Otolemur_garnettii Locus TCP1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii TCP1
Otolemur_garnettii
TCP1
GeneScaffold_2867
SNORA29, SNORA20
6538..6677, 12128..12258
17768
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCGAACTATAGCTCGATTCGCTGAAAGACGACCGAGCAAT
CTGTAATGCTCCGCCAATCATCGCTGCGCAAAGGGCACGCAGGCTCTGAGCCCACCGACC
ACTCGAACACGCCCCGCCCCAGGCCTGGGCATCAAGACGACCTCGTCGTTTGGGAACAGA
TGTACGTCACGGCTTTGGGGCCTCTCATGCAGGGCTTACTACTGATCACATCAGGCACAC
ACGCAGCTGAGCACTGGGAGGAAACGAGGCGGAGCTGGAATCACTGTGTCTCAAAGGGGG
CGGTGTTACTCTTCAAACAAAAGGGCCACAGGAAAAATCGCCCCATCCACCCAGGTTCAG
ACCCTGTACTCGTGAGCGCTTGACCAAAGCTAGCTGACCCGAGTCATGAGCCCCGAAAAA
GCATTTCAGGTTAGGAAGAGAATACGGACAAAACGAGACTCGTTCAGAACCCAGGTCGGC
CCGCCCGCTCCCGGTACACCGCCAACTTCAAGCTCCGCCCTTCCCAACACCTTTTCTAGA
AGGCACTAGAACGTCCTAACGCCCTGCGCCGGAAGACTGTTCAACCGAGCACTTCCTGCC
TCCCAGAGGTTGGCCGGCCTGGCTTCCTTTCTCCCGCTTTCGCGCCCTTCTCATTCGCTC
TCTAATTGGTTAAAATACAGAGCCGGCCTCTCCTGCGCCCTCATTTCCGGTATAGTTCCG
ATTCTTCCCTTCCTCCCCCCGCCGCCTTCTTTTTTCCCGGCAGGCCGTCGGGCCCCGGAA
GTGGAGAAGCGGGCGGGGCGGTGTTACCCAGAAGCCGTCGCGGCGTCGCTCGGTCCTCTC
CACGCTGTCGCCTCCGCTGTTGTGGCCGCCGCTTGGCTGAGATAGCGAGCTAGTGATTGT
CTGCGGTGTGGGTAGATTTCGTCGCAAATCCTGCCGCGAAGATGGAGGGGCCATTATCCG
TGTTTGGGGACCGCAGCACTGGGGAGGCAATCCGCTCCCAGAATGGTAGGGACAGGCGGG
GCCGGGGCCGCGGGCGCTGCGCGCCGAGCCCTCTTTCGGGGCCGCCGGCAAGTGGCACCT
TTTTGTTTTCCCCCTGCGGAGAGGGTCCCCGGGACCCGCGCCCTGATCAGAACACTTGCA
GTCTCGCGGGCGGGCCCATAGCCGCCTTTCCCCGGAGGGGAAGATCCCGAAAGCCCCCCA
AATTTTGAAGTACTGCCCGCCCTGGGAATTGATTAAGTGTCGGTCTCCGGCTTTGTGAAA
GCCTTCTACTACTCAAAACTTTGAATCCTCATAGTGAAGTTACCGAACAAACTCTGGATT
CCCTTTTGTTAAGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAA
GCTGAAATGATGTCTTTAGCGTCGTGGATTTTTCTGATTTTATTTTTTGTCATTGATATC
TCCAGTTATGGCTGCAGCTTCTATTGCTAACATTGTGAAAAGTTCTCTTGGTCCTGTTGG
CTTGGATAAAATGTTGGTGGATGATATTGGTGTAAGTACACTTAACTGTTGTATTGCTTT
AAATCAAAAAAGGTCTTAGAGACTTTGCTGTGTTAATTCTTTGTTTATATCAGAATCGTG
GGCATTGTTATCAAAGATGTATGTGCAGGCTGTGGCTCACACCAGTATTCTACCACTTGG
GGAGGCTGAGGCAGGCGGATTGCCTGAGCTTACAGGTTAGGGACCAAACTGAGCAAGAGC
GAGACCTCATCTCTAAAAATAGCAGGGGGTTGTGGTGGGCACCTGTGGTCCCAGCTACTT
GGGAGGCTGAGGCAGGAGACTCGCTTGAGCCCAAGAGTCTGAGGTTGCTGAGAGCTGTGA
TGCCACGGCACTCTTCCGAGGGTGACAAAGTGAAGCTCTCACCCCCCAAAAAAAAAAATG
TATGTGCATGATAATGGGCCTATGTTAATTTCTGTGTCAGTTTATGTTGTTTTTTTTCCT
GCAAATTTCTTAGGATGTAACCATTACTAATGATGGTGCAACCATACTGAAATTACTGGA
GGTGGAACATCCTGCAGCCAAAGTTCTTTGTGAATTGGCAGATCTTCAAGACAAAGAAGT
TGGAGATGGAACTACCTCAGTGGTAGGTATTCACTGGGTAGAGTGAGCACAGAAGGGTCA
TTAAAAAAAAGAATTTAGGGAGCTGATTTTTATAAGTATCTAGAGGAAAAAGTTTTAGCA
GTTTGGGGAAAAAAATATTTTTATATTTTAAATACTGACAGACAATTTCAGGGATAAATT
GAAAGTATAAGAAAGTAATTCAGTTTCCCCAAAAGAAGCAGACAGGGTTTTAAGTCTTCA
TTAAAAAGTTGTAGTGGAGTGAGATGGCTCATGCCTATATAATTCTAGCACTTTGGAAGG
CCGAGGTGGGTGGATTGCTTGAGTTCAGGAGCTTGAGATCAGCCTGAGCAACAATGAGAC
CCAAATCTCCTGAAAAAAGAAAAACTGAGGCAGGATCACTTGAGCCCAAGAGTTGGCGTT
GCTGTGAACTAATGATGATGCCCGTAGCACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAATTTCTG
TGTCAGTCTTATGTGTTTTTTTCCCTGCAAATTTCGTAGGATGTAACCCATTACTAATGA
TGGTGCAACCCATACTGAAACTACTGGGAGGTGGAACATCCTGCAGCCAAAGTTCTTTTG
TGAATTGGCAGATCTTCAAGACAAAAGAAGTTGGAGATGGAACTACCTCAGTGGTAGGTA
TTCACTGGGTAGAGTGAGCACAGAAGGGTCATTAAAAAAAAGAATTTAGGGAGCTGATTT
TTATAAGTATCTAGAGGAAAAAGTTTTAGCAGTTTGGGGAAAAAAATATTTTTATATTTT
AAATACTGACAGACAATTTCAGGGATAAATTGAAAGTATAAGAAAGTAATTCAGTTTCCC
CAAAAGAAGCAGACAGGGTTTTAAGTCTTCATTAAAAAGTTGTAGTGGAGTGAGATGGCT
CATGCCTATATAATTCTAGCACTTTGGAAGGCCGAGGTGGGTGGATTGCTTGAGTTCAGG
AGCTTGAGATCAGCCTGAGCAACAATGAGACCCAAATCTCCTGAAAAAAGAAAAACTGAG
GCAGGATCACTTGAGCCCAAGAGTTGGCGTTGCTGTGAACTATGATGATGCCGTAGCACC
CTACCCAGGATGTGACATGAGGCTGTCTCCAAAAAAAAAAGTCTTTTTTTTCCATCATCA
AGTTATAACAGCCATATTCAAGGCCCTGCTCTATGTTTTGCTTGAAGTTGCAGTTTCCAG
GAATCTGTTGATGTTCAGTGAGGACTTAATGTACTTTGTAGGATTCTCTTGTTCCAGTTT
CTAATAATGAGTTATTCATTTCATCACCATTCTGGTCAGTAATATCTGATGGTTTTACAC
ATACATTAATGCACATTGAATGTCAAGCATGCTTAGAGCAATGAATGTTTTCTCGACAGG
TTATTATTGCAGCAGAACTTCTTAAAAATGCAGATGAACTAGTCAAACAGAAAATTCATC
CCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGGTAAGATTCTTTCAGAGAAATT
TTTTTATTTGATTAATAGTCCATTGATGCTTTGATTAATGATTAAGTTTTTAATTGAAAA
CATTATGTTTTAGTATGTAAGTAGTAATATTTGATGTAAGAATCTAAAGCAAATGTATTT
TCCCATTTGACTACCACATTTTCTCCTAATGGTAGATTTTAGTGGCTATGCTTATGGGAT
AGATTAAAGTTGCCGTGATCTGAAGGAGGAGGGTTTTTCAGTGTCCTCCTTCTATATGAA
ATGGCTGAACATAAAGTTAACCGCCTATGACACTGTGTTAAACAAGATGAAAGCAAAACA
TTTGAATATCAGGTTTGTAAGTGTTTTTCTCTCCCATTCTTTTAAACAGGGAAGCAGTGC
GTTATATTAGTGAAAACCTAATTATTAACACAGACGAACTTGGGAGAGATTGCCTGATTA
ATGCTGCTAAGACATCAATGTCTTCCAAAATCATTGGAATGTATCCTTGTGGTGGTCCAA
TAAAATTTAGGTTTTTTGAAAAACAAGATTGTTATTTTTATGGTGTAAGATATACTGATT
TTATTCAAATTGATGATTGCAGTAGAGGCAAATGATGTATTGGAATTGCCTGGTTTTCTA
GGGTGAAAAGGTAATGATAAATAGCATTTTGATGGCATAAATAATGCTTGTTTTTTTGAT
GAATGAGATTATTAAAAGGAAGTTCCTTCAAATGATCCTTGATTTTAGGTGTACCCTTTG
TATCATCCATGTCATTATCCTTAACTGTTGATTTAGAAATGATGATTTCTTTGCTAATAT
GGTAGTAGATGCTGTGCTTGCTGTTAAATACACAGATACAAGAGGCCAACCTCGATATCC
AGTCAATTCTGTTAATATTCTGAAAGCCCACGGGAGAAGTCAGATAGAGAGTATGCTGAT
CAATGGCTATGCGCTCAACTGTGTGGTGGGATCCCAGGGTAAGGTTCGTTGAGGATTTGG
TTATAGAGTAAGATTACTACAAGTTAAAACTAGCATTCTTTGGCTTGCATGTAGTATACC
CTTTTGTAACTAAAGTACATGTATGTGTAACATGTTAGAGTGAATGCAAATGGAAAGAAA
TAATGTACATTTAATGCCATTAAGTTTTTCTAAAGTTAAATGTAGGAAGTTATAGTTAAA
ATTTGTATTACATATGTAATCTAGTATTTTTATGCTAGTTTTTATTATGGTTTTAAGGAT
AGTGGCATTTTAAGAAACACAGCATTATTGTGCTAATTATAAAGGAAGTTAATATTTATG
TTCAATTACAGGCATGCCCAAGAGAATAGTTAATGCAAAAATTGCTTGCCTTGACTTCAG
CCTGCAGAAAACAAAAATGAAACTTGGTGTACAGGTGATTGTTACAGACCCTGAAAAATT
GGACCAGATTAGACAGAGGTATGTTGAGAGATTTTTTTAGCCTTTGAGAGGGGTGTTTGT
AAATTATCCTTCTGTTTGACAAGGTATAGTAAACTATAAAAAATGCATAGCATGCTATCT
CATAAATGTATAACAGAGCAAATTACCAGAAGTACTAGGTAGCAGAATATGGTGTTTATA
GAACTGGAGTTCTGAATGTGTCTTGGAAGACTTTAAAAACCAGTTTAGCTAAGTCAAACT
ATTTTAGATGAACTTCAAGAAAAACTTGTGTGCTGGTGATTTTATAAGAGGGATTTAAGG
TGATAAAACTTAGGTGAAAATTGGCCCTTTGTGGAATTCAGTTTTTATGAGTCAGTTGAT
ACTAAAGGTATAAAAGGCAGAAATCTAATTTGCTCAAGCAGTACAGAGCTTGGTGGTATA
GTATAAATTGTGCCTGCTCTATGCTGGGTCTGAGGGGTACAAGTGGTGGTGGTATTGATT
GCCATGCTGGTCCTGAAGATAGTTTGACTTCCACTAAAGGATTTTGATTGCCTTCTTAAC
TTGAACCATATCAAAATTTTTTTGAGACAGAGCTTCAAGCTGTCCGCCCCGCCCGTGGCA
TCACAACTCATAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCTGCCTCCC
AAGTAGCTGGGACCACAGGCACCCACCACAACGCCTGGCTTATTTTGGGGGGCTGCAGCC
ATCATTATGTTGGTGGGCCCTGGCTGGATTCGAACCCGCCACCCTAGGTGTCTGTGGCTG
GCATCTTAGCACTTGAGCCACAGGTGCCGAGCCCATATCAAGTATTTTTAACAGTTCTTT
GAAATAGTAAACCGTTTTGAAAGGCAGTTAAGCCAGACCTACAAAAAGTCTTTGCCAAGA
GTCAGGATCATCTTTTATTTATTTCTTTTTTCCCCCCCCTTTTAGGATCCTCTTTTAAAT
CTATCTGCAGAGATACTCTTTTTCTCCTTCCTTCTAACAAAGTGTCTTTTCTTCCATAAA
AGCGCTCTCTACAATAAGTGTTCCAGAGTGTCTTCCTTTGCCCTAATGTCACGACCCTTT
AATACAGTTCCTCATATTGTGGAACTACATTAAAGGGTTGCGGCATTAAGAAGGTTGAGA
ACCGCTGCTTAGAGACTTGCCATTGACGTCTTTCTCATTTGCGTCAACTAACTCTTTCTT
TTCTAGATTCCAGTTGCAGCTCTCCTGCCCTTAAGTGATAAGCCTCTTAACACATCCCGC
TCTATTTACCCCCTATTCTTCCCCATCTCTTTATGACCATGAGAGTGATTTGGTCAGAAT
TGTTGCTGGGTGCTTTTCTTCTCATCACCTTGTCTCCCCTGCTCTCCATTGCAGGACTGC
TTGTTCTATGTCACTAGTGATCATGAATGTGAAATTTAGAAGACTTTTTTCAGCCTTCCT
TTTATTTGGCTTTTTAACAAGCAAGCTTTGGACTACTTCTTGAAATGCTTTTCAGGGAGG
CATACATCTGTCTAATTGATTGCTGCTTAAGCATCTCAGCAAAATCAGTATGTATAAAAC
TGAACGAAATCATGATAATAGCTCACATCCATTTTTGACCATCTTAATGATGAGGACCCC
TCCGTTTCAGGCAGAAAAACTAGGAAATCTTAATTCTTCTTTTCTTGCCTAATAACCATT
CTAATCTGTCTCTAAGATCATTTAATTTCTGCCTACAAATTATTTTTTTTGCCACCCTAC
ATCTTCAAATTTAATTTACCAACTTCTGTTTTCTTGCCCATATTCTTGCAGACAACTGAG
CTAGTTAGTTTCAGAGGAACTTTTCTTTCTTCCTTCATCTAAATTATACTCCGTTGTGAC
TTCCTTACTTTCTTTGTGGTGCTTACCAGTGTCTCCTGTTAAGTTTGTATAGCCAGGTTG
TGAGCTCTACAGGTAAAGATAGAATGATTTCCTTGGCTTTGTAATCCCACTCTTTTATAC
AATTTCTGACACACAGTACCTATTTATAGAGGGTTTTCTTTTGAGATTGATCTTTAATTC
GTTTTACTTCAAAAATCCTTTGAATGCTCTTATCTATTCAACATGGCTTCAGTTACATAT
TGACTTTTCTTAAATCTGTATCTCTTCCCCATAATTTATTTGTAATTTGTCCATACTGTA
AGTGACCACTTCTGGCAGCTTCACCTGAATAGCAGCAGAAGCTTCAAACTTAGTCTTGTC
CCAAACTTAACTCCCATTTTCCACCCTGACCCCCAACCTGTTGGTATATATTTGACTCCA
GTAGTCACTGGTTATACCTCCCAGTTACACAGGCCATCTCCTTGCCTTCAGCCATTCATC
TTCCCAGTGCAGTTTCCCTGTTGATATGAGGGGATCTTTTTGAAAACAAAGATTTGACAG
TATTGGTCTCTCTTAAAAATGAGGTTTGGGCAGTGCCCATAGCTTGGTGGGTAGGGTGCC
AGCTACATAGACTGAGGCTGGCACGTTCAAACCCGACCCAGCCAGCTAAAAAATAACAAT
GACAACTGCAACAACAACAAAAAAATAGCCGGTCGCTATGGCGGGCACCTGTAGTCCCAA
GTACTTGGAAGGCTGAGGTAAGGGAATTGCGTAAGCCCAAGAGGTTGCTGTGAGCTGTGA
AGCCACAGCACTCTATGTAGGGTGACACAATGTGACCCTGTGTCAAAAAAAATAAAAAAT
AAGATTTTAAGCCATCTAGACTCTTCAATGTGGCCCACTGGTTTCTTCATTTTTTGATTT
GGTCTGCTTTTGGTGGTTTCAACTCTGGACTGCTCTCATATTCCTTGTCCCACCTCCAGT
GTGGATTTATGTTTTTCAAGCGTTGCTAATCTCTGCATAACACCTTGTTTTTTGAGACAG
CAGAGTCTTACTTTGTTGGTAGACTGCGGTGGTATCATAGCTCACAGCAACCTCAAACTC
TTGGGCTCAAGCAATTCTCTTGCCTCACCAGCCCAAGTAGCTGGGACTTCAGGTGCCTGC
ACAATGCTGTCTCTTTTTTTTTTTTTGCACTTTTTTCGCCAGGGCTGGGTTTGAACCCCG
CCACCTCCAGTATATGGGACCAGTGCCCTACTCTTTTGAGCCACAGGTGCCACCTAATGC
TCTTGCTATTTTTAGAGACGGGGTCTCGCTTTTGCTCAGGCTTGTCTCAAACTTGTGAGC
TCAGGCAATCCACCTTTCTGGGCTTCCCAGGGTGCTAGGGTTATAGGCGTGAGCCACCTC
ACCTGGCCCACTCTCATTTCTTAATGAGTAACTCAAAGTCGGGGTGGGGAAAGTTAAGTG
GTTTTAATTCCTTGACCTTTTCAATAAATTGGATTAATTTAAATTCTGGTCATAGAAGAG
TTAAATATATTTATGATTATCTTGTGATAACTAGTAGATTTATAGCTGTATTTTGAAAAT
ACAGAGTAATTTTGGGTTACTAAAATCCTTTGCAGAGAATCAGATATCACCAAGGAAAGA
ATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGAT
ATGTGTTTAAAGTATTTTGTGGAGTCCGGCGCTATGGCAGTTAGGAGAGTTTTAAAAAGG
GACCTTAAACGCATTGCTAAAGCTTCTGGAGGTAGGTCTTCTATTAGCCCTCAAATAAAA
TTGTTATGTCACACATGATTATGCCAGAGGTCTTTTTATGTTGGATTATTGATGCAAAAC
AGGTTTGAAAAATTTATATTCTCTTAATGTTTTGTGTTACAAACAGCTGTTAGAAATTCA
TGTACTGAATTGTTTCCCTCAATGACATAGCTCCATCTTAGGATAAAAAACAGTTGGCTT
GATTCCTAATGAAACTTTGAACTTAACACAATTTCTCATAAATGTTTTTGAATCTAAGGA
TATTAAAATGAAAGAGCAATATTTACAGATCCCTTTTAACTTTCTGAATAGCAACTATTC
TGTCAACCCTGGCCAATTTGGAAGGTGAGGAAACTTTTGAAGCTGCAATGTTGGGACAAG
CAGAAGAGGTGGTACAAGAGAGAATTTGTGATGACGAACTGATCTTAATCAAAAAGTAAG
AGTTACTTTTTGTTTCTTTGAGACAGTCTCACTCTTGCTGTGGATAGACATCAACATCTG
CCTAAGTTTTCTGTTTTTAGTAGAGATGGGTCTCGCTCTTGTTGAAGGTAGTCTCAAACT
CCTGAGCTCAAGCAGTCCACCCACCTCAGCCTCCAAAAGGCTAGGGTTATTGACATGAGC
CACCATGACCAGCTAGGAGTTACTTACTAAATTGAAAGGTTATACACATTTTTTGAGTAA
AAATAGATTTTCCCATTTATTTGCTGCCATAGTCTTACAATGATATGAGCAGTTATACGC
ATGGGATAAAATAATAGTGGGCCATTGTCAGTTGAGATGAAATAACCATTTTCATCTTTT
GTGCATGGACTAGACATTATTTTTGGTACCGTGTGGTCTCAGTGTCCTCTGTAAGTAGGG
TTTAAATTAATCAAGGGCACTTGGCAATGAATTATGTATACTTATTTTATAAAAATATCA
TTTTAAGAATTTTGCTTTTTGTTTTTAATAGCACTAAAGCTCGTACATCTGCATCGATTA
TCTTACGTGGGGCAAATGACTTCATGTGCGATGAAATGGAGCGGTCTTTACACGATGCTC
TTTGTGTGGTGAAGAGAGTTTTGGAGTCAAAATCCGTGGTTCCAGGTGGGGGTGCTGTAG
AAGCAGCCCTTTCCATATACCTTGAAAACTATGCCACCAGCATGGTAAGAAGAATTATTT
GTTTTTAAAAAGGGCGGCTCAGCGCCTATAGCTCAACTGGCTAAGGCGCCAGCCACGTAC
ACCTAGGGTGGTGGGTTCGAATCCCCAGCCCGGACCCGCCAAACAACAATGACGGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCA
CTTTGGAAGACCAGTCGGTGGATCATTTGAGCTCAGGAGTTTGAGACTAGCCTGAGCAGA
CCACCCATCACTACTAAAAATGGGGAAAAAATCTAGCCGGATGTGGCAATGCCTGTAGTC
TCATCTACTCAAGAGACTAAGGATCGCTTGAGCCCAAGAGTTTGGGGTTGATGTGAGCTA
TGATGCCATAGCACTCTACCCAGGCAACAGACTGTCTCAAGGGGGGAAAAAAATTTTTTT
TACCATAAAAAGGGGAACAGGAATTACAGCCTAATAGGAAACCAAGCACATTCCCAGCAT
TTTGAAGTTGAAAGGAGATCTAAGCAGGCTCATGGCCTGTGGCTAGGGCGCCAGCCACAT
ACACCAAGGCTGACAGGTTTGAACCCAGCCTGGGCCTGCCAAACCAATGACAACTACAAC
AAAAAAATAGGCATTGTGGCAGGCGCCTGTAGTCTCAGCTACTTGGGAGGCTGATGCAAG
AGAATCACTTAAGCCCAAGGGTTGGAGGTTGCTCTGGGCTGTGACACCACAGCACTCTAC
CCAGGGTAACATAGTGAGACTGTCATTTAAAAAAAAAAAAAAAAAGAGGCTCAGCACCTG
TGGCTCAAGTGGCTAAGGTGCCAGCCACATACACCCAAGGTGGTGGGTTCGAATCCAGCC
TGGGCCCGCCAAACAATGACAGCTGCAACCAAAAAATAGCCAGGCGTCGTGGCGGGCGCC
TGTGGTCCCAGCTACTTGGGAGGCTGAGACAGGAGACTCGCCTGAGCCCAGGAGTTGGAG
GTTGCTGTGAGCTGAAATGCCACGGCACTCTACCCAGGGGGACAGCTTGAGGCTCCTGTC
TCCAAAAAAAAAAAAAAAAAAGATCTAAGCAAAGGATTAGAGGGAAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGAAGGTCCCAGCATTTCTCAAGGTTAACATTTAAATGGAATTGCTGGAATTAATAGG
TGACCTAATCAACTTGTAAGTGGCCATTTAATATTCTTTTTATTAATTGCAGGATTGGTC
TTGATTTGATTAATGGTAAACCTCGAGACAACAAACAAGCTGGTGTGTTTGAACCAACCA
TAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCTGCAATTACCATTCTGCGAATTG
ATGATCTTATTAAGTTACATCCAGAAAGTAAAGATGATAAACATGGAGGTTATGAAGATG
CTGTTCACTCTGGAGCCCTTGATGATTAATTTGATGTCTTTTATTTATAACAATGTTAGA
TGCAGTTGTCTCGTACCTTTGAGTATTACACATTAAAAGTACAGCAAGCTATCAACTTAG
GAGACGGTTTCCTTCCTTACTTTGGTCCTCTGATTTCACATAAAATGTTAAGAGAAATGA
AGTTTAAACAGTTTATCCTCTTTGAACGCACATTGCTATTCCCATCCCACCCCCAATGCA
CAGGGCTGCAACACCACGAGTTCCGCCTGTTCTCTCCAGTGTGTGTAACAGGGTCACAAG
AATTCGGCAGCCAGATGCTCCAAGAGGGTGGCCCAAGGCTATAGCCCCTCCTTGAGTGTT
GATCTAAGGGGGAGAAAAGATTTATCTTAGATGTCTTTTTTCCCTGTGGATAATTTAAAA
TCCTAAACTTGTCTTTTTCCTTTTGTTAGTATCAGCAAACTTAAACTTTCAAACTCAATT
TTCATTTTAACTTAGAAATAAATTCATAGCTTAGTGAAATCCATTCCTGACCATTTAACC
TTGTTACTTGGTTTAAAAAATTACTTTTAAAAATCTAAAGTGTGTTCTTTATGTCTGCGG
TAAGCTAATGTCATGGGTTTTTGGGTTTTTTTTTTTTTAATGTCAGATTTATGTGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 3485..3570, 5439..5447, 5449..5469, 5471..5486, 5488..5517, 5519..5544, 5546..5572, 6299..6396, 6769..6879, 7176..7357, 7691..7817, 11255..11430, 11751..11874, 12391..12583, 16178..16341, 16552..16768
1001..1064, 3485..3570, 5439..5447, 5449..5469, 5471..5486, 5488..5517, 5519..5544, 5546..5572, 6299..6396, 6769..6879, 7176..7357, 7691..7817, 11255..11430, 11751..11874, 12391..12583, 16178..16341, 16552..16765
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved