Otolemur_garnettii Locus MPZ
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii MPZ
Otolemur_garnettii
MPZ
GeneScaffold_3390
SNORA64
3406..3539
7050
AGTTCAGGTAATCCATTTGCCTCAGCCTGCCAGAGTTCTAGGATTATAGGAGTGAGCTA
CCACATCCAACCTCCAGCTGATTTTTTAATTTTTGTAGAGACAGGATCTCACTGTGTTGG
CCAGGCTGATCTCAAACACCTGGCCATAAGCAATCTTCCTGCCTAGGCCTCTCAAAGTGC
TAGGATTACAACCAAACTGATTTTGAACTCCTTACAGGAGGACTTAATTTTTATTTTCTT
TCTATTACCTTAATTCACATACTTTACATATAGCTGGTACTCAATACAATTTTGATGCCT
TGCTCTAAATTAAAATGGATTTAAAACTAAAGCACAACACATTGAAGAAGTTCCTTACAA
AGAGGGAAAGGTCAGGGGCTTCTTCCCTGGAAATATTCCAGTGGAGAAAAGCTTCTATCT
GGAAAAAATCACCCAGTATGCAGCAAGATGAAGAAAAAAAAACAAACTTCCAAAAGACCT
GGTCATCTCAAGAAGTCTGTGTACATGTCCAGCCTGTGTAGTCAAGATAACAAGGGCTAT
CCTATTTTCAGACTTCTCTGGAGGAACCTGCCTCTAGTCCCAGAGCTCTGAGGCAGCTTC
CCTCAGGAAAGAAAGCTAAGGAGGAGTCCCTTTTTATGGCCTTTGGATTGAGGTTTCCTG
CCTATCTATCCCTTAGAGGAGTGTGTGTGTGTCCCTTTTTCTGTCCCCTCTCTCTCACCA
CCCCCTAACATTCCAGCCTGGGGCAGGGGGAGGCCAGTAGACACAAAGCCCTCTGTGTAT
GGGGTGGTATGTGTCCCCCCACCCCTCTACCCAGACTATACAATGCCCCTTCTGCTCCCT
GTACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGATCTT
GGCTCAGGACAGCCCCCTCATACTGGAGCTCCGGGGGATTTTAAGCAGGTTCCAAGGAAC
CCCGCTCAGTTCCTGGTCCCCCACTCTTCTCAACCCCACAGATGCTCTGGACCCTGCCCC
TGCCCCAGCCATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGGGGAGAGGAGCTGCTGAGAATGCTCCAGATGTCTGCTGTCAGCTCCTAGTT
CTAGACTCTCTGGGCTGTACTGGACTAATCTGGGGTACCCTGAAATATGTTAAGGACAGG
GAGTCAGAAAAGGGCATGGTAGGAGAAATGAGTAGAAAGAGTCTTGGAGCACAGGGGGAG
GGAGTGTTCTATCCCAACACCTGTCCCACTCATAGAACCACTGGGCAGAACTGAGAAGGG
TAATGGCTGATATTGTAACAGGAGAAATAGAAGTTAGAGCCAGTGAATAGCCTCACTGGC
TATGTTGGGGATTTCCAAGAAGGCTATAGGGCAGAAGTCCCAGGAGGTGAGTAAATGATA
TTGCATGCAGAGGTGGGAAATTTGGGACACTAGGTATGGGGGGTGGCATAAGCCCCCCAA
TATTGGTCTGACAATGGGACTTTCTTTGCTTGGTTGCTTCCTACTCCTCTTGTAGAACAA
AAGAGTCTATAGTTGCCCACACACATAGGCTTTCTGGAATGACCATCCTTGTGTGGGTGA
GTCCTGAGGGTGGCACTGGGCCAGAATGGCCAAAAGGAGGATAAGGGTATTTGAACCACA
GAGGGCTCACATGCAGAGTTCTGGGCTTGGGGTCTTGCTCCTGTAACCAACTGAGAGGAG
TAAATAAGGTCTTTCCCTCTTTGTCTCCCTGGTAAAAAGCAAGCCATATGGTGACCAGGG
ATTCAGCAGTGAGAACAGTTGTGCCAGGGGAGAAGACTTACATTCTTTAGTTAGCTTCAT
TTTTTTTTTTCTGCAAGAAATTTGGGTGTGCTGTACTGTGAAACACTATGCAGCTGTTAA
AACTAAGATTGCTGTCTATGAATCAACATAGAAGTTTCCTCCAAATATATAAGCAAAAAA
AAAAAAACAAGTAGAATATAATGCAGTGTGTATGTAAAAAAAGAAAGCTTTACAAATAAA
ACTATTTGTTATAAATACACATATATCTAGAATGTATTGAGTTCATATTGAGTTTGATTC
TTAGGAAAAGCATGTACATTAAACTGATGCATGTAACAGTGGTTATATCTGGGAGGGGAC
TGCCCACAGAAAAGAAATTGGTTGGGGTGGGTGTAAAGGGAATGTTTAGCTTGCTTTCTT
TTCTCTTTTTTTTTCTTTCTTTTTTATTTATTTAATTTTTTTTGAGACAGAGTCTTACTT
TATTACCTTTGGTAGAGTGCTGTGGCGTCATAGCTCGCAATAACCTTAAACTCTAGGGCT
CCAGCAATCATCTTCCCTCAGCCTCCCAAACAGCTGGGACTACAGGCATCTGCCACAATG
TCTGTCTATTTTTAGAGATAGGGGTCTCTCTCTTGCTCAGGCTGTTCTTGAACTCGTGAG
CTCAGGCAATTCACCCACCTTGGTCTTCCAGAGTTAGCTTTATTTCTATTTCTTGAATAG
TTTGTAAGAAAAATGTAATATGTATTACCTGTATAATTTGTAATAAATTTCAAAAATGTA
AAACTCTGCATCTAAAGGATAGCTTAAGAGTAAGATACTGATACAAAGGGAAAGTGAGGC
ATGGTAACAGAAACCTAACCATCTAGAAGTCTTCAGGAGAATTCTTTCTCTCTCACCTCT
GAGTAGTTGCATTTGGCTTCACCTATGTGACTTTCATAATGAGGAGAGAGAGAAAAGAGC
TCCTCAGGAGCGCAGATTGGCCTTACAGTGGCTCCTCTTTCCTTAAGGGATGGAACAGGT
CCTAGGGGGAAGGGAGAAAGAGTTTTGTTACAGATAATTTCATTCCCTCTACAGACAAAA
TGAATGGCTTGAACAGACACAGCATTTATGTTCATCTATTCAGTCCAAAGAGCGAATTTG
GCCTCAGAATTTATGATTCTTCCCAATCTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGTCATACACAATCTAGA
CTATAGTGACAATGGCACTTTCACCTGTGATGTCAAAGACCCTCAAGACATAGTGGGCAA
GACTTCTCAGGTCACACTCTACGTCTTTGAAAAAGGTGTGAAGGGGTGGGAGTCTGGGAG
GCAGTTCAGGGAGGGGATCAGGGAGGACTGATAAGCTGGGGGAAGAGGCAAAACGCCAAG
CCTAATGACCTTGGCTCTAGGAGGGTGGGCAGACGGCAGCCTTGGCTGGAAATCCTCTAT
CTTCAATCGCAGGGAACAGGGACAGGGCTCGAAACCCCAGAGACAGGTCCCTGCTTATCC
CTTCACTTCTCTTCCTTCCCCTCCTAGTACCAACCAGGTACGGGGTGGTACTAGGAGCTG
TGATTGGGGGTGTCCTCGGGGTGGTGCTGCTGCTGCTGCTGCTGGTCTACCTGATTCGGT
ACTGCTGGCTGCGCAGGCAGGCGGCCTTGCAGAGGCGGCTCAGGTAAGGGGCGGGGTTCA
CTCCCTTCCCCCATCCCATTTGGACCCGTACTGTTCAGTTCGTGGGCGGGCGGAAGGAAA
AAGGAAGTCGGGTCCTCGGTGCAAGGGGTTGTGGCGAGGCCAAACCCACAGCGCCCCCTT
TTCCTGCAGTGCCATGGAAAAAGGGAAATTGCACAAGCCTGGAAAGGACTCGTCCAAGCG
CGGGCGGCAGGTTAGCGGGACTTGGGGCCTGGGCAAGCTGGGTAGGTGAACTCTGGGAGC
CGCTGGCAGCAGCGAGGAATGGGATGGAAACAGTCAAGCCCCACCAGATCTGGAATGATG
TGTGCACCCCCTCCCCGCAGACGCCAGTGCTGTATGCAATGCTGGACACAGCAGAAGCAC
AAAGCTGCCAGTGAGAAGAGAGGGCTTGGGGAGTCTCGCAGATAAGAATAGCCGTTAGCG
GCCGGGCGGGGGTCGGGGTCAGGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1009, 1012..1096, 4672..4838, 4939..5038, 5141..5254, 5487..5622, 5769..5829, 5960..5983, 5986..5997, 6000..6038, 6040..6045, 6048..6050
1001..1009, 1012..1096, 4672..4838, 4939..5038, 5141..5254, 5487..5622, 5769..5829, 5960..5983, 5986..5997, 6000..6038, 6040..6045
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved