Otolemur_garnettii Locus NOL5A
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii NOL5A
Otolemur_garnettii
NOL5A
GeneScaffold_1896
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
2514..2584, 3770..3899, 4777..4862, 5290..5360, 5628..5701
8036
GGGTATATACTACTTAAGGATAAACAAGTTTTGGATTTATAACTCTAATATTAATCAAT
AAGGCAAAAATAATTCCGAAATAGTCGCCTGAGTGCCCAAAAGCTACCCTTGGAGGACAA
AGGAAGCAGCGACAATTCACTCGACCTATGGGTCGCGACCCCTTTGTAACAATGAAAATA
TATCGCGGCATTAGGAAGGTTGAGAACCACTGACTTAGGGCCATAAAACGGATAAGCAAC
ACGTTGCCCCGAAAAAGGAGATGGGTCTCGTTAAGCCCAGGAACAAGACACAGACCAAGA
AAGACCTGGGATCGTTTTTTCTTTCCCACGTTACTGCCTGCCACGTTATTTTAAAAACAA
TAAACAACATTCAACAGGAATGACAGTCGCGAGGGCCATGTTTCCAGCAATCTGCGCCAG
AACGCCCCAGGCCCCGCTCCTATACCGGGAAGGAGGAAGGGGAGCGCGATCTACTGTGAT
CTGGAGGTGTCATCACCGAGTGGGAGGGGAAAATAAAGAGTCCTGGGGGCTTGGGGCGCA
GGGAGGGGTCTGGGACCCGGGGCCGCCAGCGCTGCGGGGAGCCGGCTCCGCAACGGTCTG
GGATGGTCGCCGCGCCCCACACACAGCCTCCCGCCCTGATTCACTGAGCTCTGCTGCCTG
CAATCTATAAGACGAAAACATGAGGGATCTGACTATCATCTGGAAAAGGACCTTCCCAAA
CCTTCTTGTGGCCAGCAAGGCCAGACGCGCTCCCGCGCGTCCCAGGCAACCGCGCCCGCC
CGCGCAGCTGCAGAAGCCGGAAGAGAACAGCCCGCCCGCGCTCCGCACCTCCCCCGCCCG
CTCTCCGGGCGATACCATTCCGGCGGGCCCCGGCAAAAACCCGAGAATGGTGCCGTCCTC
GGCGTCTGATTGGTGAATGAGAATGGGCGTGGCCTCTGGAGCCTGGATCCGCGCGCCAGA
GCTTGTTAGCCGCAGTGCGAGCGGAGCAAGGAGGGGGCGCCATGGTGAGGAGTGGTTGCG
GGTCGCGTGCGAAGCGAGAGGTGGTGGTGTGGGCCTGGATTTGGTCCTGGCCTTGGCCTG
GCCCTGGTCTGCTTCGGAGCGGAGCTGGGCGCATGCTGAAGCTGCGTTGACGCTTGCGCC
CCGGCTCCATTCCAGGTACTGTTGCACGTGCTGTTCGAGCACGCCGTCGGCTACGCGCTG
CTGGCACTGAAGGAGGTGGAGGAGATCAGTCTGCTGCTGCCGCAGGGTGGGTAAACTCAG
TGGGCTTGGCGGGCGCCGCAGACCCTCGGCCCGCACGGGTCCCAGCATGCACCACGCGCT
CCCACGTGGCCGGCCGCTCTTGCCGGGAAGGGGGGGGGCTGGGCCTGGAAAGCTCTAGAG
CGCAGGGGGCTTTACCTTGAATCATGGTCAGAATCGCTGTAGGATCAATGAGAGTAAGCC
TCCCGGGCTCTCTCTATCGACTAGAGCAGAGCCAGGATATGGGGCCTAAGCGCTGGTACA
ATTTAATATCGTCCAGGGCTGAGAACCTTTGCTTCACTGCGTTGCGGAGGCAAGAGCAAG
GAAACCACTCATCTCTTTCGCCCCCCATCCTACAGGTGGAGGAGTCCGTGCTCAACCTGG
GCAAATTCCACAACATCGTTCGTCTAGTGGCCTTTTGTCCCTTTGCCTCATCTCAGGTTG
CCTTGGAAAATGCCAATGCAGTGTCTGAGGGTAAGTCGCTAAGTATTCCTGAGGGATAAG
ATACGTGTAGTTGCTTACGTTACCTTCCTAGGAGATTTGTGATGGTACTTAACCTTTTTT
CCGCTAGCTGTAAATCTGGTAAGCGCTAGGCAGTGTTAGAAATGGACAGGATGTAATTTA
AAATAATGGCCTTCAGGCCTGGCATTGGTGGCTAACACCTCTAATCCTGGCACTCTGGGA
AGCCAGGGCAGGAGGATTGCTTGAGCTCATGAGTTGGAGACCAGCCTGAACAAGACCAAG
ACCCCCCTCTCTAAAAAATAACTGGACTTTGTGGTGGGTGCCAGTAGTCCCAGCTACTGG
GGAGGCTGAAGCAAGAGGATAGCTTGAGCCCAAGAATTTCTGTGAGCTATGACACACAGC
ATTGTACTGAGGGCAACAAAGTGAGACTGCTCTTAAAAAAAAAAAAAATTGTCTTCACAG
AGCTCAAGATCTGGAAACTGTAACAGACCAATTGTTTCACATTTAAAGCACACAATCCAG
GAAGCAGATATTTCTTTTGGGTACTATAGTGACAAATGATTCTTATTGAAATAGAGGGGG
CTATTTTAATACCCACCTGTGCCTAAGTTTTCCTAAACCCAATGAAATGCCTGATTCTGT
GCTGTATCTTTCAATTCATTGAAAAGGGCAGTTTAGATAAACGTAAACCAGAAGAATGGT
TTGTTCCCAGAAGTCAAATTGGGTAATAAATGTCTAAGGGTGTGTTATAGCTTCAGTTAC
GTTTCATATGTGGTGTTGGACCTGAAGGCAGCACCTCCCCAGTTGGGCCAGGCTTTGCAG
TGATGACTTTTCTTATCTGTCAATCCCCTGAGTGCAGTCACTGATGTCTCTGTGTCTCTG
AGCAATGCCTGAAGGGGAGGGATCTAGGCATGCCATTCCATCATGCGCCACCAGACCAGC
ATAGTCAGCTGAGGGGTGATACCTCTTGCATCCTTGAGCATGTTAGTGGGAGCTGTGTTC
TTTGTGCCCTGAGGTGTTGTTCATGAGGACCTGCGTCTGCTCTTGGAGACTCATCTGTCT
ATACAAAAAGAAGAAAGTACTCTTGGGGGTTGGGGATCCCAAGATCGGTGCTGCAATACA
AGAGGAGTTAGGGTACAACTGCCAGACTGGAGGCGTGATAGCTGAGATCCTGCGAGGTGA
GACCATCATATGTTATGCTTCTGCCATTCCTTACCTTCTTCCGGGGGGGGGGGGGGGGTT
GCTGGGAAATCTGCTAGGGTGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTAATTTAGA
ATCTGATCAGGACTGACAACTCTGTGGGTAGAACTATGTGGGCTGAAGCTGGACTCCTGG
TGCTTACACAGGCTGTGTCTTACACTGACTGTATAGAAAAAGGAGGCAGAATAAATCTAC
CCTGTGTACACCCCAGCCCAGGCCCCATGCCTGGTCTGTATTGTGAATGGGGGAACATGG
AGTTGAGATGGATTTGAATCTAATGTATTGTGTTTCCTCCAGGCAGAGAATAAGTATGGA
GAGAGCTGAGGCTATGGCTTTGTTGTTTAAGATGAAGCAGCTGGGCTGGGAGTGACTATG
GTTCTTTGCAGGGAGTGGTATGGGTATCACTTTCCGGAACTGGTGAAGATCATCAATGAC
AATGCCACGTATTGCCGTGTTGCCCAGTTTATTGGAAACCGAAGGGAGCTGAATGAGGAA
AAGCTGGAGAAGCTGGAGGAATTAACGATGGATGGAGCCAAAGCTAAGGCTATTCTAGAT
GCCTCACGGTCCTCCATGGGTCAGTACAGAGCCTGGCAGCCTACATAAGGAGTAGGGCCC
TAAACGGCTGACTGTTGTACTCAAACTCTTGATGTTTCCTAGGTATGGACATATCTGCCA
TTGACTTGATAAACATTGAGAGCTTCTCCAGCCGCGTGGTGTCTTTGTCAGAGTACCGCC
AGAGCCTCCACACTTACCTACGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCT
TAATTGGAGAAGCGGTGTGTCATGGGAATGGGGGTATTACATGTGTATCTGCACTGCTGT
GTTTCCTGACCCACAGTATCTTTCCATTGTGCTTGATGGGGAAGAGGTGAATAGGGATCA
TGCAGCTGGCAGGTCAGCAGTTAGAGCTTCTGACTCCTTCCTTGACTTTCTCTAGGTAGG
TGCACGTCTCATCGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCAC
AGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGCACCTGCTCATA
CTCAGGTGCCACTTCTGGTGCCCGCTGCTTGTTTGGGGATCACAGTGATGGCTGCCCAGG
GCTCCCTGACCTATACAGCCCTGTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTG
ATTCCTAGGGCCCAGCAAAGGGACCAAGTTTCCAGGTCAGCGACATTGGATGCCTTCCTC
TGCCTCTGGGAGCTATGGGTTGGCATGGCATGTATTGGGGTAAAGACCCAGCCTGTCCTG
AGACTCATTCTGGGGATTTGGGGAACTGGGTGAGTTACCTTGGCTAATGGGGTTGACATT
TCTGATTTTAAACTCTCTGCTGAATATTCTCTCAGAGCCCTGAAGACAAGGGGTAACACA
CCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAA
GGCCGAATCTCCCGATACCTGGCAAACAAATGCAGTATAGCCTCACGAATCGATTGCTTT
TCTGGTATGGGGGTGGTTGGCAGTTGTGAGAAGAGGGCTGGGGTGGGGGGCTGACTACCT
TAGGCGGCTTCTACGATGATGGTACTATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGT
TGATGCTTTGGGTCTGAGTGAAGCTGAGGGTAGAAGAAATACTGGGTGGAGCAGGGAGGC
TATTTGTCCATTGAGAGGCTGACCAGCTTTGTTTATATACACACACACATACACACCCAG
AGGTGCCCACGAGCGTATTTGGGGAGAAGCTTCGGGAACAAGTTGAGGAGCGGCTGTCCT
TCTATGAGACTGGAGAGATTCCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGTTC
AGGTTGGTGTTGAGCATGCTCTCTGGGTAGGGGGAGAACCACAGCAGTTGGAGGTGATGA
ACTGCCTTAGCCTGACCTTAGTCGAGTGGAGGCAAAAAAAACTGATTTAATGAGCCTGAT
CCAATAAAGCCAAAAAGGAGGCCTTGGAGCACCAGAGGTTTTCAAGCCCTTTCAGCACTT
TTCTTTGACCAGGCAGAGGAAGCGGCTGCTGAGATCACTAGGAAACTGGAGAAACAGGAG
AAGAAACGCTTGAAGAAGGAAAAGAAACGACTGGCTGCACTTGCCTTGGCTTCTTCAGAA
AACAGCAGTAGCACTCAGGAGGAGTGTGAGGTCAGTAGGCAGATAGCCCAGGTGAAGATC
ATGGGTTGCAGGATTTTCAACAGCAGAACAAAGGATGTGCTTCGCCAAGCCATGGTCTTG
AGTCCAGGCTTTTGGACTGAAACAAGGACCTGAAACATCTCAAACTACCTCTTGATTCTA
TAGGAAGGAGATAGGTGCTGAGAGAACTTGCTCAAGAGCCCAGAGAGCTGGTTGTAGCAC
ACACCCGTTCCCTGGGCAAGTGTGTTCTGTCCTCGGCTGCCTCCCAGGAGTCCTCAACCT
GGGGTAGTGTAAATTCCTGCTCTGCTTATTCCCAGACGTGTGTCCGGAAGTGGTAGTGTT
TCACAGTGGGGATGGGGGCAGGGAGGTCCCCAATGTGCTAGGCTAGAATCATTCTCCCTG
GGATTTTCATTTAGTGCCCAGTTAATTTCAAGGTTCCCTTTGGAATTTGGCATGATGTTT
CTATTGTGACCAGCATGGTGGGCTTTTCTGTAGGTTATTTAATGGGCTGAGGTAATTGTT
CATTACGTGTTCGTGTTCTCCATAACTTCTAATTGGGAAATCTACCCCAGAGGCTACATT
TCCAGAGTTACACCCACATGATTTTAAAACTGTCCCAGAAACACTGGGTAATTTTAACAG
AATTTTACCAGTTTTTCCTGCCCCAGCTGTTGCTAAAAACAATGGGGATGTGTGTGTGTG
TGTGTGGGTTTGTGATAGGTGACACCATTCTCAAACCTAATTCCCCCTTTTCCCTTTAGG
ATACAGTGGAAAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGA
ACGGAATGGAAGACCACCCATCTATCCCTGTATCTAAACCCAAGAAAAAGAAATCTTTTT
CCAAGGAGGAGTTGGTTAGTAGTGATCTTGAAGAGGCCACTGGCATTGTAAATCCTCCCA
AGAAGAAGAAAGCTTCACCCAAGGAGGAAACAGTAGTTAGTAATCCTGAAGAGGCAGGCA
ACAAGAGCGTGTCTAAGAAAAAGAGGAAATTCTCCTCTAAGGAGGAGGTGGTCAGCAGTG
GGCCGGAAGAGGCTGTGGGCATCAAGAGCGGCTCCAAGAAGAAGAAAAAGTTCCACAAAG
CTCCCCAGGAAGATTAGAATGGACATTCCCTGTGAGGGAGGGGTATCCCATACCCCACAG
CGACATTTCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGCC
ATCTGATGGAATGGAAATAGAAGAACACTCTAAGCCTAAACCCAGCAGAAGAAAAGAAAT
ATCCAAAATTAAATCAGAGATTAATTAAACTGAAAACAAAAGAATCATTCAGAAAATTAA
TAAAACAAGGAGTTGGTTTTTCGAAAAAATAAGTAAAATAGATAAAACTTTGGCCAGACT
AACTAGAAATAAAAAAGTAAAATTTCTAGTAACCTCCATCAGAAATGATAAAGGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1155..1244, 1595..1709, 2713..2758, 2760..2875, 3237..3435, 4031..4218, 4302..4453, 4615..4715, 5075..5223, 5460..5581, 5772..5909, 6659..7036
1001..1003, 1155..1244, 1595..1709, 2713..2758, 2760..2875, 3237..3435, 4031..4218, 4302..4453, 4615..4715, 5075..5223, 5460..5581, 5772..5909, 6659..7033
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved