Otolemur_garnettii Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RABGGTB
Otolemur_garnettii
RABGGTB
GeneScaffold_1583
SNORD45
1280..1351
5116
CGCTCCGCTTCAACCTGAGTGAGCGAGACATTGTCTCAATGTCTCAAGATAAAACTGGC
GGCTCACCCCTGTAATTCCAGCACTCTGGGAGGCCGAGGCGAGCAGACCTCCTGAGGTCG
CGAGCGAGTTCAAGAGCGGCCTGAGCCAAGCCCCGTCTCAAAAAATAGCAGGGCGTTGTG
GCATGCGCCTCTAGTCCCAGCAACTCTGGAAGTTGAGGCAAGAGACTCGTTTGAGTGGCA
CCTGTCGCTCTGTGGGTAGGGTGCTGGCCACATACACCGAGGCTGGCGGGTTCCAACCCC
GCCGGGGCCAGCTAAAACAACAATGACCACTGCAACAACAATCAAAAAATAGCCACGCGT
TGTGTTGGGTGCCTGTTCTCCCAAGTACTTGGGAGGCTGAGGCGAGAGAATTGCTTAAGC
CCAAGAGTTTGAGGTTGCTGTGGGCTGTGACCCCATGACTCTTCTGAGGGTGACAACTTG
AGACTCTATCTCAAAAAAAAAAAAAAAAGACTCGTTTGAGCCCAGGAATCTGAGGTGCTG
TGAGCTGTGATATCATGCGTGACAAAGTGGGACTCTCCACAGGGAAAAAATATAAGAAAG
TGCTTCTGTATGCTTTTGCTGCCTGTACACAAAAGTTGTCCAGAATTAGTAAGCTCTGAT
AAACTGGTCGTTTATTTTACTTTGAGTGAAAGATGGCAGCAACAGTGAATGCAGGTAGTA
ATTTTTTGGGTCAATGATGAGCCGGCATGTATTCTGAATCTAAAGTTGATTATTACTACT
TTAGCTCTAGAATTACTCTGAGACCTGAAAATTACTTGAATCTTGACTAAGAGCTTTAAT
GCTTTAAGTTCTTTTTGGTCAGATGCTTATAAATTTTAAATCGAAGGTTTTTTTGTGCCA
AGATGAAATCAGAAGTGAAATTCATGTATTGAATATATGCTTTGGGGTAAAACATTGAAC
AGTAACTATTAATGAGGTCACAACTTTTCTTATTTTGAAAGGGCACTCCACAAAAGGATG
TCATTATCAAGTCAGATGCACCTGACACTCTGTTATTGGAGAAACACGCAGATTATATCG
CCTCCTATGGCTCCAAGAAAGATGATTATGTATGTATGGTTTTAAAGTTCTTAAGTATAC
CATGGGTATCTTAGATTGGGGGGGTTATCAAATTCAGTCATGTTTCTTATCAATATTGAG
GGTACTTGCCAGATAAAATAGATTGGGGCTTTGAGGCACAAATGGGTTTCCACTTTTATA
GTTGGGGTAATAACTTTCAAGGTCAATGATGTTTTGGCATGTATTAGCTGACTGCACAGT
TGATGTGAGCTCTAATGTGACACTGAGACCTTGGAGGATAAAGTTTGTGTCTTCGGTTTA
TGTAAATGTTTAAAAATCACTAAATAGAGTTATTTTGGTCTTTGTGAAGATCCATGAGGT
GGGGTTGAAGTCTATTTCTGTATATATGAGTTAGTATATTTGAGAATCGTAGAATACCAC
ATTACAATTTATCTGTAGAAAAATTATACTTCATGATTAAAGTTTTTAGTTTGTTGATAA
TACAGTTTTTTAAGTAACATGGTGGCCTGCCTCCTTGAGATAAGGTTTTAATTTATACAT
AGGCAAAAGGACATGCTTGATAACTTAAAGGGAGTTGATGACAGCATGAGAATAAACTGA
AAGCAGTGTTTACCTCATATTTGTCTTTGTTGCAGATTCTTACTCTGTATGATAGTATTA
ATGTTATTGACGTAAACAAAGTTGTGGAATATGTTCAAAGTCTACAGAAAGAAGATGGTT
CTTTTGCTGGAGACATATGGGGTAATGTTAAATTTAGTCCATGCTACCCAAAATACCAAT
ATTAAAAATGCCTTGGCTTTGCTATTGACCTTTTTATAAGGAGATTTTAAGTTTATCATC
TTTTCAGGTCCCACTAAGCAGCTGGTCTAACTGGAGTTAATGGTCTGCTGGAAGTTCCAG
CATGCACTGTGGTAGTTATGTCAGCATACAAGAGCACTGGAACAGAGGGGGCCAGTTAAG
GTAGGTGAATTTTTTTTCCCCAATATTTGGTGGCTTTGTAAAGTTTTTAAACTACTTGCT
GGAAAGGGAAACATCCTCAAAAAACTTTACAAACTTACTGAATATTTGAGTGGAGGGAGG
GAATAGAATTTTATTTGATAAATGTAGCTAATCTCTGCTTTAGGGATGAATACAGTGCAG
GACAGAGAGACCAGCTGCTTCATGGGATATGAAAATCTACTGTGATAATGTGGAGTACAT
TTATTTGCCTTAGTAAAACTGAAGTAGTCTTTTGAGGTCTTTTCATTTCTTTTTCTGGGA
ATTCTGTAAGCAACCTAAGAAAATTTGCTGTCAAGTTTTGAGAAAACATTTTTAGTTGTT
AGCTTCTTGAAGTAAAGGCATTTACTTCAGACTGAGTTTCCATCTAAGTAAAATAAACAT
CAAGCTTGACCTCATTTAGTGTGGTAGTTGTACAGATTGTGTTTTCAGGTAACAAACTGT
ATATAATGATCAGAAGCTTCCAGTAACAAGTGCATTGGTTTTGTCTCTGTTTAGGAGAAA
TTGATACAAGATTCTCTTTCTGTGCAGTGGCTACTTTGGCTCTTTTGGTAAGCTTTGAAT
GTTGTATTGAAATGATTACTTGGCCATGAATAGAATGGAATTGAATAAGCATATTTTCTT
TCTGTTTATAGGGCAAGCTTGATGCCATTAATGTGGAAAAGGCAATTGAATTTGTTTTAT
CCTGTATGAACTTTGATGGTGGATTTGGTTGCAGACCAGGTTCCGAATCCCATGCTGGGC
AGGTAATTTAATATATTAATGTAGATTAAAATTTAGTGTCAGTTGAGAAGAATGTCCATA
GAAATTTCGGTATCTGTTAATACAAATTAAATTAATTGGACATGGTATGTTATATAACAA
TTGCTTAATTACTAATTAAGGCTAGCATTTTGATAATAACTTGGTTTTATATACCTTCTC
TTTAGTGGGTCTCTCTGACCCCATGCAAACATAAGTTTTATAAGCACCAAAATACATTTT
CTTCATTTTTCCATTAATTTTTAATTACCTATGCCAATGAAAATATTTAATCTCTACCCA
CCCCGAGCTCTTTGTGGCAGAGAACATTGTGTTTATAAATAGTTGTGCAATACTTAGCCA
TGAAGGAAGTTTGAGAACATTTTGGATCCTGGTAATAGTATGCATGGATTACTAAGTGTT
AAAAATATTAGATCAGAAAGTAAAACTTCAGGTATAAAGTGGAGTTTTAATAATTTGAGT
AGTTTTTTTATCAGTTTTACTATCAAGGAATTACTATACACATGTACTTTATGTTTGTAA
TTTTAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAGTCAGTTGCATCAAGTAAAT
TCTGATTTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGAGGACTCAATGGA
AGGCCAGAGAAGGTATTGTGCCTAAGCTATGTTCTACTAGCTTTATATATAATCTTAAGT
GAATCTTGCTTCTTTGTCTTGCACATTTCAATATTTATTGCTCTTGTAAATTGAGCATGA
ATTTTCTTTTACCTTCCTCTGTTGGAATTTTTCAGTAATACATCCTAAAAAGACTGCCTC
TGGGAAAAAACTCCTTGGGTTGTAATGCTCATTAGTCCTGGTATCCATCAGACACACCTG
TATAAGAATCTCCAGGGGTGTGAAAGTACAATTGATTTTGACAAAGGATTGTGTGGGTTG
GAGTTTTGTCTCCTTTTAACACTGGATTATCTTTAATTCTAAGCAAGCATTTTAAACACG
AATATTTCTGTATGTCCCTTGATTTTCTCCTTCCTGCTCCTTCACTAATTATTGTATTAC
TTAAGAGTGAGACTTAGCTATTATTAAATTGTTTCTAAAAACTAGAGAAATAAAAGAGAA
TAAAATTGTGGCAACTTTTGTGATCTCTGTTTCTTCCTTAGTTACCAGATGTGTGCTATT
CATGGTGGGTGTTGGCATCTCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGA
ACTTCGTAGTTTTATCTTAGCATGTCAAGATGAAGAAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1715..1820, 2574..2626, 2711..2821, 3366..3491, 4001..4078, 4081..4116
1001..1108, 1715..1820, 2574..2626, 2711..2821, 3366..3491, 4001..4078, 4081..4116
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved