Otolemur_garnettii Locus RPS11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPS11
Otolemur_garnettii
RPS11
GeneScaffold_3476
SNORD35
2063..2149
5066
GCCAGCTAAACGACAATGACAACTGCAACAAAAAATACGCGGGCGTTTTGGCGGGCGCC
TGTAGTCCCAGCTACCTGGGAGACTGAGGCAAAAGAATCACTTGAGCACAAGAGTTTAAG
GTTGCTGTGAGCTGTGACGCCATAGCACTCTACCAAGGGCAACATACTGAGACCCTGTGT
CAAAAAATAAACAAATCCATGTTTAAAAGTACGAAATAATTATTAAGGTACTTCATACAG
ATCTGCACTATTCAACACTGTAGCCATTAGTCACACGTAGCTATTTAAATCTATACAATT
AAAGTTAAAAATTCAGGTCCTCAATTGAAAAAGCCATATTCCAAGTGCTACTTGCTACCC
TGACAGACAGAGCAGATACATAATATTTCCATCATCACAAACAGTTCTCTTTGACAGCCC
TGTTACAGACTGAAAAACAGAAGAACGGCCCTCACCACCGCTCTTCACAAGTCCGGGGAT
GAGATGGGAAATCATAGTAGAGTAACTTTCCTTAAACTTCTGAAAGCCCAAGGACAGTTT
CCGCCCCTCACAAAGATGGTGGCGGCGATGCACATAACTCCTAGCATCCTCCGGTCGCCC
GCCCTACAGAAAGTTGGCCGTGGCCGAATCCGGCTTGAAGGCTACAGGAACGCAGCCACG
CGGTACTCCAAATCCCACGTGAATCCCAGGCCGTTGAAACACAACAGCGTCTCTGCGCCT
CTCGCGATAATATAGTCCCGAGGCTGGTCGCGCCCTCCTGCTTTGAATAATATCTGCTGA
TGTAATGAGGCCTAAGACTCTCGCGAGAGTATCCCCGCTTCCCGCCTTTCAAGTCTTCAC
GGTCGGGACCGCCTGTCAATCAGAGCTGCACTCGAGGCACCGCCCAAAGCCGCGCTGCCC
CGCCCTTTCCGCCCCTCCGTCACTTCCTCTCCAGCCCCTGTGCAATCGATAAGGAAACCC
GGAGGCCGCCTCTGCTTTCTTTTTAACAGGCGGCCGGAAAGATGGCGGACATTCAGGTGC
GGTTTCGGAGCTGGCCCTGAGGTTGCAGGGCCCCCTCCGGGCTCAGGGGCACCTCCAGGA
GGACAGGACCCCGCGCCCTATTTCGGGGATTAAATCCCAGGGCTCCCTAGTGATTAACGG
GGGCGGAGGGCGCGTGCTTTTGGCGTTAATCTAGATTAGCGCTTTCTAAATCCCGGGGTC
TGTGCACGTTAATGGAGGCTTAAGCGTTTAAAACTCAAGGTTTAAGAGGTGATTTTTGGG
GGGAGATCTTAAAAGATTAATCCTGTGAAGAGTAGGACCCTGTTGTTTTGGTATTTAATT
CTGAATTCTCATGTACGAGATAGTGAATCCTGAGTGGGTGACAGGGATTACTTTGGTGTA
AAGGGTTAATTTTGTAGGCAGTACAAACTATAACAACCCCAGGTTTAGACCAGAGTCCTT
AAATTATAGGTAAATTGGGGGAGGCGTGTCTTAGAAGCCAGCGTTTTGGGAGTAATCGGT
ATACAGCGTGGGATCTGGAGGATCCGGCGAGGTCTCCGGGCAATATTGCCTGCTCCGAGT
TTACCAGCTCACGGCTCCGTTATCCCTGTAGACTGAGCGAGCCTACCAAAAGCAGCCGAC
CATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCAGTTTTCCCCGAAGCC
TGCTGGGAATTGTAGTTTGTTTCCCTGAGGCCACGCCCCCAGTTCTTTTTAGGCTCTGCC
TGCCCAGGGCTCATCTGTTTTCTTTTTTGTATTTCTTCAGGCTATTGAGGGCACCTACAT
TGACAAGAAATGCCCCTTCACTGGCAACGTCTCCATCCGAGGACGGATCTTGTCTGGTGC
GTGAGGAGGTTTGGGGTCTAGATTTCCTATGTCCTTGTTGAGGAAGGGAGTGGAGAGTAC
AAATTCCTGCGACCAGGGACATTGGCAGGTGATGTGCATTTTCACGATGGTCTTCAGATG
CCCAACTAGGGCACTGCTGAGAAACCACTTGGTAAAACTGATGCCAGAAACAAGGTTTCT
TGGGTTCCTTGCAGCAGTTTCTGATTCTCAACATGCCTTGTGTTATCCTGCCTCCCTTTC
TCATGGTTTCTGATTCATGATCTATTTCATCTCCCTAGGCGTGGTGACCAAGATGAAGAT
GCAGAGGACCATTGTCATCCGCAGAGACTATCTCCATTACATCCGCAAGTACAATCGATT
TGAGAAGCGCCACAAGAACATGTCTGTGCATCTATCCCCCTGCTTCAGGTAGCCCAGGCC
ACCCTACCAGCCTTCACTTTCCAGATCTGGGCCAACTTGAGGCCAGTGGAGGGAGCGATT
TGCTGGGTGGCATTTCCTGGCGAGTCCTGGAATCCCAGAGTTTTTGTATATCTTGTGTCT
TCCACAGTCGAAACATCTACATGTTGAGTATTTATTTGAAATGCTTGGGACCAGAAGTGT
TTTTGATTTTTTAGAATTTTGTAATTTGTTTCAAAAATCTCCTATACAGATAGTTTGGGG
GTAATTTAATAGAATGTATTGTTGTTGTTGTTGTTTTTCTTTTAAATATTTAAGTAGATT
TAGAACTACAAATGGTTTTTGGTTACATAGTGGAATTTATAATGATGACATCTGGGTTTT
CAATGTATCCAGTACCTGGCCAGTGTACACGGCACCTGACAGGAAGTTATTTCCTTGACC
CCATCCTACCCTGCACCCTTCTAAGACTCCAAGGTCCATTATACTATCTACAAACTATAC
CCCTTACCCGATGTTTTTAATCATAATAATTGTGTATGAAATAGTTAGTGTACATTGAAC
CACCAGAAAGCAAAGGTGTCCTATTGCCCCTCAAAAAAGTTCCAGAATTTGGATTTTCAC
TCCAGGGATGTTAAACCTATGGAAAGCAGAAGCCATGGGATCAAAGGGTCACAGTACTAT
ACTAGACAGGAACTTCAGAAATGATGGAATTAAAATGCTTGTTTGATTGACACATTTTGA
GATAGTCTTGCTTTGTTAGCCCAGGCTAAAGTGCTGTGGCCTCAACCTAGCTCACAGTAA
CTCTTGAGTTTAAGCGCCATTCCTCTTGCCAAGTAGCTGGGATTACATATAGGCATCTGC
TACCACACCCAACTAATATTTCTGTTTCTAGTAGAGACAGGGTGTCAGGTTTTGTTTGGG
CTGGTCTTGAACTCCTGAGCTCAGGGGATCTTCCTGCCTCAACCTCCCAGAGTGCATGAG
CCACCATGTCCAACTAGTCAGACATTTTATATTGAGCCCATCACATGCTCAGCTTGGGGT
TAGACGCTGGGATTCAGTGGTGAGAATGGGCAGAGCCCTGTTGCCTAGAGCAGAGCACTT
TCTAGCAGGGAGGGCACCAGACAGCTGGCCAAGGGGAAAGATTATAGGGGGTGGCACAGC
TATATGGGGGCATCATGTAGGAGGGAACTTCATATCAAGATATAAGGAATTGTGTGGGCA
GAGAGAAGGGATAGCATCATCATACCTTGATTATGAGTCATAGGTGGCCTGATGTGCAGA
TTCTAGTACCCTGGCTGCTAGGTAGACTATTGGGGGGGAGCGGGAGATAGGGAGGAGGCT
GCCTCCCACCTGCCTTGTAGAGCCTTGAGCTCAGTGCCTTGCCCATAGTTTGTACTCAGT
GAATGACACCTTGGTGGGGGCAGGGGTTGAATTGACAATAGGAGCTTGGTTGAAGTTTGA
TGAACCCAAAGCCAGGAGCCCTGTCTGGTGAAGGGAGAAAGGGTTTGTTTCCCAGGAGTC
TGCCAGGGTCGCCCCTCCTAAAGACATGTCTCCCACCTGTCTCCACAGGGATGTCCAGAT
TGGCGATATTGTCACAGTGGGCGAGTGCACGACCCCTGAGCAAGACGGTGCGCTTCAACG
TGCTCAAGTCACAAAGCTGCTGGCACAGAGCAGTTCAGAAGTTCTGAGACTGGATATGTG
CCCACACCCCAAATGAAATAAAGTTGTTTTCTCATTGACAGGCCAGACATGGGATCTCTG
TATCTTTACTAGAGGGAGGGATTATCCCTGGGAATTGAGTAAGGTTAGCATGGAAGCTGA
GGTGCACTCATTCTCTGAGGGAGCAAGGATGGGAATGGGGCCCAGGTCCTGCCTTTTGCT
CTCAATCTGAGATGTTGCCCCTCTCTCTTGGTCTCCTTTTTTTTTTAAGACTGCCTAGGG
TTGCACTGCCAGTTCCGCATCTCCAGGGAGGAAGTGAGCAAAGGCCGCTGGGTCCTCCAA
GCCCTGCTCTAGACCCTCTCTGGTCTTGGGAGGGAGGAAAGCAGCAGCAGCCACCCATAT
TGGGGGCTGCATTAGGTCACTGGAGTTGCCTGGGCTTGATGCTTCCTCAGCACATTGACT
TCACCCTGAGCTGCCTCTTACCCCAATGGCCAAGGATCGTGGCTAGGAAGCCAGGCGGTG
TCCCTGAGAACCTCACCACCTTACTCCTAGGTCCCATTTGCAGATGAGGAAGCCCCTGAG
AGAAGGGCAAATCCTGGGTCTTGGAGTCCACTGAGTAGTTCGAGTTCTTAGATTCTGCCT
GAAAATCTAAAGAGTTGGTGTTGCAGGTGAGTGGCATAGTGAGCAGGCACTAGCCTGGAA
GCCCCTAGGTGTGGGGCTAACCTACACAGGCCAGAAAAGTAGGGGCCTTGAGAGAGGAAT
GGGACTGAGGGACAAACTGACAATGTCAGGGGGTCCTTGAGTGTCCCTTGCAGAGTTAGG
CAGACTATGGGCACAGGGAGAGGTGGACACCATATAAATAGGTGAGCTTTGGGCATCACA
TAAGACGGGACAGGAGCAGGACAGAGGCAGACTGCAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1591..1722, 1900..1975, 2258..2387, 3948..3987, 3989..4024, 4027..4029, 4032..4052, 4055..4066
1001..1015, 1591..1722, 1900..1975, 2258..2387, 3948..3987, 3989..4024, 4027..4029, 4032..4052, 4055..4063
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved