTATTTTAATGAATTAAATT
CTATGGTCATTCATAATCTGACTCCTACTTTTGAAAATCTTTTTTTCTTTTTTGAGACAG
AGTCTCACTTTGTTTCACTCAGTAGAGTGCTCTGACATCACAGCTCACAGCAACCTCCAG
CTCTTGGGCTTAGGCTATTCTCTTGCCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGCTTTGTGGGTAACAGAGGAAGGTAGAGAGAAAAGAGTTTGTCAAGTCAG
TATGACAAGACACTTCATAGGTTGGAGTGATACCAGATTTTTGACTTTAGATTTCCAGGC
TCTTGGTCTTGACCATTCGATGAATGAGTTGACGGACCATAGAATGAACAGTGAGGTTTT
ATTTACAGCTTAAAGAACCAAACCGCCTTGCAGGGCAGGATGTGAGTGTTACAACTCTTA
TGAAAACAAGTCTTACAAAGAGCCAAGCCTCTTTGTAGAGCAGGATCAGCAGAAGCATTA
CAGCTCCTACAAAGGACCGAGCCTCTTTGCAGGGCAGGATCAGCAATAGAAGTGTTACAG
CTCCTACAAAGGACCAAGCCTCTTTGTAGAGCAGGATCAGCAGTAGAAGTGTTACAGCTC
TCACTCTTTCTTCCTGGAAGTTCTGCAACAGCTCACTGAAGTCTTGTTCTTCTGCTCTAT
CTTCCTCTCTCTCAGTCTGCGACTATCTGCAATGGTCTTGCTTTTCTGCTCTCTTCCTCT
CTGGAAGGTCAGCAATGATCTGCTCCTAGGCTCTCTGCTCAGGGGTTTATATAGGGGCAG
TTGTCCAATGAGCTGAGAGCTTAGCTGATTGGTCTATAAAATAGACCAGTCAGGAGCAGG
ATTGAAAATGGACCGATCAAGGATGCACTGGAGGAATCGCCAGTGTTTTCCCCTGATCAG
CCTGGTCTTTTTTGTTACTGGAGCCTCTGGTGGGAGAGGAAAGCTCCCCCTTTGGCTCCA
GCCTGTCAGTTTCTGTGCCAGCTGCTGCCAAGGCAGAGCCAGCAGGTCCTCTAGCGCCGC
TCTACTGGAGCCTCTGGTGGGGGAGGAAGGCTCCCCCACTTGCTCCAGCCTTCTGGTTCC
TTTGCTGGCTGCTGCCACCAAGACAGAGTGGCAGGTCCTCAGGCCCTGCTCGGCTGAGCT
GGCTGGGGTGCCACTTTTCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCATCCTGCATATCAGATATTTACATTACAATTCATAACAGTACAGTTATGAAGTAGC
AACGAAAATAATTTTATGGTTGGGGGTCACCACAACATGAGGAACTGCATTAAAGGGTAT
TAGGAAGGTTGAGAGCCACTGCTCTAGATGATTAAGGTAATTGCTTGAGGAGATACATGA
AGAACTGAAGATTCAAAGATTCTACCTGAAGTTGCTACAAACCAATAATGCTTTGGCAGT
GAAGGGGTTTAGAGAAGACTCTCTAAATTATCTAATATGTGTACATCTCCTCTCTGGAGG
AATTGGCTTCTTACTAAATGTATATGCATATGTGTGAAAAATTACACACTCATGCATGAT
GCAAAACTAAGTAAATAAAACAAATAACTAACATGTACCAAATAAAAAACACCCTCCTGA
TGACAGTGCACATTTTATAAGTATTTAAAAGTAGAGAGATCAGCTACAAAGTGAGGCTTT
GATGGTGGGGATGTTGCGTAAGTGAGATTAAGTATCTACATGGGACACTGAAGGACGGGC
AGGATTGTAACAGAGGCAACGTGCAGGGTGGCTCTGCAGGCAGAAAGGGACATATATTGA
CCGTGGCGTAATGTAGCAGGGGGAGAGGAATGAAAGAGAGAGCTGTAGAATTAAAAACAG
GTAAATTTATTGGACCTTTATGTTGTGGCATAAATGTTTGTGTTCCTGCAAAATTCATTT
GTTGGAATCTAGTCCTCAATGTGATGGTATTAAAGGTGGGTTCTGGTGCACCCATCACTT
AGTGGCAGGGCCCTGGCCACATACACCAAGGCAGGCAGGTTCAAAGCCAACCTGGGTCAG
CTAAAACAACAATAACAACAACAACAGAAAAATAGCCAGGTGTTGTGGCGGGCACCTGTA
GTCCCAGCTACATGGGAGTCTGAGGCAAGAGAATCACTTGAACCCAAGAGTTTGAGGTTG
CTATGAACTGTAACACCACAACATCCTACTCACAGTGACAACTTGAGACTCTGTCTCAAA
AAATAAAATAAAATAAAGGGGGGTTCTTTGGAAGGTGGCTGTGTCACGAAGGTGGAACTG
TCATGAATGGTCTCGTTGCCTTTATGATAAAGACTTGAAGGAACTTGCTTGCCCTTTTGA
CCAGGTGAGGGCACAGTGAGAAGCCACTGTCTGTAAGGAAGAGGCCCTCACTAGTGGCCA
AATCTGTTGGTGCTTCATCTTGGACTTCTCAGCCTCCAGAACTAGAACCGATAAATTCTG
TTGTTCATAAATTGCCCAGTCTAAGGGATTTTGTGACAGCACCCTGAATAGACTAAGACA
TATTACCACTCAGAGGGTAGAAACCATCCAAGGATCGAAGAGGGTGTTTTTTTGTTTGTT
TTTGTAATTTGATTATTTAAAAGGGCAGTCATGTGATCACAATTTAAAGAAAAGAATCTG
GGCAACAGTGTGTATACTTATTTCTAGTGATAGAAGCTATTTGCAGGAGACTGTCAGAAA
GTTTGTTACAATAAAGCAAATACTAAATAATGAGGACCTAAACTAGGATGCAATCAAGGG
GACTGGAAGAGGGAACAATGACTGCCAGAGATAGGGAAGTAAAAGCAAACGTTCTTGGTG
AACTGGCAGGTGGCTAGGACTATGACTATAGTCAAGATCAAACACAGAGATTCAAATGGA
AAAATTCAAAACAGGAAAACAGTATAAGTAACAGAAATAGATCTTTCCAATCAGAAGGAG
AAACATAATTATGGAGACTTTCAGATTTTTGAAGTTGCAGCAGGAATCTAAGTGGTGTGT
CCAGCAGATTGTTCAAGGTCCAAGACAGAAACTTGGGAAAGAGTTTAGAACTGAAGATGC
CAAGTTGGTGGTCATGTTCCAAAGGAAAGATTCAAAGTCTTGCTATCTTATAGAGCCATG
AAGGCGTGCAGTTTAGAGAGAGACGTGAAAGGGGCCTAAAGCATAACACGAAGAGGGAAT
GGAAGAAGCAATGGTGTCTACTCACCCTTAACAAGGACATTTAAACATTGCTGAACGCTA
ATTGCTCAATGTAACTAGGAAATTCCTGTTTGCCTTCGAGTGAACAATTCACTAGACAGG
TAGAGGAAAGATCTTGGTAAGGAGAACTCTTTCTGGAAAAAAAAAAGCAATGTTGATGAC
AAGGAATATTCTTTAGATATTCTTGGTAATATAAAGTTAGGGTTATATCTGAAGTGGGAG
GATTTTGTAAAAGTGCTTAGGAATTTGAGGAGAAAGAATTAGTTAGAATAGTAAATGTGA
AAAATAAGTAGTAGAAAGTCAACAAGAGATGAATAAAAGCGGGGGGGCTCCAGGGAATAG
GTGAGGTGAAAAAGAAGCTTGGAGGGGACTCAGTCCTTAACAGGTTCATGGCACTGCTCC
GTAAGGCAGATTCAGATACTCAGAGTCAAGCTCTTGCTTAGAATGTAGCACTCATTTGTG
TCAGACCTACTTCTGCTTATGTTCAACTCACTTTTAGACTTCTTGGATCAGAAGCCTGCC
TTCTGTCCCATCCTCCGTCTCCCCTGGAGTTTGTAACTTAAGAACTCTTTCACGGTTCTG
TGATATAATCCAGTGGCCCCTATAGTCCGTGAGGGTTCCCTGCTGCAGGCCCTGGCCCCA
GAGAGTCCTAACGGCTCTGTCCATGGTGGGCGCTTTGAGGTGTGGAGGCGATTTGGGTAA
AGCAGAAACACCTTGAGCAATATATGAATGCCTTGTCCAATGTGAAAAAATGTCTGCTGG
TGACAACAAAGAGAGAGAGGGCATATTAAAACAGAGCTGTGAACTTTGAAAGTATAGAGG
TCGATAAGTGCTGGGAGATGAAATTGGGGGGAATCATACAAGTACCGGCAAGAGCTAGGA
GAATGCTAAAGCCCTGTTTAAACATTTCTCCATGAAATGGTGAACTTGGGTAAAGCTGAG
TTCCGATGAAGGGGAAATTGCTAGACCATTTTGGAAAGTATGGAGAATATGGAACAAGAA
TCTCATAGGACAATATGATCTAAAGTTCATGACATAGTGTTAGTATTCAATTTTCTGAAT
TTATCAACTCTGCTATGAAATACACACACCAGAGTCAATGCCAATGAAATTAAACTGACC
AAATATTATTTGAACATTTTTAAGGTAATTTATTAGGGATGATCAAATATCTGTCTAATA
AGATGTAGTTAGTTTAAAATCTTTTGATTATAATTCAGAATTTCCTTTTGCCTAAGCCCA
AAATAAAGTTAATCTTAGAAAAGATGCAAATATTTAAATCATCTTTAACATTGAGAAGAG
AATTTACTATGGAGAATAGAATAGAAAGTATAATATTGATGTAGACTTCAAACTTTATTA
GTATTATTAATGATATTAATACTACTAATTACTACTATACTTAGTACAAAATTGGTATCA
CTGCCTCTCTGTTGAGTTTCTTATACTACTGAGAAGTGGCCAGAAATTCTGCATAGAATA
TAAAAAATAAATTTTGAATTTGAAATGGTTTTTATTGTCTCACAACTGAGCTAAAACTAT
ATGAAGGAGCATGAAAATAATCTGAATAGAGGAAATGCAGTCGAAGACTGTGTAGGAATA
CACAACTTTAACCACTCACTGATCTCTGAGTCCAAGTATTTATATAAGTTATCTTGGGCT
CACTTTCTTAAAAAAGATAAAAATGTAGTCTCATGTTTTTCTATATATTGGGCTATAAGA
AATGGACGTTTTCTTTCCTTTTTTTTTTTTTAGCCAGCACCTCACTCTGTTGCCCAGGCT
AGAGTGCAGTGGCATCAGCCTAGCTCACAGCAACCTCAAATTCTTGGTTTCAAGCAGTTT
TGCCTCAGTCTCCCACGTAACACAGACTACAGGCTAATTTTTCTATGTTTGGTAAAGACG
GGGTCTCACTATTCCTCAGGCTGGTCTTAGACTTCTGAGTTCAGGGGATCCTCCTGCCTC
GGCCTCCCAGAGTGCTAGGGTTACAGGCGTGAGACACCACACTGGCCAGAAATGCATGTT
TTCACTGTGCAGTGATTGTCCTTTGTCTAAGAAATGACCGTCCTCTTCAATTAATTTCCA
GTGCTCATTTTAAACAAACTTTATTGATACAATTACATCAATAAACTGTATTTATTTAAA
GTGCTAGTGGGTGGGTTTTTACAGACATCCAGACCTGTGAAAGTACATTCTGCTCCAGCC
GCCATCCAGAGCCCTTCCATCCTGCCAGAAGGTTGCATGTGCCTCTTTGCTGACAGCATT
AAAATATAAAACAGTGAACAATCATTCTGCCTTACTGGCAGCTGTTGTGTATAGGGATTT
TGGTGACCTTTTAAAATAAATCTTCCATGTTATAAATTACATCTTAAAACAGTCTCATAA
ACCGATAGAATTGTACATGCTAGAAAGCAGATGTTCTCTGCCAGCCATGACATTTTAACT
TGTGCTCTACTTTTTAAAATGTGGTCGCAGCTCAGTGGATGAACACAGCAAGGAACAAGA
GGGAGAGTTTTCACTAGCTCATCAGCAAGGAAGCAGAGGCTTAGCGAAGTTGATTTATGA
AACCAAGACCAAAGAATAGGCAATGGTTAGGACGAGACCAAGTTGCCTTCTTCCCTGTTC
CAGACTTGGCTTTCAGGGCAGAACTGGAAATTCACAAATGGAAACAGCCACTGCGAACAC
CATTTCGTGTGCTACTGCCTGATTAGCCTGCAGCTCAGAGCTGTCCCCTGGCAAGAGGTT
GGGGAAACACAGTTGTAAAAGGAGCAGCTCTCCCCTGTGCTGAACAAATGCCAGCCAGTC
TGATTCATGCTCAGTGAGGTGCTCAGGCTGGGGCTTTTAGGAGAAAACTCAGAGTTTCCC
TGTGCGTGCAATAAAACAAACTGTGCAAAGGGCACCCAAGAATTCAGAGTCCTGGCTTTG
AGCATAGAAAACAATTTTACTGGGGAGAATCTTACAGTCTCCTCTTCAGAGTGGGAAAAT
CACCGTAGCACTGATGAGAGCAGAGGAGTGACATCCTTCCTGGTATTCAAGCAGTATCTT
GAGCTACCAGGGAATTATTTTTGAGTCATTACTTCAGGCCTAATAATAGTATTCATTAGC
GAGGGAGGTTACTCATATTTTGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCACCCTACCAAGGTGACAAAGTGAGATTT
CTATCTCAAAAAAATAAAATAAAATTTCAATGAAATAATACATATAAAGAGCTTGGAATA
CAGAATGATCACTTAATAACCCTCTGCTCTTGTTTCAGATTTCCTAATTTTAGCCTATGG
TATGTGTAGATTATCAAGTGGCAGAGTCAAAAGGTATAAATACTGTTTAAAACTTCCAAA
TAGAATTACCTAACAACCAATTCTAAGTGAACTGAAACTCACTTTGGGTTTTCATTTATT
AGTACTTTTTTTTGACCTAGAACTAAATTTTTTACACTATAGGATGTTGGTTTGGTGCTC
TATTCAAGGACACGCCTGCAAGGTGATTTTAGCTTTCAAGATACAATGTAGAAAATGCAT
GCCTGCTGTCTTAGAGCACTTTTTAACCTCCTTAACTATGGTATTTAAACTTTGGACATG
AATTACATTGTGATTTTTTTTTTTTTTTTACATGGGAGAAAGGAAGCCCATACCTGCCAA
GAGTTGGAAAGGAGGATAGGAAGACCCCTGGAGCTCTGGTGTGGTAGATCGAAAACATTA
TTTAGAGAAACAGAATGGGAAACTGGTGAATATTTTGGCTTTTATAGAAAGGGAGTGTGC
CTCATAAACAGGACAGTTGGAATGTATGGAAAAGATCCAGTGAAAACAAGACCCAAAGCA
CATGACTAATATTGCTTTTCCAAGTTAGACAAATGCAGCTTTAACCAGAATTTGCCTCTG
AGGGGCCTTCGGAGCCCTCCTCAAATCTTGGGATTGTGATCCTTTGCAAAGTTCCAAGGC
CGAAGTAGGAGAGCAGTCCTGGGAGATGCTCTGATCTCAGCTCTCCCTTTCTCCCTGAGC
TCCCCTCACTTGCTCACGGATTCCACCAGTGAGAGGCGGAAGACTAACTGATGTGCTCAG
GTGAATGAATGACAGAAACCATTCTTGTCGTACCCTTGGGGACCACTTGGCTGCCCAGAG
GAACTTCATAACTTAGGAAATAATGTTGACTGCACTGCCATTTTTAAGTGCCCATGACAA
ATCTGCTTTATGCTCACTCATCTCTGTCCCACATCAAATAATGGATGTCAAGATGTACAG
AGAATATAATCTTAAAATAATCAGACAACTCTCACCCAGATGGCTGCTTTTTACCTCTTC
CCCAAACCAGCTTCAGGTGTGCCTTTATGTGGAGTGAGTCCCTCGTCATTAGCCATTAAC
CGTGGGGTTCTCTTTCTCCCTTCACATTTCTTGTAACCTCAGCATGGATTTCCTTGTTTA
TGGGTTTCATTTATTGTTCAAAACCACCAAAATAAATTTGCATTTAGGGTGACCTTGGAC
TAAAGCTCCCCTGCGGAATTCCAGGATCCACCTGTGGCACAGGTGTGATTAATAGAGCCT
CTTTCAAATTGAAAAGCACCCTGATGTAGATCACAAATGATAGAGTTGCCCGGTGAGTGC
TGCAATCAAGCTTTCTCAACTCAAAGGTGGTTACGATGTGTGTGAATGAATCACAGTGAA
AAGTTCCAATGTGATTCCATCTGACCAGGCTTCTTGTGATGGCCCATATTTCAACACAAA
TGGGGGTCATCCGTGGCTTCACAGTGGTTTTTCTTGTAAATGCCATCACAAACTGGACTT
GCGACTTATGCCATCCAAGTCCACTTTCAGCTCTGACTCATGCTGGGATTGCCCCAAACA
GGGCAGGGCAGACTGCTGGAATGTAGATTGCCCTAACATTTCTTAACCTGCCCAAGGTTG
AAAGTGCCGTTTTCTTTTTACCCTGTTTTGCTCTCCAAAAATCTTTCTGTTAGCATAAAA
CCCTAGTATAGTGACATGACTTACTTACTGTGTAAAAGGGGAGGTTGGAATCTGTCCCTA
AAACATACAGGTTATGTGTAAGAAAACCCTAAAAATCCTGGCTACTGAGTGTCAAAGATA
CTAGTGCTAGTTCCTATCCCTGGCATTGTAAGGAATTTATAAAAAATCACTAAGGAATTA
CTCAACTTTAGAGGGACAAGAAACATTTGATGAATTGAACTTTGGTGTAGAGCTGAGCGA
TAAGGAAAAACAAGTGAATTTTGGTTTTGTTTCTGATGATAGTAGCCTTAAAAAGTGCTG
TTTCATTCAGCATTTTGTCTTTAAAGTTCTTTGGAAAGAAGCTAGACTTACTTTAATATA
AATCAGCAGAACTATCCCTTATCAGAAGACCCAATGCAAAATTAAAAATTGTTGTGCTAG
GTACTTTGCTTTTTTTAAACTTGGAAACATCCTGCTGAATTCACCCAAATGTGTATCATT
AAGAAACATAGTTATTTCCCTTTGCCAGAAATCAGTTCTGGAAATGAAGATTGTGTAAAA
ATGGAAATAGTCGAGCGCTATGAAAACCCAGGAATTACATCGTCAAATGAACTTCTATTT
AGAATATCATTTATTCATCTTATGTTTGTTGAGTGTGTACCAGGTACCCATGCTTGGTAT
ATAAAGAAAATGTATGGTCTTTAAGCCTCTGCCAGGAACTGGCAGCCCAGCATTCTGACT
CTTCTAAGGGAAAAAAAATAGCAAAACGCGATGCATGGAAGCTCTGCTTCACAAAGTAAT
TTTAGGCTTAGCGTTTTTAAAAAACATTCTGTGAAAATCTCTTACTTTGCCTTTCACAAC
TCAGATGAAAATTTGCCAGTTAGGAATTGTGCTTAGCTGGTAGTAAGAGGAACTTTAAAA
ACAGTGGATTAGGTAAAATTAAGGAAAGTAAGATTACTTTAAGATGAAGTAAGAATCAAT
CTCCCACATCAGATGCAGTTCTGAGTCGACCTGGAGGGGGCGCAGTGACCACTGCACTGT
GAGGGGCCTGGAGCGCTGTACTTTGGCCACCTCAGCTGTGGCATCTATGGGCCAATTCCC
TCAAATCTGATCAAGGCCGCGCCGCATTTCTAGACATCAAATGTGTGTTTCAGGCAGAAA
GAAACGGATGGGCATAGGGGAAAATGTCCCCCTTTTTGAGAAACTTTCGCAGAAGCCCCA
TTTAGCCACTTCTGCCTGCATCTATGTCATCAGCACGAGTCATACAACCACGATTAATGC
CAGAGAGACTGGGTATTGTGGCCCTCAGTTCCTCTCGGTGTCACCTTCAGCTAATCTAGG
ATTCTGTTAGTAAAGAACAGGCACACAAATGGCAATCTATGCCACAATGCTCTTATCACT
GAGCCCCCTCTGGAGAAGATAATTGTGGCAGACATCTCTGGTGCCCCACCCAGACTCTTT
CTGTAGGTCGGGGGCACCTACCCTCAGCTGCTCTGAGTTCTGGCTGTTAAGGACTCTCAT
TAAGAAGCCCTTTCAGAAAGAGTTACCCTCTGTCAAAAGAAGGCCCAGGGATGCCTGGGA
GGTCAGCCCACTCTGCCTCTCACAGGGTTACCTGCAACCCATGACTGCCTGATACAGGGT
ATGAAAGACAGCGCCCCACACTTGCCTCAAGGTGGGACATCATTGCTCTGTCATTTGTGT
GGGGTGCTGGGGGGGAGATCAGACTGAGGCCAGCCTTCAGCTGCACCAACACGTTTGCTG
AGTGCCTTGTCCTCTCCCGATCTTCTTATCTCACTGCCTTTCTCTGTAAATCCCTTGCTG
AGAATCTCTATCCCAGGGTTTTCCTTGGGGGAACTAAGGCAATTATTTTTTCTTATAACG
TCCTCGTTCTCTCAGCTTTCTACTGAGCTATTATATAAGAACCAAATATTATTGTACCAC
CTCCTTATCTTCCAAATACACCTACAGATTAGCCACCTAATTGCTGGAATAGTTAACAGA
GCAGACAAGAAAGAAAGAAATCTAAACTGTTTTTCATGAAACCTAAGTGCTATTGTATGT
GTTCTCAAGTGAAGGGAGAGACAAACTTATTTAAAAGAGGAAAAAAAAAAAGATTTTCTC
CATAAAGATACGCATTTTAACTTCCCTGGGCGAAATGCTTATTTGCTACAAGTTTTTAAC
AAATCACACATGATAGAGGCAAAGGAAAGGAATTTGTTGATCTAGGCTGAGTGATATTAA
TAGAGAGTAAGATTTTCTGAAGGCATCATTTAGGAGCAAACGACCAACATTTAAAGTGAC
TTTTTCAACTAGCTCTATATAAACACAGTTAAGCAGTTCTCACATAAAAATTATTTTGGT
ATCTAAATTTTTGCCATACATGCATAATTCTTCTAATTGTATCTCCTTGTCTTTTTCAAC
AGTAAAACTATGTTTGATATGTCTTGAATACTAAATGAAACAGAAAATGAAAATGTTAAT
AAATAACATAGTTTTCTATTATGTACAGATGAAGTTCAAGGATAGTTGTTTGGGCTATTT
CCTTGCTCTCCTGATTTGAGATACCATCTTAGGCACCTCCTGGTACTAGAGTTCCTCCAG
CACCTCAGAAACTCTCTATTCAGATCTGCCTTTTTCAAAGGGGTTTCTGTGCTTCCTCCT
TTCCCCCTATTCCCCTTACTTAATCGCTCTCTCTTTTTTTTTTTTTTGGTCCCGCGAATC
ACCCTCCCTCCACCGAACCTTCCTCTCGCCTCCCCTCCCTCTCCTCATATTCTTGGGCTA
TAATTGGGTTATATAGCTTTCCTATGAAAGCTATAAATTAGTTTCATAGTAGGCCTGAGT
ACACTGGATACTTTTTCTTCCATTCTTGAGATACTTTGCTGAGAAGACTGGTGTCCAGCT
CCATCTCCTTACTTAATCTCTTTAAAAATTAAGCTAACTTTTGTTTTGTGTCCTGTGCCT
GATTTTCAGAGAAGTAGGTCTAACCACCTACTCTGCCCCTTTGTTTTTGTGAGAGCCTTT
AGGAAACTTCAAAATATGGAACAAATAGGCAATGGCAAGTGATCAGAACACTATTTTTTT
GTTTTAATTTTACATCAAATGATAGCATATATTACATTTCTATGTAAAATGGAGCTGCAA
AAATCAGGTAATATATTTTGAAGGTACCTGTTATATTTACATAACTATGGTGTCTGCGTA
TGTATAAATGTCTGGACAATTACCATGAACTCATCCTAGAAAAAGTGCTATGGGCCTTCA
TTGGTGAATATCACTTGACCATCCGGTGACCATTGTGTTCTTTAGCAATAAGGACTTTTC
TGTAGCACTTTTTCTAGGATGAGTTTGTGAACTTAATTGTCTGACCATATATTAGGAAAC
CCCAAAGCTGTACTCTAAACTTTACTTTTAAGTGTGCTCAATTTGTCTGCTTTTTACTGT
TATCAAAGTAGAACATTCATTCATAAGAACAGTGTTTACTTGGCTTTTTTTTAAAGGAAG
TAGCTTTATACAATTATTAAATTTTAATTTAATTTGTACAGTAAATGCAATTAGGAAAGG
GATACTGCCTGGAAAAAATGCATTGCTCGGAAATCATTCTATCGAGGAGTAATGGGAGAA
TCTAAAACAGTGGTTCTCAACCTTCCTAATGCCACAAACCTTTAATACAGTTCCTATGGT
CTTGACCCCCGGGTTGAGAACCGCTGATCTAAAATAACTGATCCTGAATATCAAGGACTA
CAATCTTTATCAGTTGTATTTATTGCCTCTTTCAGATACTGTGAATATACTGTAAATTTT
GTGCAGATTTTGGTGTATAGAATTTGCAGCAGAAGGAAACTAGAAATTTTCCGATAACTT
TCATTGAGCCACTTGACTCATGGAAAGATCTCAATCTAAATGTTGAAACTTCTGTTGTCT
TTTTTTTTAGTTTTAGGGGGCTTTTTTGGTAGGGGGAGAGGACTTTTTTGTCCATTTTCT
TCCCTTCCTCACTTCTGTGGACTAAATACATATTTTCAAAATAATACAAATAAATGACAT
CATCTAAAACAAAGAATACCTAAGTGGGTGTCATGAATATGTAGTTTCCTGATTTTTGAG
TACTCCATCCTTCCAATGATGGATATTTATTATGCTTTATGACAGGCAGTTACAGAGTTC
ATTTCACATGTATCAGAAACAATCCTGGGAAATAAATTTTTGATCAGCTTAGGTCAGTGT
TCAAAGTGTGAATAAAATGAAGGTATTCAAAGAGATTTTCAGTAATCTAACTCATACCAA
AATTTCATTTGCAATAGATTGGATAGATTGGTGTATTTAACTTAATTAGCCTTTTTTTTT
TTTTGAGACACTGTCTCATTGTGTCATCCTGGCTAGAGTGCAGTTGCATCATCATAGCTC
ACAACAACCTCAAATTCCTGGACTCAAACAATTCTCCTGCTTCAGCCTTCTGAGTAGCAG
GGAATATGGGTGTGCACCACCAACCCTAGGTATTTTTTCTATTTCTTATAGAAATGAGAT
CTCATTCTTGCTCAGGCTGGTCTCAAACTCCTGAGCTTAAATGATTCTCCTGCCCCAGTG
TCCCAGAGTGCTAGGATTACAGGTGTGAGCCCCTGAGCCAGACCTAACTGGCTTTTAAGA
TTAGTTTTTAAACAACTAAATTAAATGCTATAACTTTTTACTTGTTATTCTTATATATTA
GCTATATTTTTAAAACTTGGTCTTTATCTATGGTTTTAAAGATAGCACATTACATGTATA
GCACATGTGAAGGCACATTACACCTTTTTTATTCTCAAACTTAGAATGAAATGCATTTGC
ATATACATGTATGTATGTATCCATATGTACATGGGTGTATGTAGGTATACATGTGTCATT
TATCATAATATTAATTATAATGTCATTACAATAATTCTTGTATTGAATGCCTACTGTGCC
TTGAGCAGTGTGATTGCCATGCTTTACCTTATGCCATTCTCGTATCAATAATTTGATATG
AATGTAATTAGCCCTGTGTTACAGTGGAGGAAGGGGAGGCTTAGAGAGTTTAAGTGACTA
GCCTAAGGGCACATGGTTAGTAAGTAGCAGAGCTACGGAGGGTTGGAAGTTTCTTCCTGG
TAACCAGTTAACAATGCGACCTTATCACATCTGTTACCTCAAGTTGTGATATAATGAGAA
GAATAAGAATTGCAGCACAAGCTCCTAGAGCAAGGAATAGAATTACTTAGAAGGCGCCCA
CTTACTGGCAATATGCTGTTAAACCCTTTACTGATTTCTGTAGCAGCAGCACAATATTTA
ATGCCTTGGCTTTCATGGGGCACTGAGGGCTAAAACCAAGGGGCATAAAAAAATGACTTG
AGGAGCTGGGATTGAAAATGGTACCATGCTGCTCCCACGGGCTTAAGAATAATTTCCATT
AGAATCAGTAAAAAAAAATTATCCTTCCAAAAAATGCGAGGCTCAAAAATGAAGTCCAAG
GTGCTCCGTCTAACATCGCTAGACAAAACCTGAATAAAGAGCAACCACAGTGGTGGAGGA
GGAGGAAGAACCGCTCAGGCACACCCTCTAATGAGGTGTCAGTGCAGTGCGGAGGGCTGC
TGGAAACCTCGGCTGGAGAGTGGCCTTGCTGTGACGTTGCCTTACGGCTGGGAGAGCAGA
ACTGCTTAGATTCAGAGGCTGCTGAGAAACTGCCAGTGTCAGTAAACAGCAGTCACTCAG
GGATGTATCTGCAGGGTAAAGAAGACTTCTACTTCTACAGAGGGGTTTGTTAGGGTGGAT
GTGTGTGAGAGAGAAAGAATTCTTAGCACACGCTGACTCAGAACACTCATAATAATTTGG
CCATTCAGTGAAAAGAATTACTATAATTGATGATATTTGCATGTGAAGTATTTTACTCAC
ACATTTTTAAATTAGGAAGAAAATCCTTAAAATGCTGCATGCCAAAGTGTAACTGGTGTG
TCTTTTCTAAAGTGGAACCATGACACTCTCCAGAAATAATGTTTGACACTGTTCCCATGC
AGCTCAATTTATGGCTTTCCTCCAGTTCTGTGGAACTGTAAGACCCAACTCCTCCAGATC
CATTTATAGGATCGTTTTTCCTGTAGTTACATAGACTCTGAGAAATGTCAGCCCTGGAAC
CTGGGAAGTATTGACAGGACTAAAGTCTTTCTCCCTCTCCGTCATCATCATTCGATGTCT
GAAGTTTGAGAACAGAGGTTGGCACTGGAACGTTTTAAAGAAAAGAGTCAGGATGCAAGG
AAAACAGATTTTTCCTGTGAATTATTATTTACCACATGTGCTGTGGAAGTCAGAGCCTGA
CCTGAGCTTGAATCTGGGTTAGCTTAGGACAGAGTCAGACAACCACTAGAAACAAAGACC
AGAGACCTAGACTCTGTGACTTCCCTTCAGGAAGAATACAAGCTTAATTACCAGGACAAA
ATTGTCACCTGTTAAGTAAAAGGCTTGGTCAAATCTGGACTGAAAGGGACTTAATCCCAG
GTTCGTTCCAGTTGGGTCAAGGCTAAAAGTTGATGAAGGTCAAATGAAGTCTGTGTCTTA
GTCCACACAACTGCTATAACAAAATACCTGAGGCTGATTAATTTGCAAACAGCCGAAACT
TATGGCTGTGGTTTTGAAAGCTAAGAACTAAGCATTTGGGTCTTGTGAGCACATGCCTCA
CGTGACAAAGGCCTGGAGGGATGAAAAGGGCCAGAAGCTGTGTGTGGAGCCTCTTTTAAC
TTTGTAAGGGCCTTCATCCCATTCAGAAGAGAGGAACCCTCATGTCCTAATCACCTCTGG
AAAGACCCACCTTTTAATACTATTGCATTGGCAACTAAGGTTCAACATACAAATCTTGAG
AATCATATTCAGAACATAATAGTCTACAAGTGTGCTTGTCTTCTAGACCTAAATTGAGTT
TCTTTCTAGGAACAAAACTAAAAAGCGAACTAAATGCTCACTTTTCTGAACATCTGGGGA
GTAAGCAGCTTTTACAGTTTTGCAGATTAAGGCAGAAGGAAGATTTTTAGACTGGGGAGT
CTTTATGTGTAAGGTGGCCAAGCTGGTGGCAAAGGGCGCCTGAGAGTTCTATGTAGTTCT
TTGATTTCTAGACCAGACTTGGAAAGATTAGGGGAAAAGTTTTAGAGAATGGATACAAAT
GTTGATAAAAAGTCAAAGACAATGGATAGAAGGGGTTATAGTGAGGAGCTAATAGAGCCT
TGGGGGCAATGGGGAAGGATGTTTTCTGTGTATTTCACTGGGTGTCTGGGCCAGTAGGGA
AGGGTGCTCACTATCACCCCGTTCAGACCTCTCTGCTCTGTTTACTCCCCTCTTCTCCCA
TTGCCTCACCTCTTTTCTACCACCTCCAAGTGAGACCAGGTTCAACCCAGAATGTTGGGA
GAAGTTGAGAGTGAAGAAAAAAAAAATTGGAATGCAGCCACTGCAGATTTTATGGTGTTC
ACCCCTTTAAACTACAAGGGTCATGTGTGATTGTACATGCACACACATCCATTTTGTTCG
TGTTTGTCACATTTTTTAAAAGCTGTAAACACAAGTTAGAAAAGGCAACATGAGATGGCA
AAGAGAAATACCAGATGTCACCTCCCCTAGTTAGCCTTCCTTAAAATACACCCTCTCCTT
CCACCCTTGCCCCTCCCTCTAACAGAGAGGGAGAAGCCTCTTGCCTGTGTTCCTGCTGAA
ATCTCTCTCTTCGTGCCTTTTAGACTGTGTTTTATTATTTGCTTATATAGTTCTCTCCTT
GCCTGGACTGGGTGCTACCTACATCCAAGATGTCGGCTTCATTGAGTGTGCCTGGGGGTG
AGGTGAGGAGATAGAATCATCCGTGTTACACAGTGTAGTGAGGGTATCTCATAGTCTGGG
GTAGACGGCATGAAACATGGGACTGTTCCACTAAGATTCCATGATAACATTATGTATGAC
TCATTCTTTATTATATATTGTGTTTCAGTCTGTAATAATAGACCTTGTTTTAATTGTTTC
AGTAGTTAGTAGATTGAGGGATAAAGGTAAATTAATTCCAGGTGCAACTGTGTTATTAAA
ATATCACAGCCATGGGCCAGAATCTATAGAAAAGTGAATTGGTCGTGATCTTAACATGAT
TCAGTCTGAGAAATTAAATTGAGTTAACTGAAACAACTGATTCCATTTAACTAATTGACT
TCTAAAATATTGAACCATGACATTAGGTCTGTTTCTAATATTCTTTAAGCCAAAATCATC
AATATTAACACAATTAGAATTCCCAAGTTCATTACCTCATGTCTATCAAGGTTGTTTCTC
AGAATATTCACTGTGACTCAACATGGTTCACATGTTGAGATTGATATGTGATTTTTACAA
GAAAAACTCCAGAACCAAAAGCACCTATTTGGTTCAGAAAATACAAATACAGTGAAACCT
CAACACACTAAAAAAAATTTGGAAGTTCCTCTACTGTTGCAACAGAATTCAAGCCGAACC
TCCAAATCTGACCCAAATCACATTCCATCACCCTCCTTTCCCCCCAGACTTGTAGAACTA
AATAATAACTACCCAGATAACTATTAATTGCAATGAGCAAGTTAACTTTTCCCGAATACA
TTATGCATTTTTTTATGTCAAGTTTTGGAAACAAAAGGTCCTCTGGTTTCAGTTTTCTAA
ATATACTTTGCTGGAGAATTGTATGTGCTTTCTTTCTAACGTGGGAGTGAGCCGTAACAC
CTTGTCTGTCCTCCGTTACAGAAGACAACCGATGTACCTCCTCCAATGCCGCATCGTGCA
CCAAGTGCCTTGCGCTGGGTCCAGAGTGTGGATGGTGTGTTCAAGAGGTGTGCCTTTTTT
TTTTGCTTTATTTTTCTGTTCCTCATCCTTAACTTTCTGTCTCGCATGATTTCACTGTCT
CACTGTTCTGGGCCTTGAAGGTGCATCAGGAGAAAAGAAAGATACTGGGGAGCCCAAGGA
AAATTTTCCTTGGTTCTATGCTTGGAAACAGCCTCTCTGGCTGAGTGTAAAGTAAACTAC
AGCCTTTTTATTAGGAAAATTATGGTAATTGTGAAATGAAGTGCAAGCCATTTTATGTTT
TCCATCTGTTCTATAGAGAATATTGGCAAACACAGATAGTAACATTTGATAGTTCAAGAA
GCTCTGGTGTGAAATTCTTGGTCCAGCTTGAAGCATTAGGTAATATGTCCAAGTTGAATC
ATTATCTTATGTTATCTTGTCCTTGCTCATTAAAGAAAAGCGAGCTAATTTCTTTGTTTT
TCTGTGAAATACTTGAAGGTTAGCAGTTGACTCCATCTCATAACATTGTATGTGTACATC
AAGTTATTGGTACCTAATGGAAAATGTGACCCTCTCCGTGAGATATTGTGTACATTTAAA
TTTTGTGGAACGGAGAATAATTCAGACAATGTTTATTTTTCAAATATCTGGGGTTTTTTT
CCTACCAAGAGAAATGAATCCTGATAACAAAATTCTTAGTAAAACAATTATAATGCATTT
CATCCTTCTCGGCTCTAAAGTTGTTGTGTAGTTTTTAATCTTTTGTCAATAATCTGCAGT
TAAAACTACCTGTAAATTGCACTGGAGAAGCCATCTGCTAATTTGGGTTCCTTTCTTATG
AGATTGCCCAGGTAATTTTACATTACTACATTACTACTGCCTAGGTAATTTCACATTACT
AATACAGTTCCCGGGAATTGAAACAAGTAGATCATTAGTGGGGTTTTCGTGGCAGGAAGA
TAAATCTTTGATTTAATTCAACTACATCTGCCACCCTCTTTCCACCTCTCTTATTACTGT
TTGCCCTAATGCATCCCCCAGGAGGAAAAAGAAAGTTGAAAAGTAAGCAATATTTTCTTC
CATGAAGCAGGTAAGGATAGAAGCAGGGGAGGAGTTCGTGAAACAGTAGCTGTGTCTGAA
AGTAAGCCTATCTCACCAGCAGCTCGGAGGCTCCCAGAGGTGCTCTGGGCTACACCAGCA
AAACACCAGGTGTCATTCCTGAACTGGGAAGTGCTGTGCCAGAACCCGTGGGGCGAGGCT
GTGTCCTAGGGGAGACGACTCCACAATTTCTTGGTCCAGTTCCATCACTTCCCATGATCC
AAATGACCAGGCCCAGTTCACTCTGTTCTCTGAAGTCTCCTTTTCTTCATCTCTAGAACT
TTGAATTTGGAATTTACTTCTAGGTTTTCCTCTGTCAAGAATGTTTGACATATCCTGACC
CTAAGCCAGTATGCCATTTTAGATTTTTATTGCATCATTAAGGAAGATCCTTAGAGCCCT
AGATTTGGTGCCCACCTGCCATGAGCTGCTCACTCCTTTAGTAAGGGGAGTTTGCAAGAG
CCTTTAAGAAACAGTTCAGAAGCCCAGTTGTCAGCCAAGTGTAACATGCCAGCCCTGGAA
TGTCAGGTGACAGAAGGACCCCTTCCTCCTTCCACGTGTCTGACTGGCCCCAAAATGCCT
GAGAGTCACAGCTCTGGGAATTACTGCCAGTGCTGCCACGGGAGGGACTTTGTGAAAGGA
ATTATTGCCAGTGTGCCACGTGTGGTCAGGTGGAAGGAGGTAAGCTAAGGGGACAGAAGA
TGGCTTCTGGAGGGGAGGGGGCAAACCTCTGTCCAATGTTGGCCACAGCTTCCAGTTGGG
ATCTCAGGGAAAACAGGAAACTTGTTTTGTAGTTCATGTCCCCAATAACTCAGTACAGTG
CAGTGGAGTCCAGTTTCCATATTGAAAGAACAGGCTCTGAAGAGAGACTGAGTGGGGTTC
AAACCCCTGTTCCACTGGTTTCTACATAGACAAACTTCACCGTGTTACCTGCTTACTTTG
TACCTCAGTTTCCATATCTCTAAAATGGAAGTATTGATTGTCACTGATGAGAAGAAGATG
AAATGAAGCCATGTGGGAAGCACTTGGCACACAGGCATTGCTTAAGACATGTGAGTTGTG
ACGAAATAGAACTTTGATGTGGCCCTGGAGCAACTGATGCAGGTTTAGGAAACAAGAAGG
ACTGCTTCCTCAGAGAAGGGGCCGGTGTGAAGACTCAGCCTCCATTCACATCCTCAACAG
AAGGAGCTGTCCACGCCGGCAGGCTGACCCGGCGTCACTGAAAGGAAGAATGTAATACTT
AATTTTGAAAGATCACGCACCATTCGGGCAGAGATGCAACCGAAATCAATGATTTGTCAA
CCAGCAAGGCTGAAAGCAGAGAAAAGAAAGGGGCTGTTTTTTCTTTTTTTTTTTCTGCTC
ATGATTAAAACAGAGAAACAGCAATAAAATAAAGTTAGTTTATATAATCTTCAAAGTTAG
TCAAAAGTAAAAGGTTACCAGAAAGTGCTGACAAGATACTCACTTTGCTTGCAAAGTGAT
CCTCACTCATTCCTAGAGAGCGTGTTAATCGGGCATTTCATACACTCGGCCTTCTCTTTG
CCTCCACACTACACGAAAGAAATTGGAAAATAATTAGGATAGAAAGAACCTCATCTATGT
TATCTACTTTAATGGCTCCTGGTTCTTCTTAACATCTGTGAAAGACGTGTCAAGTTTTGA
AGAATCCTCTTCTTCTCCTGCCTGCAGTGTCTAACCCGGGGGTCCCGGCACCGCCAGCGC
TTACAGTGCAGCCTTGGAGCCTGCACTAAAATACGTTATAAAGGACATTCACTGTCAAAG
GAAGTGGAAGAAGGTTTTTGTTTCCATTTCTCTGCAGGTTACCATGTTCAGAAATCAAAA
AGACTCAAACATGAGTAACAGAAAAAACAAAAACAAAAACTTCTCACATCTATGTCCCCA
GAATATTATATCAAAAGGATAAAAGTAACACCTGATGAAAAGCTGGCCAGAGTAACTTCA
ACCTGGGCTTTTCATTCTCAAATAGATTGTAGGTGCAGAAAGCAGGAGCAGGATTTTGCT
CGTGTTTTTCTTGTAGAAGTAAAACATAGGATTAGCAGAAATTAAAATGACACAAAATAC
CCCCAGATTAGTTGGGTGTGGTTTCAGATTGCTTTTCTTTTGCACAAAGTGGAAAGTCGG
CCGCAGTGGGCAGGAGTAGCAGTCCGGTCTTTATTTTGATACCATGATCTTATCTTCCTT
TTTCAAACCTAATTGGCAAATTGGCAATGTTTTCCTGACACGGTTTTCACAGTGGGATAA
AAACACTTATGGTGATTCAGACATTGCAAAATAATTCAAAATATTTTGTTGATTTCAGCA
GAACTGTTTGCCACGTCCTGGTCAAATGGCAAAGCTTGCTGTATAGTGACAGGGAACCCA
CCACACTCTCCTCTCCACTCTGTACACACAAATAACAGATGCTGTGGCTGAAAAGAAAAA
TTAGAGCTATTTGTACTTTATTTCCTTTTTGTGATTTTGAGACTTGCGTGTGCCCTTTGC
CGGTGGCATATCATGTGAGTCATGACCGAGTAAGCACGTACCAGCCTTCTGTACCCACGG
TACTCCCCACACCGGGAGCAGTGGGACTCCCCATGGGGCATGATGCTTTCTGGAGGAGTG
TGCTGCGTGCAATAGCAGCCTTTCCACGTTCCCTGAGGACCTCCGACCTGTTTGTAAATT
CAATCTTTCACTCAGTCCCTCCACATTATATCAGTAGATTGAAAGTTAAGGCTTTGATTA
TTTTAAACCTAAGACTGAAATCTGCATATATGGCCAATTGCAAAGCAAATTTAATTTTCC
ACCTTCGTGAAGTCACCAGGTGACATACTCGCTTTTGTATCTTGAATACATCTACCTACC
CTACAGCTGTGCTCCAGAGGCTAATTCTGGTGGCGCTAAAAAGAGCCACATAGTTTTGGT
GGGCCACCTACCGCCCTTCAGCTTATTCTTTTATTGTTTTGCACCCCTCTTTAAAATGTA
AAAAGCATCCTTTAGTTTTTGCACTTACACTCTGTAAAAACAGACCCCGGGCCACATCTC
TTCCACAGTTCCTAGTTTGCCGAGGCTAGCTCTCAATTAAAAGAGGTCTTAAAGTCTTTG
TAAGAATGTTTTCCTATTGCCTGTCTCCATCCCATGTAATTACTCCAGTGCCAGGGATGT
CACTGTTTATAGTTAGTGACCTCTTTCTTATTCAACACTCACATCCATCTAAACTCGATA
ATCTCCTTATCTGCATAACCCTGTGATATGCTGTGCTTCCCCTAAGTTTCATCCCCATGA
TCATTTTATTTACTTACCTAATTGCTGAATTCACTCATGAACTGTTGGCTTTGATGACAG
GGACTCTTATCCATCTTGCCCTAGTCTGTATCTTTAGCATCTAACAAGATAGTGACCCTG
AGTAAGTATTCACTCAGCAGGCTTTGAGTGAGTGATTAATTGATGGGAAATCCAATTCTC
TGAATCATCTGGACTAACTAAAGGAAGAATGATTGAATGCCAAATCAAGATAGCCACTGC
CAAGAAGATTGCTGAGCAAAGATTCAGCTCGTGTGTAAGCAAATACCTCAAATAATCTAG
GCCAACACTATAGACACTTATAGTAAAACATATTTCCATATTTGTAAACACATTTTCTGC
ACTTAAGGAGAAAAAATCTCACAACTCTTTTTACATGAAAAGTAAAAATGTTCATTTTTT
TCCTCACCCAAAGTAAATTATATGTTAACCTTATCCATTAGTTCCAAGTTTATTAGGTGA
CTCCTAGAGAACCATCAAGTAACCAATGCTGAATGATAGTGAACGTTGTCGATTTAGTTA
CAAAATCCGGAGAATTTGAGATGCAGTCTTTTATCTCCCAGCCTCCTCATGAACATCTTT
CTGGGTTTATTGCGTTATTTATAGGCTGTTGTATATATTAAGAAGTTGGGGGATTTTAGG
GTGTAAGAAATTCAGATTTCTGATTCCTTCTCTTATGAATTTTCAACGCTTAATTAGGCA
TGTGATTCTAAGTACTTACGCTTATATTCCAAAAATAACCATATGTAATAAATATATAAC
AGTAAACCAGTTGGGTTATTTGAGAACCAAGGCTCACATTTAGAACCACTGAATGGTCTG
TTTTGACTAAATTTTCTTTTGGATTGGTCTTTTGAAAGTAAAATATTTAGGAAGAATTAA
ATTAGTATAACTTTACAATGATCACCTATCAATATATTAAGTGTTCTGTTGAAATCTCCC
CTTTAGTAATTTATTTTCCTCTTTACAAAGAACATTTAGAAATTAAAGTTTAAATGAAGA
CAGATTTGCCAGTACTCTCATTGGAAACATGCAGCTATTTTGAACAATCGCATAATTTGT
TCTTTATTAGAAGATGGCTTCTTCACAGGATTTGCTATGTATTTTGTTGTTGGTGGTGGT
TATAATTGAAATGACATGCATTCAAAAACGTCAATGATTTTCCTTCTTTTAAACAGGATT
TTATTTCAGGTGGATCAAGAAGTGAACGCTGTGATACAGTTTCCAATTTAATAAGCAAAG
GCTGCTCAGTTGATTCAATAGAATACCCGTCTGTGCATGTAATTATACCAACTGAAAATG
AAATTAACACCCAGGTGACACCGGGAGAAGTATCGATCCAGCTGCGTCCAGGTTTGGTGA
TTTTCAAATAAATCTATGGGGATCAGAATTCTAGTTTTGATAGTACCTGCAGCCAGCGTG
TATCCTCTGCTACTCTCTGCAGATCTGACTGCACTACATTTTAATTACGTGTTCTGACCA
TGTTGTGATGTAATTGTGTTTCAATAGTAGTGCCAGCTCTAGGGAAAAGGGAGCATGTTT
ATTTCAATGTAGAGTGCTGGCATTATTAAGTACCCCCATAAATATTTGTTAGATTGATTG
ATTGATTAAAAGGAGTTGTGAATTAAGCTAAGTCCCTAGAGACGTTATGATGAACTTTTA
AGCCCGAAGCTGCAATTTCTGGTTACCATAATTACTTTGGGCAGCTTTGTGATGGCCCTG
AGAGCCACATGCACCTCTCCTCCCGTCTTTCTATTGTAATCATCCTTCCATCTCTCTGTA
TCCCACAGTTTGCCGAATTGTAGGCCACTGCAAAGTATTCATTTTCCTCCAGTGCTAGAG
AATCCCAGTGCACAAACTACACATAGGAAGATAAGTCAGGGCCTCAGGTATGCACCACTC
GGTTAGATGGATTTAGTTGAAAGCAGTGGTTCTCAACCTTCCTAATGCCGCAGTGTATTT
TCATTGTTAAAAAGGGGTCACGACCCACAGGTTGAGAACCTCTGGTCTAAAGTAACCTGC
AATTGTCTTTCTTCAAGCCTTCATTATTTCATTGTGTGTGGTCCTGTCCTGTCATTAATT
TTTTAAATAACCATTCTTGACATACTCCCTTCCCCGTTCCAAAGCTAAGTTATTTCTTCC
AGACTCTTTGATTACCAAAAAAACAAAGTCTATTTCTTTCTTGGCCCTAGGCATAGTCCC
AGCTTCCAATTAAAACTGTGCTTTTTACAATCTAAAATAATGATACAGCCCAGTATGGAC
ATATGTAAGCAACAGCTGGAAAAGGATATAAAAAAATGAAAGTAATTAGTTTGGTAAGAT
CATAGCTCTATTGCAAAAAATTGTTTAGCCTAGTTAATGAATTCTTTTTTTAGAAAAAAG
GAAAAGAGGGAAAAACAAAAATTATATTCTCTTTTTCACCTAATTCTAATCAGTATGTCC
ACCGAACTCTGCCCTTGGGAGTTCCTATAATTACACACGCATGTCTCTTCTACCTATAGA
TGCTTAATGTTATGGTTGCCCAACCATCTTTAATGATTTCTCTTTCTGTCATTCTAATAG
GTTTTTATTTCAGTTTCCTGATCTAGATGAACCTATCTGTCTTCTGAGACGACTTCTAAA
GTCCTTTTTCTGTTTGTTTGTTTGTTTTCCTGAGACATANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCATGGCATCATTGCAGCTCCCAGCACTGAAACTTCTAGGA
CCTGAGCAGTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACATGCACCCACCACTAT
TCCAGCTAGTTTTCTACTTTTAGTAGAGACAGAGTCTTGGTCTTGCTCTGGCTGGTCTTG
AACTCCTGAGTTCAAGCAATCCACCTACCTCGCCCTCCCAGAGTGCTAGGATTACAGGTG
TGAGCCATCATGCCCAGCCTCCAATTTCTTAAACATTTCCATATCCTCAACAGTGTTGTC
ACCTGCAGACTTTTCCCTTGTTCATCTGTGGATTCTTGAGGCTCTCAGTACAGCCATTGC
CTCTTTCACATTGTATTGCATCGAGCAGTAGCACCTCTGTAACTCAGTTATACTTAAGCT
CTTTGACTCAAATGAGTTTGGAGATACTCCCCAACTCACACTTAAATTTGAGGACAAGTT
GTTCATATCATCTTGGCTACAAATCTTTCTATCCATATTGTAGGTTCTTGCTCCTCTACT
CTTCATTTTATTTCGATAGGATTTTCAGAATTGGTGAATTGAAAAAACTACCCCTAATGT
TTACAAATGAAGTAAACAGTAAGGCTGGCTGTGTCTTTACATGGCAGAGAAAGGAAGCTC
TCCAGAATCTTTTCTTAGAAGGGTGCTAATTCTATCATGAGCGTCCCATGACTTCATCTA
AACCTCATTGTCTCCTAAAGGCCCCATTTCTAAATACTGTTTCATTGGTGGTTAGGGCTC
CAATACATTAATTTTCAGAGGGACACAATTAAATTCAGTTTCTAGCTTTGGATATATAAA
AATATATTTCAAAAGCCCATGGAATATTTTTAGAAATTGATCATGTTTTAGGCAAAACTC
AATTACAAGAGTAAAAACATTTTTTTAGTGCTAACATCTATGGGTATAGTTCAATGAAAT
TTTAAATCGATTCAAAAAGAAAAACAAATAACAACAAAATTCAGAAAAAGCCTGTCCTAA
ATGATTCTATCTCCAAGAATAAATTGAAACTCTAGTAATAAAGTAATATTAATAATAAAA
GCACACATCAGAATGTGTTGGATGTAAGTGAAGTTGTTCTTGGGAAAATTTCAAGCTTTA
CATATTTTTATTATTAAAGAAGAATAAATAAAGATGCCCTATGCATCCAAACAAAGGTAT
GGGAACAACCAAAATAAAATTACTATAAGAAAACAAGAAGGAGTTTGTAAATTAAAAAAA
TTAATAAAATGTAAAATAGAAATAAAAGAACAAAATGAACATATTAATTTGAGAAATGGT
TCTTAGTAAAATCCAGTGAAATAGGCACCAGCCACGTACACCTGAGCTGGCAGATTCGAA
TCCAGCCCGGGCCCACCAAATAACAATGATGGCTGCAACCAAAAAAAATAGCCAGGCATT
GTGGCAGGTGCCTGCAGTCCCAACTACGCGGAAGGCAGAGGCAGGAGAATCGCTTGAGCC
CAGGAGTTGGGGGTTGCTGTGAGCTGTGATGCCATAGCACTTTACCCAGGGTGACAGCTT
GAGGCTCTGTCTCAAAAAAAAAAAATAGAACTAAAGGCAAATAGACAAATAACCTAAGTT
ATAAAATTATAATCACAGAAAAAATATAGAAAAAGAAGACAGTAAGAAAATATTGATCAT
AAAAATCTACGGTAAAGTGTTTAAATCTTTTTTTGTTATAGTTGTTTCAGGTTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCCTTCCCCCTCTCTCTTCTCTTT
TCCCTCCTCCCTGGTTTCCCTGCCCTCACCTTGAACTGATTCTAGTTTTTCTCATATGTG
AGCATGTATTAGGTCATCTGCTCCCTTCGTATTAGTATTAAGTACATTAGATTCTTGCTT
CTCCATTCTTGTAACAGCTTACTGAGAAGAATGTGTTCCACCTCCATCCAGGTTAATACA
AAAGATGTAAAGTCTCCATCTTTTTTAGTGGCTGAATAGTATTCTATGGTATACTATTTT
GTTATACCACAGTTTGTTAATCCATTCCTGGATTAGTGGGTATTTCCACATTTTGGCAAT
TATAAATTGAGTTGCAATAAACAATCTCATGCAAATGTCCTTAAGATAAAATGAATTTTT
TTCTTTTAAAATGTATAGTCTACTCAAAGCAATCTACAAATTTAATGCAATCCCCATTAA
AATACCAACAATATACTTTGAAGAACTGGAAAAAACAGTACTTAGTTTTGTGTGGAACCA
GAAAAAAAACCATATAGCCAAGGCTATTCTTAGTAATAAAAACAAAGCTGAAGGCATCAC
TCTACCAGACTTCAGGCTATATTGCAAGTCCACAGTAAGCAAAACAGCATTGTATTGGCC
CAAAAAAATAGAGACATAGACATATGGAACAGAATACAAAACCGAGAGATGAAACCAGTC
TCTAGTTTCCATCTAATCTTTGATAAACCAAATAAAAGCATACACTGCAGAAAGATATCC
CTATTCAACAAATGGTGCTGGAAGAACGAGATAACCACATGAAAAACACTAAATCTTGAT
AATATAGATAATTTTCTACAAAAATATATATGTCTAAAATTGACTAAAGAAGAAGTACAT
TAGGAAATCTAAAATATTTAAAATCTAAAATTTACATCTAAAAAAATTATGAATTTTTTT
GTAATTATAACCCCTTAAACAAATAAGAAATACTCCCCTAAAAGCATTACGGCTAAATGC
TTTCATGAGAAGAAATGTTCCGTGTTCATTCAAATACTGAAGGAATATATTACTCCTATG
CTACATGAATTCCTACATAGCTTTAGAGAATGTCTAACCTTATGACAAGGTTATTATAAC
ACTACTATCAAATCCTTTTAGCTAATCTAATTAAAATATAAGTTACACTTTTTACTGGCA
TGTTATCTATACTTTATACGCTTCAATGAATTTATGATGCATGTTTTTGTCGATATGATG
ATGTTTCAGTGCTCTGAAACTATAGATTAACAGTTCAAAAGTTGGCACCCTATTTCAGTG
CCCTAGACAAGTAATGGTAGCGGTAAGGAGGCAGGAGAAAACTGGATGGGCCTGAGAGAA
TGGGGGATAGAATCTCTGGGGGATGGTGATTGATGCACCACTGATGGACTCTGGGGTCTG
GCTTAAGAAACTTGGTGAGAAAGGGAACCTGCTTCCTGCGCAAGAAGTGGTGTTGTGTTC
AATCCGGGACATCTTAAATTGAGGTAGAGACGCATCTAGGTGAGGATGAAACTTGAGGAA
GGTTTAGGACTTGGAGCTACAAGAGAAGCAGAAGACATCAATTGGAGATGGATGGTCAGG
GAAGGCAGTAGGGATGAGAACACGGGGAGTATGAGAGGGAAGAGAGAAATGCTTACTTCC
CTGTCCGTCACAATGGGACTTGATGTCATTCAATTTCCCACTACTAAATTGCTATGTGAA
AGTTAGCATGATTGTCTCTTGTGTGTAAGTCATCTTTGTGAGCTACTTTGTGGCAGAACT
ATGTTTTATATCCCTGCTCTATAGCAAATATTTATGAAATTAAATTGATGTAAGTTCATC
TAAAAAATGAATTAGGACATCGGAACTATACCAGCTTTGGGGGCATGATATATAAAGCTA
CACTTTACCAACTCCAGATATACGTGTATAGAAATCCATGTCTTTCCCACCACGAGACAT
GTAGGAGTCAAAAGCTTGATATAAAGCATACCTAAAGGTAAAAATGCTTGATCCCTAACA
CTGACTTTACTTCCGGATAATTCCTTTATTCTTATCAGACTTTCAATATAGTATCTTTTA
AGAATTTTTCACTTTTCATAGACATGTCTATTATATTATGTACTGAACATATTTCTTAAT
GGATATTGATAATACCCATGTTTTAAATTGAATATTTGAAATGAGAGCAAAACAAGGGCT
TTTACTTTTTAAATGATACCTTTTCACCTTACTTGTACCTACCAGCCTTGTGAAAAAATA
ATGACAGCAGTAGACTACTGAGCCTGGTTGATGTTCCCTAAAGACACTGAAATTCAGAAT
TAAGGAAGGTAGAAGAGAGAAAAGAATTCTCTAATTCTCATTCAGAAATGATACAAATAT
ATATGGTAAAGATTCGTTTACTGTATTCTTTACTAACTTAAAAAATGTTTCGAACTTGAT
TTGGTTTAATATTAAAATGAAACTTTAGTGTAAATTTAATACAATTTTTCACATATACCT
GACATTTCATTTTTTAATTTCAAAATTGAAAACAAAAGGCAGAAAAACACCAGAAACCTC
GTTCTTTCCCTCCACCCCTGTCGTACATCCCCCATTTTCTTTCCCACAGAAATTTACAAT
CGTGCTGCAGTCTGTACCTTGCTGTTTCAAACTAGTCTCATTTGTGGGGACCCTTCTCCT
TCCCCTGCCCTGGCTTCTCTTTCTTCCTCTCATAGTTCTCCACATGTTCTCACGGGTTTT
CAATTCCATCTGATGCAGACTGGTTTTGGTTATCTTTCCTTGGTGTCCAGTCACGTTCGT
GGCGGCAGTGTATCAGAGATGCTCGCGACATCAGCTGAGTGGTTTGGAAATCTCGTTCTT
CCCACTTCTAATTCTTTGCACTACACAGACCAATCACCAGTAGTGCCTCTAAGTAGGTTG
AAGACGCCCCTCCAAGTCCTCCTCATTCTATGTCACAGAGTCTCTTCTTCCCTTTGAAGT
TAGTAAAAGGAAACAAGGATCTAAGTAGTTAAGAGTCTCTAAAGGTATGAGGATGAAGCA
TGTCTAGGGATAACTAAGTGACCACAGGGACATTTGGAGGCCAGATGATAGTCTTTTTTC
TTAGAGAAACTCTATGGAAGCTCTCCCTACACTTTTGGAAAGAACTCCCAGATACAGGCT
TCTTCCTGTGGTGAACATGTGGGCTTTCTGAAATGCTGCACCAAAATGTGCTTCAAATAC
AGTTGAGTTAGACAACATCTGTGAGTGACCACACGCACCCCAAACACAGAGGCTGCAGGG
GTGAGGAAACCCTTCTTACCCTCTTGCTTAGAATCTGATAGAACTAATGGATAATTACTA
TATAGATTATATTTACTGAATCAAATGCATGGTAAATATTTTACATAGATGATCTCATTT
AGTAGCTCCCAGCCTCTAAAAAAAGATAAAGATGCCCAGGCTAGAATCTCATAATTATAT
GGCAAACACTATAATGGCAGTATGTGCTGGTTGCCATGGAAACACAGAGGAGGGACGCTC
GACCCAGTTTAGGGAGGAGCAGAACACTGCATCTGGTCTCAAAGTGGTAATTACATGAAG
AAGAGGAGGTTGGGACACCACAAGCAGAGGGAACATAAGCAGGGCATAGGAGTATGTATT
TGTGTGGTGTATGTAGGGAATTATAAGCAGTTTTGATTTGCTAGAGCTAAAGATGTAGGT
AGAGGTCAAGATTATGGAGTCACTAATCTGCCATATTTAGCCTTTGGGGGCATAAGCCAT
TGGATGGGGAAATACTGGCAAATATTACAGGGAGTGACATAAGCAATTTTTGAGTTTTAA
AAATATCAACACAGCGGGTAGGTAATGATTGCAGAAAATGAGACTATAGAGGTAAATGAA
GAGTTTATGGAACTCATCCAGGCAAGAGACGAGAAGGGAACATATCCTGATACTCTGGCA
TGCTACAGCAGTTCACGTGGAATTGCTAACTTAATGCAAAATATGCAAAGAAATTGAAGA
CTAAACAACCAAATTCTCAACTCTTAAACCATCTGACAGGGGAACAGTAAGAAATTTGAA
CTACAATGTTAAAATTAACCCAATTCTGCCTTATGTTGGAATTCTACATTCATAAAGAAG
AAAAGAAGGAAATATTATAGTAAACCCTAAATTGTAGTCTAACTTTCTCATAGTTGGCCT
TAATCAGTCATCACCAATGTTCATGGGTAAGAATTGACTGTTCAATGTAGGATGAAAGGC
CTACATTTGGTGAAATAATGTGACTTGAGTTCCAGAAAAGAAAGGAAAATTCCATAGCTC
TGCATCCAGGAGAATTAGGTGATGTTTTAAAAATATTCACATAGACATAAATTCTTACAC
ATAAAATTTGTACTTACCTGTACACCACAGATAGAAAGCTGTTGGCAAGAATGAAGTACA
TGTACCAAGACAAGAAAGTACATGAGTAGGAAAACAGCATCCCCAGAATCATTTCCCATT
GTAGGAAAGTAACTTAGGTTACTTCCTGAGACTGATAAAGAAAGATACCAGAAATGTAAA
TAATCATTGCCATTTATTTTCGATACCCAAAACCTTGTAAAGGCAAAATTTATTGTCTAC
AGACAAGAGCAGCTATAATTAATATGATGCAAAATTTTAAAAGAGCACTTTGACTAATGT
CTTTGATTAATATCCACCATAAATTTTAATCCCTGCTTCCTTACAACTGAAAATAGAGAG
TACACTCCAACTCAAGTTTACTCTTGTCTATATAACAAATCCAGTCGACTATAATTTAAT
ACATATCTGACAGTTGAGATAGCTTAATTTTAAAGTAATAATAGAAATGTATTGAACATG
AAAAATAGAATACTTCAGATAAAATTGCTTCATAAGTCATATATTACCCCCAAAGGAAGG
GAAGGTTACTCAGTCTAGTAGACTCATCTAAATGGGAAACAGGAACAAGATGAGGAGCAT
CAGTTCCTTTTTCTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
GCAGAGATCAGTGGGCTATCAGGACAGTTCTGTCACTTTCATGCAGACACGTCCAGTGCC
AACTACATTTCCTATAGAAATAATTCTACAACCACTGAGAAGTGAAGAATTGCCAGAAGA
AGACACAGAAAAGGGTTATAGACTTCATTACTTAAATGATTTCCAAGATCATATCTTGGG
TCTGTAAACCCACACATCAGACATATTCTTTGCCATTTCTCACCTTGTCCCATATAGTTT
GTCAGTGTAGTAGTCCAACTCTGAAATGACATGAAAACTTTCAGTGGGAGTTTTAACTAG
GGAAACTTTATTCACATTGCCATGAAAAGGCATTTTGACTTCCTCATACTATGGAATACT
GACACCAAGAGAAGTTTTCTCTCTTCTATATTGTGATACAATCCAAAGCCAACTTGAGAG
CATATTACGGGAACATCTCAAACTCATGGGCAAGACATAGTAATCCAAGTTGACTCCTTG
GGTTTCCTTCTTAGCAAGCTGAGTAGGATTGAGCTCAGCCTATCTAGAGCAACCTACTTG
AGTTGACTGATTACAGCTAGAGCCACAGAGAAAAGTCTAGGGCCTTGTGGGGTAAAAGTA
GACATTATTGTTATTATTGTTATGACTAAAAGGCTGTGTGTAAAAAGAGTCGCTTTTCTC
CTTTATTGGAAAGCTCTCTACTGAGAGCTCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGAAAACAGGTAGCCATTCATGTTTAGACAAGCACCA
TGAGTGGCAACGATGCACCAAGTGGAAACCCGTGTGGCCCCTGCCAAAGGCCTTTAGCCA
TATGCCCAAGTCAACAGTTAAAAACAACTATACAGTTTTTTTTTTTTAATCTGCAATGAT
GGCAGTATTTTTCAGTCACATCAGTTTACCTAGTGAGTATTGATACTTTGGGTCTGAAAG
AAAAAAAAAAACTGCTAACGCCTATTTTAAGGTTAACCCCCTACATCTGAACCACACTCC
CCAGTTGTGCTCTGTTTCTATTTCTCATTGATCTGGCCCTGCCTACCAGTTTCTAATGCC
TTCCTGAATTTACTTCTCCATGCAAATTGTAGACCACTGCCAAATAGTCAGGCTTTCTGT
CACCAAAGGCCCCAAAGCAGAGTATCAAGTACAGTACTTGATCTCTGGAGGCAGCCCAGC
TTCTAAGCAGGTGTCCTCAAACTATGGCCTGTGGGCTTCATGCAGCCTGCCTAGGACATT
TATCCGGCCAGCCAGGTGTTTTTGCTGCCACTTAACAGCTGACTCATCCCGGGGCTCATA
GTCCAGCCCTCCAACAGTCTGAGGGACAGTGAACTGGCCCCCTGTTTAAAAAGTTTGAGG
ACCCCTGTAAAGGAAAAGGGTAAGAGAATAGGCCAGTTTCTTCTAACAAACATGAGCCAG
AAAACCAGGAGTGTTGGCCAGGCATGGTGGCTCACACTTGTATCCCTAGCACTCTGGGAG
GCTGGGTAGGTGGATTGCCTGAACTCAGGAATTCAAGACCAGCCTGAGCATAAGTGAGAT
CCCATTTCTACAAAATATAGAAAAATTACCCAGATATGGTGGTGCACAGCTATAGCTCTT
GCTACTCAGGAGGTTGAAGCAGGAGAATTGTTTGAGCCCAAGAATTTGAGGTTGCTGTAA
ACTATGATGCCACCACGCTCCACCAAGGGCAACAAAGTGAAACTCTATCTCAGAAAAGAA
AAAGAAAAGAAAAGAAAACCGGGAAACTAAATGTGTTTCCTGCATGTAAAGGCAAGTTAG
GAATGTCTAACCCCTTTCTCTCATAATTATTATTATATATATATTAGTAAAACTTTATTA
TTTTGCCAATAGCTAATAAAAAACTGATTTGTGAAATAATTTAAAAGAAAATATTGCTAT
TTTTATGCTCATGAATACAAAAATATTGTTTGATAAATTAGGGGATTTCTTTAATAAGTA
GATCAAGCTACCAAGTATGTATACACATCAATGTTTATTTAAAAAAATGTTTTCCACTCA
AAATATTCTCTATGGACAAATAATTAACAGTGCACGAATTTTTTTCTTTATTGTTGAAAA
AAATGAAGCTTACAAGTGATAAATTGCCCTCCTTTACATAGATGACTTTTTACCATATTC
TTAAAAGTAGAACTGCCAGCTCTGTAGAGATCTGAGGGATAACCAGGTCCTGGTGTCAAT
GTTGTAACAGAGAACTGAGTGAAACTGCAGTACAGACAGTTATCCTTAAGGAGGCACCCT
TGTGGTGATCTCTTCTTGCTGGTGGGACCCCCTCTTCAGTATATGAACACCCACTGCATG
TTGGACAGATACTGTCCTCTCCACTCTCTAGGTCTCTTGTGGCCTAGCACTGGGTACCAT
CCTTTAAGCCCCCTGTCTTGTTCCTTCTCTCAGCTAACTGATGAGAAGAATCTTAACTAA
TTCATGATGAAGAACTAACTGCCATGTTTGGAATAGATTAATCTAGGACTCAGTACCAGA
CTTTTTCCATCTCACATGTAAATACGCCTTTACCCGAAAGAAGGCATTTACACCTGTATC
CAATCAGAGATTATTTTTCTTACAATACCTTTCTGGTTTTCCTCAACCCATCCAAAAGCA
TAGCCACCTCCCATCTCTTGAGAGACTGGACTTACCAAGAGAAACTGCTTATCAAGGCTG
CACTGTGCTTTCCAGCTACTAAGGGCAATGCAGATTCATGATGATGTGCTCTGTGACATT
TATATTGAGCTGGTCCATTTATCCTCGTCTCTGTTTAGCCCATAGATGTGAGAAATGCAT
TGTAAAATTTGGAGACTAATTAATTCGTATGATTTTCAACCCGACTTATAATGATACCAG
AATATTTCAAATTGTATTCCTTATGCCCAAATTGGTGATAATTGTGCTAGACCCTAAGAT
GCGACTGATTTATTGACACCTTATCCTGAAATGTTTAAAATGAAGACTGCCTGATGTTTT
TCCTTCTTTGAACTAGGAGCTGAAGCGAATTTTATGCTGAAAATTCATCCTCTGAAGAAA
TATCCTGTGGATCTGTATTATTTGGTGGATGTCTCAGCATCAATGCACAATAATATAGAA
AAATTAAATTCTGTTGGAAATGATTTATCTAGAAAAATGGCATTTTTCTCCCGTGACTTC
CGCCTTGGATTTGGCTCCTATGTTGATAAAACAGTTTCCCCATACATCAGCATTCACCCT
GAAAGGATTCATAATCAATGCAGGTATCTAATGTTTGATGTGGATGATGCTGAACGCATT
TTTGTCTCATAAAATCTCACTTTGTCCGTATATAAAGAACTTACCAAACTTTATCTTTTT
GTCTTATGCAGTAAGAATTAAAAATATTTATGGGGCAGCACCCATAGCTCAATGGGTAGG
GCACCAGGCATATACAGCAAGGCTGGCGAGTTCGAACTCCACCTGGGCCAGTTAAACAGT
AATGACAACTGCAACAAAAAAATAGCCAGGCATTGTGGCCGGCGCCTGTAGTCCCAGCTA
CTCGGGAGGCAAGAGGATCACTGAAGCCCAAGATTTGAGGTTGCTGTGAGCTGTGATGCT
AAAACACTCTATTGAGGGCCACATAGTGAGACTGTCTCAAAAAAAAAAAAAAATGTGAGA
GGGAGGGGGTAGCATCGAAAACCTTCTAAGCTTATAGTCAAATGAGCCTTTTAGTTTTAT
GGTCGCATTAAAATGACAATCACATCCAGTTGTATCACCAAACAATCCCCTGCATAAGTG
TTAGTAACTTGGATATACCTTCCATAATTAGGCTGCTGTGTATATGATACCCCTTTGAAA
ATCTGTATTTTTCCTTTTTGAATGGCTCCAAAATTTGGTGAACTAAAGTTTGACCACATA
TTAAAGTATTTACTTTGCCAATACAGCCTCTCTCTCTCCATTACTGTGTAGTGACTGTGT
ATAAATACATTGCTTATGATGGACTGCAAAGAAATCTCAACCCTCATATGGAGAGTGGGA
TAAAAATTTGACTGCTTAGGAAGAGCCTTTTAAAAAATCAGTTTGGAATCCTGATCCTAA
GTAGCACATGCCCAACCATGAATGAACTAAGGATAAAAATACAAGTTTCTCACACAATAT
TGTCATTAGCCTGCTGAATTTTCAGAGACATAAATCTATCTAGTTCTTTTCTCATAAGAC
GGTTTATTTTTAACATCTTTTCCACTTTCACAAATTGTTCAGATTGCCTTCTGATGCATA
TTCCAATTCATTGAAATACCTCTATTATCTGCTCTACCAGAACAGCACTGATTATCTCCT
GAGGAAGTCTCATGAGTCTGCCTCTTGAGCACCTGAGGGATGATTCTTACTTGTTGGAAT
ATAATGGAATTCCCAGAATAATTTTAATGAATTTTGATTGTTTATCAAAATTCTATACCA
AGCATCATTTAAAAAATTTGTAAGATGTTTTTAGAAAGAAATCAAACGATAACACGATAT
TTCAACTAAATTCTTCTAAAATATCCTCCCACCCCCAAAGAGTTTCTTAGTTATCCCAGG
GTCATCTGTGATGAGAAATCACTCCAAATTCTTATAATTCCCTCAAAAACTTACGATATT
ACAATAAACTTACAATATTAGTATATTGAAAGCCTGTAGTTATCCCGTGTTAAAGAAACA
TGTTTAGTCTTCATTTATTGAACACTAAACTCTTTTTGTTCTGTTTTTACTTGCAGGAAA
ATAGTCACCAATACTGAACTTCTCTCTAATTTTATAAGTACAGGTTCTTGTCTTATAAAA
CTTCCCCCTTTTCACACAACTACACAATTGTACTTTAGTATCGTTCTGAACTTTTAAGGA
AGTGCAGCAAAATAGACTTTGCATGTCTTCTTTTCTCATGTAGTGATTACAATTTAGACT
GCATGCCTCCCCACGGGTACATTCACGTGCTGTCTTTGACGGAGAACATCACAGAGTTTG
AGAAAGCAGTTCACAGACAGAAGATCTCTGGAAACATAGACACACCAGAAGGAGGCTTCG
ATGCCATGCTTCAGGCGGCCGTCTGTGAGGTAAGAGGTTTCACGGTATGGCGTATTTGGT
CAGATCTTTTATTTCCTTTTTCATTTAAAAGTCAAAATATACTATGCAGCCCTAAAGAAG
GATGGAGACTTTTCCTCCTACATGTTTACATGGATGGAGCTGGAAAATATTCTTCTCAGC
AAAGTATCTCAAGAATGAATGAAAAAGTATCCAATGTACTCAGCCCTACTATGAAACTAA
TTTATAGCTTTCATAGGAAAGGTATAACCCAATTATAGCCCAAGAATACAGGAGAAGGGG
AGAGGAAGGGGAAGGAAGGATGATTGGTGGGATCACGTCTATGGTTCATCTTTTAAGGGT
ACATGTGAATCTTTCTAAATGAAGAATATAAATGTCTTAAAACAATAACTAAGAAAATGA
CATGAAGACTATGTTAACCAGTTTGATGAAAATACTTCAAATTGTATAGCACACTATACC
CCATGACAGTATCAATGTACACAGCTATGATCTAATAAAAAATAAATAAATAAAAGTCAA
AACATACTAGAGATGAATACAGTCTTCTCCTATCTCATACTCTTAACCAAGGTTATTTTT
TCTTCATTTGGTATGTGTTTGGGACAGAGGAGCTAATTTGGGAAAGGGATATAAATAGGA
AAAGATAAAAAGGAAAGAATAACTTACTCACATGGAAATTCTTTCCAAAAGCCTTTCTTT
CTTAATCTGCTTTTTTGATGCACCACACTCCAAGGAAGAGAGTAGACTGCCACCTACTCA
CATTAGCTTGTCCTACTTTGTTGGCTTAATCTTCCTCTAGTGGAATACTAAGAAGACTCT
GGCCAGGGACTTGTGTGCCCAAATGACTCTGGGAAAGTAGAAGATGTGCACGTGAAAGGG
AATTCAGCATCGTACTTATGCACATTATTCTAGCCTGCCATATGTTCACCAACTCGAATG
TAATGTTTACTTGAGGTAGAGACCACAAGACAGATCTATGTTATTGTACAAAGGCTAATT
ACATGTTTATTTTAAGAGTCATATTGGATGGAGAAAGGAAGCCAAAAGATTGCTGCTGGT
GATGACAGACCAGACATCTCATCTTGCTCTTGATAGCAAATTGGCAGGCATAGTGGTGCC
CAATGACGGAAACTGCCATCTGAAGAACAACGTCTACGTCAAGTCCACGACCATGGTAAT
GGAGCAATAGCCCTTTTGTAGCTACCACTCTTTAAAGCACGAGTTTGAATTGGTAGTTCA
GTTGTTCTAGTACCCAGAAATTGCCTTAAAAATGCAAGATACAGAACCAGGATAGGCCAT
GAAAGAGAATTTGTGGAGCAATGCAATCTATAAATGCTGATCTTTAAAATATTTGGCTAA
GATACTTTGACAACCTTTAGTGGCTTACTCTCTGATGAGCCACAGAGCACTGCATGATTT
TTGAAAACAAAAATGTTATGAAAGCTGATTTCAATGCAATTGATGCAATTCAAGGACCCT
GAATGGAGACAAAATTATACCTTTGCTTTGTCCCAATAAACATACTAAGTAAGGCACTGC
TGTAAGTAAGTTGTATTTGGCCTGAAAACACCTTACTCTACAATAGGTAGAAACTGCAGA
GACTGGGGAGCGCAGAGTGAAACCAAGTAAAGTCTCTCTACTTTGTGGTTTCCTCTGGGA
CTTGTCTGTGTTTAGAGCCTCTTTTTAGGTATCTGGGTTGTTGCTTGAAGTTTCAGTTCA
TGTAAGGTCTAAATCATAGATTTAAATACAATCTTCTAGAACCACATCTTCACCAGCATT
AGATGCGAAAAATCAACAGCACAAAGCATCATTTATTTCTGATGTTGACACCTGCTTATA
CATTCTTCCAAGTGTCAAAACAGAAGGTCTCAAACCTTCTCAGTTCATGGGACCCTTGTG
TCTCACTGTTTTTTGTTTTTTGTTTTTTTTCCCACGGTGCCTCTAGGCCAAAAGAAATAC
CTAACAGAGTTCTGTTTTTTAAGTAATTAGATGCAAATAGCTTACCTACTTATGTCATAA
CAATCTAGTAGCCAGTTGAAAAAGTAATACCAATAAATCAGATATGCAGAGATATATTTG
TCAGTTTTAGTAAGTAACTTATTAATGGAAACTCCCCAAACTTTGTAATCAGATTGGCTA
CGGCTACCCTCTTTTCCTGTTCCACACTGATTTTTAGGTTGACTAACTTGGCAAAGATGT
GATGCCACTTAAAGAAATAGAGCCAACTGCAATCTTAAAACTATGAATTACTTTAAACTA
GTAGTTCTTGAGTGCCTGATGTACGATTGAGTATCACTGTGTGGTCCTTGAAAATATGAA
CTCTTTTGTGCACCTTGGGGGTATCCAAGTACTCGCACACAGTTGGGACCATAGGGTGAG
AAGCATATAAATATGCTAAAATCTGTGTCATTCCATTATGCAAATTTTAAATAGACCTTC
ATTTAATGTGGAGCACTGATCCAGATTTGCCAAAAGTCTGGAGGGACAGTTGTACCCATG
TTATCCCATGAAACAAGGCCCAACCCTTGATTAGTTCAGTTTTCTGAAAGTAGTCTCAAA
ATGTAAATGAAGGTAACTAAAGTTTGAATGTAAAAGTTTAAGACTTAGAGTCAGACCCAT
TGTGTTTTCTCCTTCACTAATTCTTTTCTACTCAGACTCATCACGCTGGTGGACCCACCT
ACTTAGTCACATCTTATCTATTCTTTCTTCAATTTGGTCTCTTTTGGTTAGACAGAGACT
GCTAATTTATTTATTGTGGAGTGGAGGAGGAAATATTCTATTGTAAGACAAAGAGAAGCT
TTTTATTTTTTTAGGAAGGAATAACAATGACATTATTCTCAAATTGTGTTATTCTTTTGA
AGTTCTGCCAAGTTGCTGAAATCATCTCTCCACAATGGTATGTGAAAGGATGCTGTTGCT
CATCTAGGGAGGATTCCAGAGCAGAGACGCTATCATAATTGTAGATATATACCATGTCAT
AAAGCTTCACAGAAATAAAATTCAATTCTAGTGGAATGTAGATAGCCCTTAGGTTCTTAG
GATACCAAGACATTGAACAATACATCTAGAACTTCTTTCACCTTCTTGCTCATTGTTCCA
TTTATTTAAAGGAATGACCCTTCCACGTTTCACTGGTGTGGTGTATTGGTTAGTATCTGA
GAAGAATATTTTTATTTCAGTTACCTTAGGTCACTTTTTTTTTTTGAGACAGAGTCTCAA
GCTGTCACCCTGGGTAGAGTACCTTGGCGTCATAGCTCACAGCAACCTCAAACTCTGGGG
CTTAAGCAATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGGAATACAGGTGCCCACCACCA
TGCCAGGCTATTTTTTGGTTTCAGTTATTGTTGTTTGGCAGGCCTGGGCTTGATTTGAAC
CCGCCGGCCATAGGTCAATGTTTCAAGTCATCCTCTTCCTAAGAATTTTCATTCCCTTCA
TTTCTAGGGACACTGCCCTCAAACAAAAGAAGTGGAAAGCATTTGAATGATCACCTAGCC
ATGCATTTATGTATACAAGATGTGCTTTTGCTGTGAAACCTTTTGGCTACGTTGACCTTG
ACACTAAGCATTATTTTTCTACCCATTTTAAAATGATCTCTATCCCCTCCTCTTCGGCCA
TTAGGAAGGAATTTTTTTATTTTGTATAACACAAGTAATCAAACACTTTGTTTCTTGGCT
TTATCTCCAGCAGCCAAAATACCCATCATGTTGAGCAGTATCTGAGCTTCTTGATTCAAG
ACTCTTTTTCCTTTTATTTATAAAAGAAAATAATTGATAAAAGACCTTTCATATGTCTAA
ATTACGTGGGGCAGAGTTATTTCTATTGCGGGTACACATAGTGATTTCCTGAAGGTCAGT
ATGAACCCCAGGCTTTTGAGTATATAGTTAGTTATACCACAACATTGTAGCAAACACTTG
GCCTACAGTTACAAATTTTATCTTTACGATAACTCCATAGGGCAGTCATAATTATCCTTC
TTTCTCAAAGAGGAGGACTGAAGGTCAGAAAAGTTAAATCAGTTTACTGCAGAGCTGAGG
CCAACACAACCCAATCTCAAATAAGGATTCTGTATTCTTAACCAGTTTGCCACAGTGTTT
CAACTGAAAAGTAAAAAAAAAAAAAGAGAGAGAGAGAGAGAGAATGTATCTTCTTTGTAT
ACTTTCTGCTCTGATGTTCTGGTTACAGCCTGACTTATGGACTATAACCCACATGATGTG
ACTTAGATAAATTACAAAACAGTATATAATCTAAAATAGCTTACATCTACACATTGTTGA
TATGGCCCTTAGCAAAAGATGTCACACTGTTGAATAAAACACACTTTCCACTGATTTCTC
TTCAAAATCAAGTGCTAGAATAAAAAACTTTGTAGTTTTATGATTTACCCAGTAATTATG
ACAATTCAAAGTATGGCATTCTGTCTATAATGATAGATGTTATTACAAAAGTTATTAACG
GTGTAGGCGACAGGTTATTAATACTGAGGGCCTGGAATTTCACCCTTTCTCCCCACCCTG
CTTCTCCAGAGTTATTTCCAACCTCAATCAGAGCCCTGCCAGAAACCATGCGCCCCGCCC
TTCGCAGAAGCCAAGAATAGCACCAAGATCTTTTCTAACAATGAAAGGAGACCCAGGAGC
GAGGGTGTGGAGGTCACCCGACGAACCTTATCAATGGGATTTTCAGATGGCTGTGTGACT
CATAGCCCTGAATAGAGAGATTCAAACAGGCAGGATCCTACCATCCCCTACTGCCTGTGC
TGGTACAGACGATGTATTCTGGGTATTCGCTGGTTCAGGCTTGGTATTTTTCCACACAGC
CATTTTTACAGGGCCCCATTACAGGATGGTCAGAGACTCTTCGACACTCCACCTTGAAAT
TTCCCTACCTACCACTGTCCTGATAGTTCACGTCTTTTCCTGAAGCCTCATTTGGGTAGA
CAGGTTGCCAAATGGATCAGCACTTTAGAGTATTGAGAGAGAAGTGCAGAAGGCGTCTTG
GGCATAACTGAAGAGTTTGGCTTCCTCGTGGCTAAAGTCAACACAGTACCTGTTTTCAAG
AAATTTTAACATGTCCTTGACTTTGAGTATGTCATGTAGGAAGCTCTCTTTTTACCATGA
ACTTCAACTACATAGAATTATATTCAATTTTTCCAGAATTACAGATGAAGAGAGCTTAAA
AAGTCACTTAACTCATTAAATTCATAACTTAGCCGCCTAAATGGACAAACTCTCATAAAG
TTATTACATTTATTTTACTGCTCCACTTTTTTTCAGGAAGGAATATTTTCAATGTCTGGA
AAGCCCTGAAAACTAATGTCAATAGTGGACATAATCCCATTGAAGGTGATAATTGTCCTC
TTTTAGTTAAGAGACTTGTTAGTATTTTTGCTGCTCTGTGACCAAGAAGTAACCTCCTCC
ACTTCAGAAAGCAGTGTGTCTCTTTTTTCTGCTTTTCGGCTTTTTTTGTCTTGAGCATAT
GGTAATAAAAATGGAATTCATTGAACACTTATTTTGTAGCAGGCACAGAATGCAACAAAA
AAGATTTTAGTCAATTTGCAGTTTTAAGAAAAATAGTACAGGCAGTCCCTGGGTTACTAT
CGTAAGTGCAAGCTATATGTGAATCAAATGGTAATAACTTGGGACTGCCCGTATTACATC
TTGTGGGGCTTTGAACAAGCAATCAAAACACCTGATTTCGGCTTGCTATTTGCGGAACTT
TCTGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCAGTCTCTA
CAAAAAAACAAAAAAGAGCATTGCAGCTTTAGTAACGGCCCCTAACTGTGTTTTACTGAG
CAGTCTTCTAGGAATAACTGTCTTTTCCAAAGCAATCCTGCGGGGTCTGTTCCCTTTACA
CTCATGTAGTGCCATCTTCTGTCCCAGTAAGGATGTAGATAGTGCTTTACTTCTATTTTA
TAAATGAGCACAGAGCAGCAGAAATACACATATCTAAAGGGATCAGAGCCTTAGCTGCAG
TTACACACACCCACACAGCAGTGCCTGCAGGAGACACCAAGCAGTGTGACCTCAGGACAT
GAGCCCTCCTCACCCTTGATGCAGGCTTGGTACACAGTAATTACAGAAAGACAGGTCAAA
GCCTTCACACCTTTTAACCTATTTGATCTTCATCATAATTCTGAGAAGTAGATACTAGTA
TTTATACATATGGAAACTTAGGTCCCAGAAAGGTTAAGATAGCCCCCAGTGTCACACTGG
GAGTAATTGCAAAGCCATGAGTTGAAGCCCCCAGTGAAAGCCCCCGCAGGCAGTGTGGCT
CTCAGGTGGAGAGATTTTGCCCTCCAGGGGACATTTTCAAGTCCTCAGACATTTTGGTTG
TCACTTGAGTGCTACTGGCAGCTATTGGGTAGAAGCCTAGGGTGCGACTACTCATGCTAC
AATGTCAGGACAGCCCCTTTCCTGACAAGAAGCACCCAGCCAAAAATGTCACTGGCATCT
CTTTATGTTAAGAAACCCTAGTCTGGGCAGTTACCATTGTACACCCATGTGGCTAGAACA
TCGGCCACCAGGATAGTTGTGAACTAACTTCAAATACATCCTTCAAAGTTTCATCTGAAA
TGAATCCAGCTATCTGATTGCTTCCATGCTATTTTTTTCCCTTATAAAGAAAAATCTAAA
AACTAATCCAAATAACTGAACATTTTATTTAACTAAGTTCCTGGGGGTTTTATATCTTGT
TACAATATTCAGTACTGCAGATTTTATTTGTAAAACTTTTTTTTAGGAGTCTCACTTTTG
AAAAGAAAATCTTAGACATTTTTGTCTACCTAGATATATGCATTATTAAAATTCCACCGT
ACATCTCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTATGGTCACT
GTTTCATAAAATATCCTTAATCCATTGGCACTGTATGATGTATTTTTGAGATGAATTATA
ATGCCAATCATAAATCTACAATTCCTTCCAAGTCCATTTTTATGTAAGTCATACAATTTT
CATGTAAGTCATACAACTTACTTCACAGTAGATGTTTGCACATGTGTGGGGCTGAGCTAC
TGAATTTCACTCCCTTCTTTGTTTTATTTTCCATTACAGGAACATCCCTCACTAGGCCAA
CTTTCAGAAAAATTAATAGACAACAACATTAATGTCATTTTCGCAGTTCAAGGGAAACAA
TTTCATTGGTATAAGGTATGTTAATACTCAAAATATAAAAATAAAAATATTTGCATTGAT
AGTTGAAATTAGGATACTTTTTAGAGACAAAAATTAGGATTCTGGAATTATACTTTATAC
CATCTTACTAGCTAAAGCATACTTTATACTGTCTTAATTTAAAAATTATATGTAAATTCT
ATTTAGGTTTGTAACACCTAGAACCAAGTGTGGACACTAAATACTGTTTGAGAATTGTAC
TCAATACCGATGGGACAGCCTGATAATATGGTAGTGCTAAAGTTGAGAATAATGGAGACT
TTTATCAGGTGAAAAGCAGATAATGTTCCAACTCTATACCTTTCATGTCCAGACTCCTGC
GTATATTCTGGTACATAGGCACATCCTTATAGTAAGTTAAAGTTGGAGGCCAAGGCAGGA
AGAACGCTTGAGACCAGGAATTTGAAACTAGCCTGGCCAATGTAGTGAGACCCACATCTC
CATAAAACATTTTTAAAAGTAGCCAGGTCTGGTGATGTACACACATGTAGTTGTAGGTAT
ACTGGAGGCTGAGGGGGAAGGATCATTTGAGCTTACAAGTCCAAGGCTGCAGTGAGCTTT
GACTATGGCACTGCACTGTAGCCTGAGCACAGTGACACCCTTTCTCAAAAAAAAAAAAAA
AAAGAAAAAGAAAGTTGGAGAATATCAGCTTAATCTCCAAAAGCACCGACATATCAAGCT
TTGGTCTAGGTCATCCAATAAAAGGACCAAGCCAGTCAGCCTTCGTGTGTAGGACTAATC
TTGGTGATGTCTGGAGTCCTTTGGGTCAGATGAGACCCACTAGCAGAGCAGGCTTTTGGC
CACCACCTCATTCTGGAGCGTCAGGGATCCCCCAGCACGGAACTGCACTTCTGAGACCCT
GCTGCAGCTTTCTTTGCACAGTCTTGTAGTTTCTCTCTTCCCAGAAACTCTCTTTTCAAC
AGAAATAGGGCTGTGGCCCAAATCAAATGGCCCAAACTGCTTTATTAACAACAGTCACAG
CTTCTACTTTTTGGATACTCAACTCTTGTCAGGCACTGAATTGGTAAACATTAACTGACC
CCTTAGCCACTCATCATGATGAGGGCAGTCTTAGTAATACATGCTCATTTTAAAGAAAAG
GAACCACACTGAGGGAGGTTGAACACTTGTCCAAAGTTTTCTAACAGCCAGAATTCTGTG
CTGTGAGTCTCTGAGCTTCATAGCTGACTTTTAAATACTGTGCTTCTTTTTACAGTATTT
GCTTCCTGCTGTCTGCTGTTTATCATTTCTTCATAGTGTTGTTGGTTCTAGAAGATTCTC
CCTACTTCTTTTAAAATCCGCCACTGACTGAGAAACCCTTAGACCAGGTTTATTAGTAAT
TGAATTGGGCACAAAGTCAGAATCAATGGGCCCTGAAAGTTGGCAAGCTCGTGTGTGAGA
CCCCTGGGTGATCCTGTATTCATTGCTTTGACTGCCCAGGAATCTTTTTTATCAGTCACC
TTCTGTCGGGTTGTGACAGCCTCATAAGTGATCTCCCAAAATCATCCATTCTCCACCTGG
CTGCCAGGAGGATCCATTGAAATCACAAGTGTGACCCCAGAACTCCCTGGAGCAAAGTGT
TCCAGTGGCACCCTCTAAATTAGAGGACTGAGTCTCCAAGCGGCACCTGAAGACATCTGG
TCTCTCTGCCTCTCTGGTCTCACTCCCCTCTGCTTCCTGCCTGGCCCCTGGCCCTCCAGC
CAAGCTTCTAATCCTCCTGTGCCCATGCTCACCAGGCTGTTTCTTTCCTCTGTGTCTGTT
CTGACTTCCTACCCCCGTGCCTGGGAGTCCTTCTTTCTCGTTGCTTGATTAACTCTTATA
CATCCTTTGAGCCAGAGTTCCTAAGTCACCTCGTCCAGGGAAACAGTCCTTGATGACCTT
CTTCGCCTTTCATTCCAGCGCTTGCCAAGTATGCCCCTCATTCGGGTCTGTGCCTGTCTC
TATTCCTTCACTGTACAGTGTTTGTGAAACTGTCATTTATATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCTTGAGGTACTAGGAATTTTCTTTTAAAACAGACTTT
TCTCTAGAACTCAAAAAATATGTTCTTTTTAAGCTTAAAATCCGACTGACCTTCTTAGTA
AGCTTCTGACCAAAGTAAAACTTTCTGGATGTAAATTTTGTGTCCTTTTAGTCAGTGTGA
CTTCCTGTTTGGGGGAAGGAAGGAGATTAGAAAGGCTCCGAAAACTGCTTACATTTCAGG
CTGTTCTTTAAATATTGATATTAAGTGAATTAAGTATAAGCTGGTTAAAAACCTATGGAT
TAAATTGTCTTTAAAACATGAATAGTTGTAAAAAGTAAGAAGGGTCAGTGCCTGGCAAGC
TGTGATATTTTTGTTTGTACATGCAAAAATGTTTGAAAAGTAATTGTTGCCGTTAAAAAA
AAAAAATTCCCAGTACAGCTAGATTTACCTTGCCTTTATTTACTTTTGTTAATTCACTAG
CGTTGTGCAAACTGTCATAAACCTATTTTACGACTGTGTATTTTATTAGAAATAAGATAG
AAGAATTTAGGGGGCAGAATTTATATTTTGGATTTTTTTTTCTATTACTTTAAACTTCCA
TGCTTAAGAATAGCTCTGGGTAAAATTTTTTATTACCAAACCCATGTGGTAATATTTTTA
AGCCTCATAAATTGGTTTCATATCATATTCAAATGCAACTCATGAAAAAAAATTTTTTTT
CTATCACAGCAATTATAGCCTGTATAGAAAGAAAAGGATATTTCTCATGGCTTCTGGTGT
TAGTGACAGTATTTTTAAACACAAGGCTATATGGCCTTCTCATATACATATGAGAAGATA
TATATATATGTATACACACACACAAACATATGCATTTAATATGTGAGTCACATATTAAAG
TCACATATACTATAAGTGAAACTAGTTAATTTAGTTCTTTTACTAAGTTCAGATAGTTGC
CAAAATACAGAAATATTAATCAAGATGGTTTCACTAATTCTTCCTTTAAAGAAAACACAA
TTAGCATTGGCCGGTGCAATGCAAAGCAGTAAGGATGGAGAAATTTGAACTTGAATCGCG
TGATACTAATGAGGCTCAGTCACATAGTCTCTGGCTCAGGCAAGTAGGTATCAACTGACA
GGCAGAGACCACAAAAAATGGAGTTTGACATCATGTCTCCGATAGGTGTCTTCTATCTGA
TCTTGTTGAGGCAATCACTTTAATTTCTAGAAGAGCATNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTACAACAGGAACTTAATTATAATTGTGAATAGGAAAATGTG
TGAACAACGGATTTCAAAACTTTTCATAATCTGATTCCTTATAAATATTCACTCTTCATT
CGAGTCAGACTGGCTTCTTCTCTGTTAATTGCATCATCTGCCAGTTGGTTAGACCTTTCA
GCCTTTGCTCCTTCTCATTTTCTCTCCGGGAATACCTAGAGTCTTCTCCATAATTATTAA
GCGCCATTCATCATGAACATCTTCTACTTATTAACTATGATTTTTCCCTCTCAGGCTGGC
CCAGCATGCTTTAAAGTTCATTCTATGGAACAGCAGTTCTGTAGAATATTTATAAATGTT
ACATGAGAAAAAAGTTTGGTAACTAAAGAAGTACTGGGAAATGTTGCATTAAGTAAAGTT
AAATCCTTTGCAAATTACAGGCCTGCTCTGGACCTTTTAATTTGCAAACGTGTCTTTTGA
GTCTCTAAGTGGAAGAAACCATATGTAAGACTTCCCAAGCTTATTTTGGAAACCTTTTTG
GGTTCTAAATTTCGGGGGGCTGTGTTCCATAGAAGATACTTCCAGAGATCTAACTTCTGG
GTTTTTTAAGTCATCACATACAGTAATTCAAGATGCAAAGGCATATATGCACCCATGCTG
CCATTTCAGGCGTATGTTCTATCCTGTCCTATTAGGTTGCTCATATTTTAAACACAGAAA
TGTATAATTTGTTGATTATGAAACCATTGTCTACTATTGTCATTATTTAAATTATTTACT
ATTGAAATGCTACTAATATGTTTTGTAGGACCTTCTACCCCTTTTGCCAGGCACTATTGC
TCGTGAAATAGAATCAAAGGCTGCAAATCTCAATAATTTGGTAGTAGAAGCCTATCAGGT
ATGTATATATTATATAAAAAAAAAATTTTAAAGAAACTTTTAACCACAATTTCTATGGCC
AGATACAAGCTAGTGCCATATCATGTTGAGAAGAGGGGCAGAAAGAGCATTAAGTTAGCA
ATAAGGAACTGTGGCTGGCTCTATCACTAAGTAGCCATGGTGTCTGGAGAAAGTCACCTT
CCATGCCTCACTTGTCTCTTTGAGAATAAACTAAGATTTGGCTAGAAGCTGTCTACATTT
TCTTCCAAATCCAATGCTCAGAAAGTCATCAAATCATGGCTATATAATATACTTTATTAC
CAAAAAATTTCATAATTTCCTATGCCATAAAGTAAGAAATCCACCATTATTTAACGCAAT
AATCTGCCATGGAAAATGAACTATCTAGGACAGAAAGATGACTTTGAGGCCTCTCCTGGG
AGTGTCACTTGATTGTTCAACCAGTTATTTTACCACTTTCATCAAAATAGTCTGACTAAA
AGAATCATCTTACTGGGTGTCTGAGTTTGTTGAACTGATGACTTTTTATCATTCCTGTAA
AAGTGGATGTGTAAGTGCAAGGAATTTAAGGAAACACCTGCTTTCTCACTTGGTTCATTT
CTGGATATGATAATCTCTGTTTAGACATTGCAGGAATCGTGACTGTTAACTCTCGTACCA
CTAAGATCCATCACTTACCATTCATGACCTCATTTAGTCCTCACACCTGACCTAGAAAGC
AGGTGTTAGTACTCCCGTTATATGAGACTCAGAAAGTTAAATTAACCGAAGGTTGCCCAG
CTAATCAGCAGGAGAAGCAGGATCAGAAGCCAGGTGTTCTCAATTCTAGGCCCCAGGTGC
TTCCTCCTAGTTGATACCACCTGTTACTCATTTTCTACATGGTGTCAAAAGATATGCTTT
ATTCTGCCTTGAATTTATGGGTCAATTATAAGGTCTCACTTTCCCAAATTCTCCGACTCA
CTTCCCCCCGTGTATTGTTTAATGGTGTAAGTTGTAGCCACAGCACTGTGACAAACTTCA
GGCTTGTCTTATAATTTACTCAAGGCAGCGCCTGCCTTCACCTTGGGCATAAAAGGGAAA
GGCAGGAAGTAGACACAGGATATAAAATGAAGAACTTGTTTAAACTTTCTTCTTTTAAAA
GGAAAAGAAATCTTGCTAGATTTGTGTTTGAAGAGGGTTTTTTTCTATGTCTGGAAAGTA
CGTTGTATAAGATAAGGAAGAAAGTCTTAAATTACATCTTTTTCTCACTGTTACAAAAGA
ACGTTAGGCCTAGGGGAGGATTTTTGCAAAGAAAATCAACCATCTGTACAATTCATTTCA
TCAGTAGTTTGTTCCCCAGAATAATCAAAATAAGAAAGAACCATATACTTTTGGGAGCCA
TCTTCCACTTTATACTCTGAACCCATTTATTATTCAAAACATGGTAGAGGAGTTAACAAA
TGTTTATCTGTGGGTCCGTAAGTCTGCACCAAAGACTAAGAAGATAGCCACATTTGGTTT
CAAGTCCTTTATTTGCCTAGGATAGGTGTGGACACCTTAGATCCTTACAGTTCCGATTAA
TCTTAAACAGCAAAAAATATTAGTCATTCCAACAAAAACTTACTCTGGCTAACTAATCTC
CTTAAGTTGGGCTTCCTCTATTATTTTCTGTATGTCTGTATTTTCAATATTCTTCTGAAA
TTTCATTTTCACAGTCCAACAGAAACAATTCACAATTCCTTAAAGAATTGTATGTCAGTT
AAAAAAAAAAATAGATTCTGCCTCTGTACCTATGAGGTATCAAAGGGGAATGGGAGGATT
GTGCCTGGAGATTAATTTCTAAATCCTAAAACTGGGCAGGATTTTAGAGATGTGTATTCA
CTCTCTGCATGAAAAACATTGACCTGATTAGCTTAAGGTCTTAAGATATGTATTTTTTTT
TAAAAAGGACGCCAGTAGCACTGCAGCTCGCATTTCCTCGCCTCTGTCGGGCAATTCCCA
AAACAGCATAAATTATATACCTCCGGAACTAACTAGCAGTTTCCTCAAAATATTAAGAAG
AAAATCACAATTTAGGAGCTCTCAAGGGGATAAAAATGTAGCTGACATCATCTCCCCTAA
TGCAAATAATATTTACAGCAACGAAGGTGTCATGTTCTAAAGAGTAACTGCCCGAATAAT
TCGCTCAGTATCTCAGTCATGCTTGATCACTCACGTTTCTTAAATATTGAATGCATTCGC
GGAGGAGGAAGAAAAATCACTCAAGTAAAGAAGTGGAAGCCTCAGGGAATTATTTTTCTT
CTTCATATCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCATCTTAGCTTTACAGTAGTCTCAAG
TATTTGGAGAACCCAAATTATTTCTTCAGCAGCTGTGTATGGGAGAAGCAATTTCCCACA
TTTGTTGAGCTGGCAATATTTACCCTTTGTGACGACATATGTGTTCTCAATGTTTTATTT
AAATTTTGATCAGAAAAATAAGTGTTAACTGCATGTAAAAATGACGATTTTGGTAACAGG
CTGAAAAATAGCTTTGAAGAGATCAAAGTGCACAGTCATGGAAATATGTTAAAACAACAA
CAACAACAATTTTAAATGCAGACAATCTAATCCTTCAGTATTTCTTATATATTTCAAATG
CAATTAGGTCATTTGGTTTTATTTATCCTTTAATCAGATTTGTGATTTAGTTAAACATTC
AGTGTGTAAGGATTTAAATAGCTTGACTTTACTGTGTTGCTTAGATTTAAAACTACTATA
GTATATAATTCAAAAATGATGTCCCTCCAGAAACTCCTTTCAGAAGTGAAAGTCCAGGTG
GAAAACCAGGTTCCAGGCGTCTATTTTAACATCACCACCATCTGTCCAGATGGGACGAGA
AAGCCAGGCACAGAGGGATGTGGAAACGTGACGAGCGATGATGAAGTATGTGGATGTGCG
TTTTTTCCCGTTTAAAATCAACTCAGTTCTTTGGGGTACTTCCCGCAGAAAAATCAGCCA
TTCTGGAAAGATTTAGTTCCTATCAACCCCAAGAATCTTTATTTATATTTCAAAGTGACT
ATCATTGTCTCTCTTCTAAGTTTCTACTTGTTGTAACCCCATTGATAGTTCTCAAAAACT
CGCAAGTTAAAATAAATAAATAAATACATCTTATATTAAATATTTGTTCAATAATAGTAA
CTTCAAACTTAGGTTTCACAACCACTGTAGAATAGGAAATCACAGCTTCCCAAATGAGTA
CTGTCTATACTTATGAGGATGATAATGCTTTTTGGGGTTTCGAATTCACAAATTCTTAAG
AGTAAGTGTGAAATTGAAAGTCATAAGTCACCGAAATGAATGGGCATAATGGCACAGTTA
TTAAAGGCTAAGAATTCCAAAATGTTTCACTTTGTGATTACTCAAGTACGCTCCTAAGGA
TATAGAAAGAGGTAGAGAAATTTGACAGGCACGTTGAGAAAGGAGTTGTGAAATCTTCTG
AAAAGGCAGGAGATATAAAGCAGAGAGGTACAGACTACAGCAGCCCTGGGAGGCAGGACT
GGAGGAGAGAGGGACTGTCCAAGGACCAGCCCAGTACAGCGTGGCACACACAGATGCGCT
TTAGCAAGTCCTTGCAGGGTGAATTGATTTACAGGGAGTCATTTACCTGAGGTCTGGAGG
CATCAGCTGTCTCATTTTTAAATGAATGAGTAGGACTAGAAGATTTTCTAATCCCTCTTC
CTTCCACCTCCAAGGTTCTTTGATGGTTGATTATTTAATGTCATGCTATAGAGGGAAAAA
AAAAAGATATTAAGATAGAAAGTTCTAAGATGGAATAAAATAAAACCATTGTTTCTCTTT
GGTTAGAATATATTTAATCCCTGTTGGGAATTTTAGAAACTGTGGGTAGAATAATTGTTC
CTACAGGCTGTATATTTTAAATTAATTATTACAAGTTTCTAATTCTGTAGTTTCCTCTGT
AATCACTCTTTGGATTTTGTTCAAAAGCCATCATTCACCAGTTTGCAAAATACACATTTG
ATTTCCATTAAATGCAGAGAAAAGTTTTTACTAGCAAAAGATAGCACTAAGTTACTTTCG
GAAAAATGGTTACCTTTTTAGAAATAGCTTCTTTCCTTCGAATTCTCAATTTTGGAAGAA
TGGTTTGTCTGGCTTTGTACATTTTTTTTCTTTTTCTTTGCCTAATCTTTTTCCCTTCAC
TTTCAACCAAATAGTATAAATAGTGTGACTCTCAGGAATGGTCATATGACCTCTTCATTC
TATAAATCCCGTGTTTTGCTCTACTGCTAGTAATGGCAGTGACCACATTATCTCACGCAT
CTGTTAATCCTAAACGTTCTTCAGGACAATGCCAGTTCAAGTATAATACCAACTATGTTG
ATTTTAATTTAGGCGACTGAGTCTAATTCCTAATGCTTAAATAAACCTAAATTTAGCTCT
TTTATATCATTATACATGTTTTGCAGCTTGGAAAGAAAAAGAGATATATGCATACATGTG
AGAAACCTTCTTATTTGCTAGAGTACTTAAAGATGGTAAGGCGAATTCAACAAATAAAAA
GATACAATAAATCAGTCTTCTGTAAAAAGAAAGAAAATTATCAGGAGAAATAAACTAGAG
TTTTGTGCAGAAAACAAATTTCTGCCAGCCCTGCTCCTTAGTTCTGGGCTAATATCCTTT
GTTGAGGTCTCAAGATCTAAGCACAGGAGTCCTAGACTTTTTTCCCTCGAGTCACATTAA
AGAAAGCCTCATTGACAACTGCTTAACTAAAATTTAACTCTCAAACTCCACTTGGGCTCC
TAGAAAATAAAGACAAAATAAAAACTTCTCATTTGAACTTCTTCTCTATTGGCTTTAAAC
CAAGAGATGGAAGCCCTTTACTTTAGTTTCTATTTCCCTAGAATCACGTATTCAAGAACC
CCACATTTTAAGGATTGAACACTGAAAATGGCGTGTTCTTTCTCAAGTTTGCTAAGATAT
TAATCATCTGGGTAGAGTAAGTAGATACTTGAAGTCGGCCCACACCTAGGTCTGTGCAGT
GGTGCACTCCACGAACGGTGGCAGTCCTTGGACCTTTAATTAGAAAATAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAATTCATACATGTGAGAACCTTCTTATTTGCTAGAGTAC
TTAAAGATGGTAAGGCGAATTCAACAAATAAAAAGATACAATAAATCAGTCTTCTGTAAA
AAGAAAGAAAATTATCAGGAGAAATAAACTAGAGTTTTGTGCAGAAAACAAATTTCTGCC
AGCCCTGCTCCTTAGTTCTGGGCTAATATCCTTTGTTGAGGTCTCAAGATCTAAGCACAG
GAGTCCTAGACTTTTTTCCCTCGAGTCACATTAAAGAAAGCCTCATTGACAACTGCTTAA
CTAAAATTTAACTCTCAAACTCCACTTGGGCTCCTAGAAAATAAAGACAAAATAAAAACT
TCTCATTTGAACTTCTTCTCTATTGGCTTTAAACCAAGAGATGGAAGCCCTTTACTTTAG
TTTCTATTTCCCTAGAATCACGTATTCAAGAACCCCACATTTTAAGGATTGAACACTGAA
AATGGCGTGTTCTTTCTCAAGTTTGCTAAGATATTAATCATCTGGGTAGAGTAAGTAGAT
ACTTGAAGTCGGCCCACACCTAGGTCTGTGCAGTGGTGCAATACAGGTAATTTGGCAGTC
CTTGGACCTTTAATTAGAAAATAAATGACACTGAAAAAGGGATATTGCATACACGTTGAA
AGAGATTGCATATGTACTTCTAAATCATTGTTAACTTCTCTCAGATGAGTTATTTTTGAA
TCAAATATTAACAGATATAATATTGGTAATAAAAATAGTCAAGGCATATAAATGTATTTC
CTTTTTCCTCCTAATTTAAGGTTCTTTTCAACGTACTGGTACCATGAAACATGCGATGTC
ACAGGAGGAAAAAATTATGCAATATTCAAACTATTGGTTTCAATGAAACCACTAAAATTC
ACATACACAGAAATTGCAGCTGTCAGTGTGAGGACAACAGCAGACCTACAGGAAAGTACG
TGGATGAAACTTCTCTGGATTCCAAGTGTTTCCAGTGTGATGAGAATAAATGTCATTTTG
AAGAAGACCAACTTTCTTCCGAGAGCTGCAAGTCACACAGAGATCAACCCGTTTGCAGTG
GGCGAGGTGTTTGTGTTTGTGGTCAATGCGTATGTCAGCAAATGAAGTTTGGAAAAGTAT
ATGGAAAATACTGTGAAAAAGATGACTTTTCTTGTCCATATTACCATGGAAATCTGTGTG
CTGGTAAGGATAAATATACACAGGCTGTTTTTACTAATCACTGTTATGCTCACATCTATG
TTAAAATGGCTTTAAATCCCATCTTTATAAATTAACAACACTGGATCCTAATTTGTCATT
CAGTTTCATGAGCTGGGAAACTAGGGCGTGACAACAGATTTATAGCACATGATTTTAGTA
TTTACATTTTAACTTATTCTCTACAGGAAGTACTTCAAAATAAAAACCTTAATTAATTGT
CATTGTTACATATCCCTTCATCTTGGAAAGAAATATAGCAGGAAAGGAAATTACTGATAA
TGTCTGATACAGTTCTTTAAAGAATCAGAGTATTCTTCTTAGAAGAATCTGATTCATTCT
GGTAAATTTCCTCAAGCTTTCTCACAGGGTTTATTCCTGTCAGGTTGATAAGAAATGAGC
TAGTGGGTAGTACCTGTGGCTCAAGGAGTAGGTCCTGGCCCATGTGCCAGAGGTGATGGG
GTCCAAGCCAGCCTTCAGCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGCAATTGAGA
CTCGTCTCTGAAATCTTCGTGTATAAATATGAATTGTAGGGCAGACTTGGACTTTCTTCA
CTAGTCTCCTTTGGGAATAAAAACACATGTTCATGGGCCCCCTGGCTGGGACTCAGCGTG
CATGGCGGAGCGAGTCTGGCAGACGTTTGTTTGGCCTGAATCTCATTAGTTTTATGCGCA
GTAAATTGGGCTGATCCTACAGTACACGCACATTTACTCCGAGCTCAGCAATAAAAGAAG
TGAGAGAGGGAGCGAGGAAAAGAAAGGCGAGAGGGAAGCGAGGACGGGTGGAAAGAAGGA
AGGCAGGCAAGCATGAAAGGTACCCCTTCCTGAAGATTTCTGGTTCATATTGGCATCTTA
AATTTTGGACACTTTTTGCACTCTAAAATTCTTTTAACTACGTATAACCAGTGTTTCCTC
ATCTTATTTGTCTGCATAAATGTCCCCCCACATCATCATTTCTTTTTTTTTTTTTTTTTT
TTGGCAGTTTTTGGCTGGGGTTGGGTTTGAACCCACCACCTCTGGTATATGGGGTCAGTG
CCCTACTCCTTGAGCCACAGGTGTCGCCCCATCATCTTTTTTTTTTTCTATTTACCACCT
ACTAACAGCTCGCAACATAGGACATGCCCCAATAACCTAGTGAATAATGTTCTGAGTATG
CGAAAAAGTTAGTTCCACTTCCCAGGAGACTTTATCTTAACCATGGTACCAGCAGCTCTG
AAGCACTAGATTTACCGCACGGCCCTTCAGAATTACCCCCAGGCCTTTAGCAATAATGAA
AGACTGAGAGAATAGCTTTTGGAAGCCATTAATCAAATAACCTTTATTCTTTTGATTTCA
AGTCAGAAAGTTAACATTACTTCAGCCTTTGCAGCATCTTTATATTTGTGTGTTTTTAAT
TTACAGCTGAATGTACCATGACATTCAAGCAGGGAGGCAACCCCCAGGGCAGGGGCGCCC
TTCACACTTGTTAGCACAATACATTGGCATGGAGAGATTATCCAGGAGAGAACAGCTTTG
GAAATAGACACTCCTAAATCGCGGCATTGTTTACATCAGACCAATAGAAAATGATGCTGT
TTCTATTCACTAGGCTGTCAGTGTGTTTCCATGGAGATGGGAGGGGGATCCATGGCTGGG
GACTCTTCACAGAGTCAGTGGTCCCAATAACATAGGTCCTGGGGTGTCTTTGTTGCAGGG
CATGGAGAGTGTGAAGCGGGCAGGTGCCAATGCTTCAGTGGCTGGGAAGGGGACCGGTGC
CAGTGCCCATCAGCATCAGTCCAGCAGTGTGTCAACTCGAAGGGCCAAGTGTGCAGCGGA
AGAGGCACATGTGTGTGTGGCAGGTGTGAGTGCACCGACCCCAGGAGCATCGGCCGCTTC
TGTGAACACTGCCCCACCTGCCATACAGCCTGCAAGGAAAACTGGTAGGATTTCTCTGTC
TCCGGACATGCAGAAAGCAGTCCTTCCTGAAACCTGCTTCTGTCCTTCATCGTTCTGCTT
TCCTTTCCTTAATCTTAAAAGTTGCCAGATATATTGTTACTATCATGCTGGAAAAGAATT
AAATAAGAGATATTAGAAATTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCAGTTTCCTAATAAAAATTAGGAT
TCTGATAATAATACCCTCTTATAGTTTGATGAAAGAATTAAATGATTCATGTCAAAAATA
CTCCTTGTATTCAGTACATGGTAATCATAGAATAAATATTAGCTGTTAAGTTATTCCTAT
TATCTTTAATATTTTAATGGTAAAGAATCATGGTAACTGTGAAGCACTCTAGAAACAAAT
TATATATAAGAGAAAGGTGATATGTTAGATAAAAGTGATATTATTGTCTTGAGCCAAGTT
AGTTTCCCAATAACAATTTAACATCTGCTTAAAGAACACTAGTCTGGACACCACCGTCCC
TTCCAAATTGTTTCATTCAAAATTTTAAAACACACTTTCTCAAACCAGTAGCTAGATAAA
GTAAGTTATTTAGAATTATGTGTGGTAATTTATTTATATCATTTGAAAAGCAATATTTTA
ATACCGGAGTTAATTCAAAGAAACCCAATCAAAACTTGAACTATCTATTGATTGGTATTT
TGTCATCTTATTGTTTTGCAGAAAATATTACCATTTACTATCTTTTAAAAAAAAATGAAT
GTTTTCCTTTTCCCCCGTACAGGAATTGTGTGCAATGCCTTCACCCTCACAACCTGTCCC
AAGCTATTCTTGATCAGTGCAAATCGTCCTGTGCCCTCATGGAGCAGCAGTATGTGGACC
AGACCTCAGGTAAACCAGTCACAGTAACCCAGGCGCTGAAGGTACCTGTAGAGGGTAATA
CTCTCCAAAGGGCCCGTCGTTAACCGCGATGAAGAAAGTATGAATGGATTCATTTTTTTA
TTATGAAATATTGCCTTATTATTTAGAATAGTTTTATTAAAGTATCATTGATACACAAAA
AACTGTTCACATTAATATACACAGTGTAATAAGTTTGTGATTCAGTTTTTTTTAAAACTC
CCAGGGATTTTACTCTTAACCAATGAAGCAATGGAGCAGGCTTGCCATGATGTAGTTAAC
GTGGTATAGATTTTTCGTCTCATCTGCACAGCTCAATTTTTGTACTGTGTACCGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGAAGGGTATGGCACTTTCAGTCTGAAGACCTATTCCTAAAGCATGTC
CCTTACCGTTATTAGTTAAGGGGCTAATATCAGTCTACCTCCAAAATTTCCCTGAGCCTT
AGTTTTCCCATTTATAAAATGGAGATAAAAATCAACCTCAAAGACTTGACATTAAATGAG
CCAATGGACCTGGAAGAAATATCTGAAGTAAACGATAATGCAAAAATAGGAGAAAAACAT
GAGAGCTATTTTTTTTTCTAGAGATTATTTTTTTTTTCCAGAGAAGGGTCTCTCTCTGCC
ATTTAGGGTGGAATGCAGTGGTGCTATCATAGCTTACTATAATCGTGAATTATTGGACTC
AAGCAGTCCTCTTACTTTAGTCTCCCAAGTGGCTGGGACTATAGGCATGCATCCCTGTAT
GTGACTATTATTTTTTTTTGGGGGGGAGGGGGGTTAGAGAGAGGGCTTGATGTGTTACCC
AGGCTGGTCTTTTGAGGCTCCTGACCTCAGGAAAACCTCTCACCTTGGCCTCCCAATGTG
CTCCACACATGTAAGCCAGTGTGTTCAGACCTCAAAGATTTTTTTTTTTTTTTTTAAGAG
AAAGGGTCATGCTTTGTTGCCCTGGCCAGAGTGCAATGGCCAATCATAGCTCAGTGTAAC
CTTGAACTCCTGGTCTCAAGTGATCCTGCTGCCTCAGCCTCTTGGGTAACTGAGACTACA
GGGGCACCAGCACACCCAGCTAATTTTTTTTTTTTAAGAGATGAGATCTCAGTATGTTGT
CCAGGTTGGTCTAGAGTTCTGGGCCTCAAAGGATCCTTTCACCTCTATCTCCCAAAATTG
AAGGATATTTATGTATTTATTTTTAACTTTTAAATAAAAAGTTTATGAGAACCTAAAAAC
CCAGAAACCTGCTTTGTACTGGTGTAAGGTGTGGGATGATACATGAGTTAGCAATTAAGC
TTGAAATTATGACTTCATTGAAAACATTCCTATTGCTACTATTATTTAAAAATTTTCCTC
CAACCTATATGAAAAATTTTAGCTCTTAGGGAGACTATGCAGTAGAATAAACTTTCTGCA
AAGTTTGTTTCCTTTTTCCTTCACATCCACACTGAGTTTAGCCTGTAATGAATTTGGCTC
TGAAAAAGAGCCCATGTGCTACCAGCTGGGACTGCAGCAATCTCTCCAGAAAGCCAAGTG
CCTTTTCTAATAAATACCAAGATGTCATTTATTATGTTAAGTAAATACACACTACTCTGC
ATTAAGTGTTGTTACAAAAAGTATTCCCCTAAAGCTTCTTAGGAAAAGCCCTGGCCTGAC
CTAACCTATGAAAGGCATGAGCCAGGGGGGTAGATGTTCTACTATCCATAACAACACGTA
AAAATGCATGCCCTGTGAGTGTCCTCTGTCCTACCCGATTAGAGATATTTCTAAGATGTG
TCAGTAGCTAGGGGGCTCCCCTCCCCTTCACAACTGCCATGTAAGGAGAGGAAAGGGCAC
TCCTTAGGCACCTCTATCATCTCTCCACTCAATCACACTTAAAGGCTGTTCTTTAGTCTC
TCTGGCTGCTCTTCTACAGGCCAGAAGCCAGTGAATGGGTCAAACTCCAAGGCCCCTCTA
AGGATCTGCCTTAACTGACTGAGTAGTCCTAATCAGCCAAGGGAAGTGACAGCCCGTCAG
GACAAAAGGCATGTGTTGTTTGAGCCTGAGTGTCCTTGCAGAAGATTCTAAGAACACTAC
CTTGAAACACAGCACTCGGGATTCTCCCTCGGAGCTGTGCTGACTGGAGACTTTCACTGG
CATTTTATGTTTTCCCTCCAACCTGTAGCCTCTGACCTTTCTTTCAAGGTATCTTATCAC
TGACCAAAAGAAAACTGAGCTCCATTAAGGTTTTCCTCATGGAGAGGAATTCTTGTTTTC
TATCACTGAGTTCTTGCCTTAATCAAGAGCTCATCTGGTCATCACTGGGAATCTAAAAAT
AAATCACTCGTAAGTGGGGGGATGCACAGTTCCAAGCCTTGGCAGATCTCCTCCAGTGGC
CCTCTCAGGGAGACCTTGGACATTTGGGTGAGGTCCCCAAAGTCTGGAGAATGGGCAGAG
AAACGCAGGCCTCGTTAGGCCAGGAAGTAATTTTATGAATCTAGGGCAGCGAGTGAATTC
TGTGGAATACAGGCCTATTGTGCAACCGTGTTCCTCTAAGATTAGGGTAATACCACTGGC
AGCAACAGAGCCTGTAGGCTTTCCAGTGAGAGTTTGGCAAGGATCTGGTGCTAAAATGGA
GATGGAGCATGTCCCTTCTCTTAACATAGCTTTTTATTTTTCAGCTAGTAATTACTTGTT
CTTGGAAAAATAACAGTGAATTTTTAGAGGCAAATAAGATAGATTTTGTTCACAGACATG
TAAAAAGCAAATTAGTGAAAAGTAAAGACAGAGATTTTCATATTGTCCCAAATTGGATGC
TCCTATTTCCTGGAGAAGCTATGGGTAATAGTAATGAAAACTTGCACTATAATTTCAGGG
GAAATATTTATTTATCTACTTTCGAGTAGTACTGATTTTAGCTTCTGCAGATGTTTACTT
TATTTTCCATTACTGGCATGGAACAAATGATAATAAGAGAAACAAACATATGTTAATGCC
CAAAGCTATTAAATATTTTAAATCCTATTTTCCACTTAGTGGCCAACAGCACAAACCACA
AACATGGTCTCTTTCTCTGTCAAGGAGAAGATTATGTTTGATTAAAGGGCTTGGGCAAAT
CCAGTTAATACAATTAAAGAATCAAGCTGCAAAGCAATAATATTATTGAATACATTAATG
GTGTTATTCTCCAAAAGAGAGTTTTCTGTTGAAAATACCTCAGTGATAAACACGCAATCA
AAATTAGAGAGTTGCCTTTTTGAGTCAACAGTAATTTAAGTCCCCTGTTTGGAAAATGTG
GATCACAAATATGTCTGGTCCTCTTTGTTAAGACATGATCATCCTTTCAGTGATAGAATC
CTTTGATTTCCTCATTCCTGTTTTTAACCCACGTATCTGTTTGCTTCATTACAGAATGTT
TCTCTAGCCTGAGCTACTTGAGAATATTTTTCATCATATTCATAGTTACATTCTTGATTG
GGTTGCTTAAAGTCCTCATCATTAGACAGGTGATACTACAATGGACTAGCAATAAAATTA
AGTCCTCATCAGATTACAGAGTGTCAGCTTCAAAAAAGGTCAGTGAATTCTAAGAAAGAA
TTACTGTGGGGAGTGGGAGGGGGTCGGGGTGCTCTCACTGAAAGGCACCGGGTGGGGGTA
TCTGACACACCTTTTATGTGTGGGACATAACCACGTAACTCTACCTAACAAAAACAAATA
TTTTGACCTGGTTGTTTGGACCCTCACATTAACCTGAAATAAAATTACTTTTCAAAAAGA
ATTTTAACGATAAAAATTCAGACTGTAAAACAAAAAGAAAAAGAATTATTATCAGTATGT
TATCGTCTACTCCCACTATTTAGACCATTAATTAATAATAATATTTCTTCTCCATCAAGG
ATAAGTTGATTCTGCAGAGTGTTTGCACCAGAGCAGTAACCTACCGACGTGAGAAACCCG
AAGAAATAAAAATGGATATCAGCAAATTGAATGCTCATGAAACTTTCGGGTGCAACTTCT
AAAAAACGATCTTAAAATAACTTTCTGCAAAACTGGATTTTTTTAAAAAAATAATTGCTC
CTAAAATTTATAATTGTAAAAGTCACAGGAGGAGACAAATTGCTCCAGATCATGCCGGGG
CCGGTTGGACCCTCGAATGAAGACCGACAGGCATCCTCATCATCATGTGACTCCCACAGC
TGCTGAATTTTCCAGAGAAAAATGTGTCTTACTACTGTTTGAGACTAGTGTCTTTGTAGC
ACTTTACTGTATTATATAACTTATTTAGATCAGCATAGAATGTAGATCATCTGACGAGCA
CTGATTACACTTTACAGGTACCTGTCATCCCTACGCTTCCCAGAGAGAGACAATGCCGTG
AGACTTTGGCATTGTGTCACTACAAGGGTACAAGCCATCCCCGCACCAAACATGTGGATG
AGAAAAATACTTAAACAGTGATATACAAATGCTGCCAAACACTGCAAGCATTGGTAGGTG
ACTAGACAAGAACAGCTAGATGAAGAAATGGTTAGCATTTCACTCAGCCCAGAGGTGAAC
AGATGGAACCTTAACTAAGGATATTGCTTTTGAAACTAGTTTCATGCATGTGTGTTTACG
TTTCTCTTCTTTTTACAAGATGGATGTTGATTCCAGCGTTCTCTCCTGAGTTGATGTTTT
GTTTTTCTTCCTTACAGGATACATTAATATTTATCACAGATGACTGGATTAAATAAGTGC
TAAGTTACTACTGCCATAGAAACCTAATAATTCAAGGTCACTTTATTAGAATACTGGTTT
GAAAAGTTGAATGTTAATAAGGGGTCTGTAAAGGATCATCCACCCTGAACGGCTTCAGAT
GCGGAGTTTTGTATCTTATCTAGTAAACTGGAGGGATTGTTTGGCTATTTCATTTGTCTG
ATCATTGATTCACAAGATACTTAAAAACTCTGCCTCAAGCAAAGTACCATGCTTCTGAAT
GAGTTTTCTTTTTTTTATTTTAACTCCAAGTAGATCTCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 30321..30406, 35936..36110, 47716..47962, 49603..49768, 50776..50934, 57519..57614, 61828..61917, 65010..65144, 68840..68854, 68857..68868, 68871..68909, 68912..69242, 72778..73003, 75742..75848, 80154..80317, 80639..80761
1001..1127, 30321..30406, 35936..36110, 47716..47962, 49603..49768, 50776..50934, 57519..57614, 61828..61917, 65010..65144, 68840..68854, 68857..68868, 68871..68909, 68912..69242, 72778..73003, 75742..75848, 80154..80317, 80639..80758
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved