Otolemur_garnettii Locus MRPL19
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii MRPL19
Otolemur_garnettii
MRPL19
GeneScaffold_1500
SNORA30
2993..3120
9102
GTGCTGGGATAAAATGGTGAGCAAATTGTCCCTTCTTTCATGGAGTTTATTGTTGCAGG
AAGATGAGGCCCACCGGAGAGAAAGAGCACCCAAACACCATAGTTATAAGAGGAAGGGCT
TTATTCATCGGCCAGGAGCTTAACGTATAGAAGATTTCCAAATGGCCGTGCTTCCCGACT
GGCTTGGTCTTTCCCTTTTTATTGACAGTCAAACAGTTCCACCCCACAGGCACCTTTCCC
ATTGGCCAGTTTGAATCAAGCGGGAGATGCTACTCAAGCCCCTACAGAACTACAGGATTT
CACAGAACTTGGAAATTTCCAAGTTCCAGGGAGTTAAGCCTGTAAATTCCCAAGAGCTGA
GTCACCATGGAGAGGGCCCTGCAGGTGCATCCTTGTGGCCTCCCTGAGAAGACCTGTTTG
CCCGGAAGTCGCCCCTCTCCGGTATCCTCTCTCATATAGTATAATTGCAGAATATAAATA
CTAATCTAATAATTACACAAGAAAATTTTGCAAATCAGATTAGAGGTACTAATGAAAGAG
ACCTATTAGGAATGGGAGCCCTTATTAGGGTTTTGACTTAGGGAAGGCTTGCCAACAAAG
CGAAGACAGAATTGATTCAGTAGGGTAAGAAAGAGCTTCTTAGGCTGGAAGACCACCCAG
GTGGAGGGGTATAATTTAGTACTTTATGAGGAACTAGAAAAAGACACGTTTTGGGGTGGC
GCCTGTGGCTCAGTGAGTAGAGCACCAGGCCCATATACTAAGGGTGGCGGCTTCAAACTC
GGCCCTGGCCAAACTGCAACAACAAAAAAAGAACACGCTTTTCCTAAGACTTCTAGGAAA
GGGGCGGAGAGACTCAACTATTTTGCCCTATTGCAGCCACCATCTGGCTTCCGGTGGCTG
CTACCTCCTCGCACTGATTACTGGGAGTTGTAGTCCCGACCTGAGCGGCAAACATGGCGG
CCTGCATGGCGGCCTGCATGGCGGGAAGCCACGGAATCGTAATGGGCATGGCTGGGAGTT
TTCGAGGCGCCAGACCGCTCCTGTCCGCGCCAGTCTCTGTTTTCTGCGGTAAGTGGAGTG
GGACTTCACAAACTGGGGCGCAGGCAGGGCTAAGGGCTAGGCTGGGTGAAGCGAGCCTGG
AGGTCAGAGGCGATTCCGGCGTTGGTCTCCAGGGTCCGCGGGTTAGGGGAGATTGCAGGG
CTCTGCGGGGGGTCTCAGTGCAGCCTGAGAGGCCTGACCTGCTGTCCGCTCCTGCAGGGG
CCGGTCGGCCGCAGAGTACTGGAACCATCCGAGCCTGGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTCCCTGAAGTGCATCCTATTCATACCT
GCTTAAATTCAGGAGTCAATCTTTTCTCCTGTCCTTAACCCTGTTTAGGAATCAGTTGGC
CCACGTGTTTTAGGTGGGAATTGCTGGCAGGCGTGGTACAGTGGAAAAAAGAACCCCTAA
ATTGTTTGAAGTTTACGCTTCAAAACTGAATAAAAATCTGGTTGACTTAAATGAATGGTG
GTGACTTTGGAGGTACATGAAATTTAAATGATCTAAGATTTGAAAAACGTGTTTCTATAG
AGATGTGTAACAGCCTTTAAAAACAGCCTTTTTAAGAGGAAAAACTTGGTGTAATTATAG
GCTGTCTGAAAGGGTTGTAGGTTGATTGGATTCTCTCTGGGAATTTTGAAAACATTTAAA
ATATTCTGTTTTAAATTGAATTAAACTTGGACTTAGGGAACCTACAGATTCAGAAAAATT
TCCTTATAAAACTTTTTTTTTGTTTGTTTAAAGTGGAAATGCAATATCTCTATCAAAAGG
CGGCATTTAATAATGTTCAGTTAAATAGGAAAGTAATTTTATGTTCTGGAAAACAATTTG
GCAAAATTTATTAATTTGAAGTTGTGTCTGCTTTTCCACCCACAAGTTACACAACTTAAA
TGTAACTTAAACTAACACATGGCTAGGCGCCCATAACTCAGTAAGCAGGGTGCTGGCTAC
CTACACTGGAGCTGATGGGTTTGAACCCAGCCCAGGCCTGCCAAACAGCAATGACAGCTA
TAACAAAAAGATAGCTGGGCGTTGTGGTGGGCACCTGTACTCCCAGCTACTTGGGAGGCT
AAAGCAAGAGAATCGCTTAAGCCCAAGAGTTTTGGAGGTTGCTGTGAGCTGTAACCACAC
AGCACTCTACCAAGGGCAACATAGACTCTGTCTCAAAAGAAAAAATAAATAAAAAGAAAG
AAAGAAACTAACACATAGGTACAAGGAGACATACAGGAATAGACATAGCAGTATTGTTTG
TAACAAACAAAAATTTAGAGGCAGCTTAGATATCCATCAGTAGGCGAATAGTCAGATACA
ATACGTTCATATAACAGAATATTATGCAGCCTGACAGATAAATAAACTAGGGCCAGCTTT
TAAATATGGATGAATTTCACAAATGTGATTTGTATAAAAAAACTTTAGAAGGATTGACAT
AGTATGATGCCAATTTTTTGAAGTTAAAATTATACTAAACAGTATTATATGTTGTCCAGT
CATGGATGCATATCTAAGTATAAAGAAATATAAGAGGGACATCCCCACTTTTGTGCAGGC
AAACCTAACTTTACTAATAGTGGTACAAGCTGATACTGTTATATGCCTTCTTACGTGACA
GAGTAAGTTTATATCATCCCTCGGCCATATTGTTACCAAAAATATTTGCCCTTCTAGCAC
TTTCACAGGTCCTCCCTCAGCAGTGGGGCCAGGATTTGGTAGCTGGTGCTGAAAGAAAAC
CCTTGATTACATCCTTGCCCTGGGACTGTACCAGTGGCAACTGTTACTCAAGGGGACAGA
GATCATTCTGTGACATCTTACTCAACTTCATGCCTTTTTCCTATTACTCTAACCTTGAGC
CCTCCTTCCCCCTTTCTGTCCTTTGTCATACAAAAATAAAAAGATTAAAACAAATGTCTA
GGCTCAGTCTAGGTATGTGGAAATAATAAATACCAAATCCAAAATCAGGTATAGATTGTC
TGTAAGATACTAGGCCTTGACTGTTAAAAAGAAGCCAATGTTATAAAAATACAAAGATGG
GGAATAATGTTGGTTTAAGAGATACAGTGTGTGAAACCTGATTGTATCTTGGACTAGGCA
ACAAATAGATATGAAAAACCTTTCCAAGATAATTAGATACATTTCAGTATGAACTACATA
ATAGATTGTCTTACTGAATCAATGCTAATTTCTTTAGGTGTTATAAAGGTATTGTGATAA
TCTAGGAGAAAGTCCTTCTTAGCATTAACCTACATTATTGAGGGATGAAATGCCTTGCTA
TTTGATATTTTCAAATGGTTTGGGGAACAAAATAATATGTATACATAATATAAAGCAAAT
GTAGGAAAATTTTAGCAGTTGGTAAAAGTAGGTAAATGATATTTGGGTGTTTATTATTGT
TTCCTTCTTTTTGATTTTGAAAGTTTTCAAAGTAGAAAATTGAGGAAATGGAAGAAATTA
AATGCATAGAATCACCAAATTTAGCATAATAATTATAGGGAGTAGGGAGGGATGCAAAGC
ATCTTCAACTGTAGTGGTAATTTATTTCTTGGGGTGGGTGACAGGGATGTGATAGTTATT
GTAATGACATTTATACTTTTAATGTAGATTAAATATTTCATAATGAGTTAAAGAAGATTA
TTTAAAAAATCAGTTTACAATTGGTGATTTACACATTTTATATCTTTTCCAGCATAATAA
ATTAGGCAATGAAAAGTAAAACACATCAACACCATATTTAATTTCTTTGTAAAGCAATAG
TTTTTCTTCTAGTGGCCTTTTAAGTTTACTTTTCATTTTTTTTTATTTGTATTTTTCATA
GGTTTTTGAGTCCTGAATTCATTCCTCCAAGGGGAAGAACAGATCCTCTGAAATTTCAAC
TAGAAAGAAAAGATATGTTAGAAAGGAGAAAAATACTGCACATTCCAGAGTTCTATGTGG
GTCAGTAAGAGCTGAATGCTTTCATTATTACTGTCTGGAGGGTTAGTTTTCTTCGCATAG
AGAAGATTATTTTTTCACATATACGGGTTTTGCCTGTATGAGGTACTTATTCCTAATATT
ATATTTAAAATGTTTAGGAAGTTAAGTTACCTAGAAATGTTATTTGTTTCTGTATCTTAT
ATAAAAGTTCACTTCTGTTTCAAATTTGTAGGAAGCATACTTCGTGTTACTACAGCCGAC
CCATATGCCAGTGGAAAAACCAGCCAGTTTCTAGGGATTTGCATCCAGAGATCAGGAAAA
GGACTCGGAGCTACTTTTACGCTTAGGAATACTATCGAAGGACAAGGTAAATTTCATTTT
ATGATTTTGATTGTCTGAAAATTGTTATCTCAAGATTCCTTTTTGTTTTCTGTATCCTGT
GATAAGAAATCTGAAATTTGAAAAAGAAAAGGAGCTCCAAGGGAAGACATGGACCCTGTG
GCTTAGAATGAATCGAAAATTAAGATTACTGGTAAATACAGTCAGTGTTCTGTTTTCTTT
TGAAGACTCTCCGACGTGTTAGTGTTGTGAGAGACTTCTCTACACATCAGGGAGAATAAG
TGACTGTAGCAGTGTGGGAATTCCTTTTAGGAGCCATTATCAGCTATGCAACGATTAAGA
CAAACTTATAGTGACCTTATGAGTCACTCTTACCTAAAATAAATGCCTGCATTTTGCTTT
ATATTATTACACAGAAGAATCACCAGAATTATCTCTGTTTTATAAGACTTGGAAGTATTT
TTAAAAAGGCAAAATTATGTTTGTATACCATGCCTAATAATGCAGAGAACCAAGTGGGAA
AATTCTAGAGGGATTAAAATGGCAGGAACAGTAAAGTTTTATAATTAAAGTTGAATGCTT
CATGATTGTCAACAGTGAAGTATTATTCATATTTTCAAAGCAATTGAAAACATAAGAGCA
AATGCTATCTTATTCTATAATGGCCTATGGTGCTGTGCATATGGGAATTCAACGGGACTA
GGATGATAATGGCAACCTTTGCCTTCACTCATGCTGAGTACTTGGAGAAGTTTAGTAATA
GAGAGGAATGGTCATAGATCTAACGCAGATGGTCCTGGGTTTGATTTTATATAAACCTAA
AATGTTAATTCTACCTAACAGGGTTCTAATCAAAAAACTGCAGTATGTGCGTGAAGTACT
GGGCACAGAATTCTCAGAACGTATTAGCTTTCTCTTGCTGTGCTCTAGTACGTTTGACTG
CTGTAACCTGCTTCACCCTTCCCTATAATATTCCCTGCCTTAGTGGTTCCTTCGCATCTA
GTGGCTTTGTATACCATCCACGTGATAACTCCCAAATTCATATGTCTAGGACTGAGCCTT
TTCAGATTTCAGATTTGCACATGGAACTCCCTGATCAACATCTCCATTTGGATGGTTTTT
ATTTAAGTGGTACCATTGCCACCCACTTAATCCATAACCTGGGAACTATTTTTATTCCCT
TTCACACTTTTAGTTAATTAAGAAGTTTTCTTGGCTCAATCTTCAAAAAATAATCCCAGT
TTTGACTGTTCCTCCTTTTCTTTTTTTCCCACTCTCATTTTTGTCGCCATCATCTGCCTG
CCTGCAATTGTACAGTCTCTCTGGTTCACAGTTCTAGCGTCTTAGTCCACTTGTGCTGCT
GTAACAAAATCCCACAGGCTGAGTAATTTGTAAAGAACAGAACTTTATTTCTCACAGTTC
TGGAGGCTGGAAAGTCCAAGGTCAAGGTGTTGGCAGGTTTGGTATTTGGAACGGACCTTG
TTCCTGCTTCCAAGACAGTGTCTTGTTGCTGTGTCCCTCCTGAGGGGATGAACTCTTGTG
TCCTCTCATGGTGAAAGGCAAAAGGGCAAAAGAACCTAAACTAGTTCTCTCCAACCCTTG
TGTGAGGATTAGAGAGAGGTTTTGCAAAGGCTTGCAGAGGCAGAGCGTTAATGACTTAAT
CACATCTTCAGAGGCACCACCTCTCAGTACCACCTCAGTGGGGATTAAGCTTCCACATGA
ATGTTGGAGGAGACACATTCAAATGGTAGCAACTGGCCCACTGAGTTATTGTGCTGCACC
TAAATGGACCTTTCCTTGGTTTTTCAAACATGGCAAGTTTGTTAACACCCCAGGCTCTGC
TGTTGGTCTTCCTTCTGCCTGTAGTGTTCTTGGCCTTTTCCGAGAGGCTTTCTCTGACTG
CACTTAAAGTTATCCCCTCCCTGTTACAACATCATCATCCTATATTGTCTTCATGGTATG
AAATCACCTTGTGTGTTTGTCATCCACTGTAGTGTAAACGCTTAGGAGAGGAGGAGGAGC
ATCTTACCTATCTTGCTTTTACTGTACGCGCAGCTCCTAGGTCAGTGTCTGGTAGAGAAT
AGCTATACAGTAAATACTGAATTGAAACCTGATATTAAATACTAGAAACTAGCATTGAGT
ATATATATAATATTTGTATTCCTTTTGAGAGTATTCCAGAAAACACAATATACCCATACA
TTTAAGATGTTGATAGTACAGATAATATTAAACTATCACTTGTAGTATCTTGATGAGTTG
AAAGCTGCTCCTAGTTTGCACATGCAAAGAGCTCTACTGTGTCACAAAAAAACCCCCAAA
ACATGTGCTGGCCTAGCACCTGTTGCTCAGTGGTTAGGGTGCCAGCCACAGACAACGGGG
CTGGTGGGTTTGCACCCAGCCTGGGCCTGCTAAACAACAATGACAACTACAACAAAAAAA
GTCGGGCATTGTGCTGGGTGCCTATAGTCCCAGCTACTTGGGAGGCTGAGGCAAGAGAAT
CACTTAAGCCCAAGAGTTTGAGGTTGCTGTCAGCTGTGACACCACAGCACTCTACTGAGG
GTGACATAGACCCTGTCTCAAAAAAGAAAAAAAAAAAACAAAAAACTACGCCATCCTTAA
AAAGAACTTGTAACCAAAGTTGGAATTTAAAATTTTACTTACACTTTTTGCATCATTAAT
CCTATTACTGTTAACTTGGAAGATCAATTTTTATTCAAGTAATTGGGAGATAAACAAGAA
CATGACATAGTGAAGAATTTACTCAAACTTTCTCCAAGTAATAATATTGTCAGAATGAAG
ATAATTTGACTCAGTGACCTTAAAGAAGAATTTTTTTCTTTTAGACTAACATTCTAATTC
AGACCTTCTCACTTTTATTTAAATGCATTTTTAGTTTATTTCTTTCAATAATCTTCATCT
TAAAAATTATAATCTTATGTCACATTTCCTACATTCAAAATCTTGTGCTAATTCCTTTAT
GAAATGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATAGCACTTTTGATGTGAATATGAAGCCAGTAGCACGAGAGTCTGGCCAAGAAGT
TCCTATTAATGAGGTACAGCTTGTATTTTTGAAATAGGAAGTTCAAGTATAAAATAAGAA
AGAATCATCCTCATGAAAACTTTAGAAGAACTTTTACTTATTTCTGTCAGCCTAATTATT
CTTTTTTTGTATCTTCCTTAGTTGAAAGTGAAAATGAAGCCTAGGCCTTGGCACAAACGG
TGGGAACGTCCGAAGTTTAATATTAAAGGAATCAGATTTGATCTTTGCTTAACTGAAGAA
CAAATGAAAGAAGCTCAGAAGTGGAGTCAGCCGTGGCTTGAGTTTGATATGATGAGAGAA
TATGATACTTCAAAAATTGAAGCTACAATATGGGATGAAATTGAAGCATCACAAAAGTCC
TGACTTGAGAATTAATTTGGTTCCCTGCAGGAGGATATATTGACTCCCTGAGGATTTGAG
ACCTATTCAATTTCATTTATAAGAACATAGACATTAAATGAACCAAATATTATTTTATTA
GTACTTTTTAAAAAGTATAACATTTGCACATAAGTTTACTCTGAAAAGAGAAATGTACAT
GCCACATGGTGCCATGTCCATGCCTTGTTGAGCAAAGAATCAACCGTAGTCAGCATCTCT
AGATCCTTTCATTGAGCAGGGAATCTGAGCAGGGGAAGCGGTGGGATGTCTTTTTAAAGA
TGTGAAATAAATCATAAATAGAGAATAATGTATAACTTAAAGAAAAATAAAACGAAGATT
CATGCCACCCACCAGCAAGGTTAAGAAATAGAACATTTATTAAAATCTAAGAGCACTCCT
GTGTATCTGCAATTGCACCCCTCTCTTCTTTCAGATGGAGACACTACCTTGACTTTGTGG
TAATCATTCCCTTGCATTAAAGTCAATTGCCCATGTATGTATTCTTTTTATTTTTTTTGG
CCGGGGCTGGGTTTGAACCCGCCACCTCTGGCATATGGGGCCGGCGCCCTACTCCTTTGA
GCGACAGGTGCCACCCTGTATTCTTATATAGTAAAAACCTGTTAGCAAATACAAAAGGGT
AATATTGCCATTGTTATATGAAGGCTTTAAGGAAAATGTGTCACCTTTCCTAGGAGCTTA
AAATTGTAGCTTTTGAGGATGTTCATAGCTGAGGTTATGGATGAAGGCTCACTGGGCCAT
CTGGCCCAGTTACAGTGTGATCTGGGTAATTGATACTGCTGGCAGAAATGTGGTCAGAGG
AAGCAGACTGTTTTCTGATGCGCAGAGCATGATGGGTCAAACTCCAGGTCTTAGCAGTAA
GTCAAAACAGAGTACCAACCTGGGGTGATATGAGTGTTCCTGCTTGTCCTGCAGTTAAAG
CATGTATGTGATTTGGTCCAGGCATGCTGTTGCTCAGGTTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1257..1281, 1283..1363, 4141..4263, 4475..4604, 7556..7558, 7562..7566, 7568..7578, 7685..7752, 7881..8102
1001..1067, 1257..1281, 1283..1363, 4141..4263, 4475..4604, 7556..7558, 7562..7566, 7568..7578, 7685..7752, 7881..8099
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved