Otolemur_garnettii Locus ENSOGAG00000012796
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000012796
Otolemur_garnettii
ENSOGAG00000012796
GeneScaffold_2053
SNORD62
65556..65641
74856
ATCTGTGTAACAACCATTCAAAATAAAGTCATAGGTCGGTGTGGTGTCTTATGCCTATA
ATCCTAGCACTCTGGGAGGCAAAGGCGGGTGGATCACTTTGAGACCAGCCTGAGCCAAGA
GCAAGACCCCATCTCTAAAAATAGCCGGGTGTTATAGCGGGTGCCGGTAGTCCCAGCTAC
TCAGGAGGCTGAGGCAAGAGGATCACTTGAGCCCAAGAGTTTGAGTTTGCTATGAGCAGT
AATGCCACGGCACTCAACCCCAAGTCAACTGAATGAAACTCTGTCTTAAACAAACAAAAA
ACAGAAAGTTATATTTTTTTGATCATCAGATCACCTGGACTCTCGGTGACTAGGGTCCAG
GCAGCTCTTGCCCACTGCATGTACTGTGCATGGCTGTGCTTCTGACGGGGGCGTGTTCCC
TGTCTGCTCAGTAACTGCCAACCAAAAAGAAACTCAGGCATGGATACATATCTGGAAGAG
ATGTTTTATGCATAATTTTTCATTTGAAACTGTTTTCTGATAGTGACTCTTATTCTCTGA
TGGCTTTTTATACCTGAGGGTTTGTTTCCATGGGGGCAGGAGTGGCCATTTTGTGACTGC
AGAGTGGTGACAGTGGCTCCCTGCTCCTCATTAGGCATGGTGGCCCTCATTCCATGTGCT
GCTAGCTGTGCCAAGAGCGCCCATCTCCCGAGTGCTCCCTTGCCAGTTGTGGCATTGCAT
GCTTTGCAAACACCATTTCGTTTCACCTTCACAGTCCCAATGGCTTTCCTTGTTATCCTA
GTTTTACAAATGAGGACAGAGGTGTTGAAATCTGGTTCTTGCCCTCACTGCATTTCAGGT
ATAGTGAAGGAAAGAGCAAGATTCAAACCCAGGCCTGCCTGTGCTGCCTCACGACGGTGC
TGGAGAATCCTGGGCCTAGAGTCTTAGAGTGGGGTGGCCCTGCACCCTCAGTCTGTGACA
CCACCTCACCAGAGACTTTGTTCTCTTGGCAGAAGCCCTCAACGGGCAGCATGTTCCGGC
AACAGTCCATTGAGGAGAAGGAGGACAAGCTGCCCCCACGCCAGAAGTTCATCCAGTCAG
AGATGTCTGAGGCTGTGGAACGAGCCCGAAAACGCCGGGAGGAAGAGGAGCGCCGAGCGC
GGGAGGAGAGGCTGGCTGCCTGTGCCGCAAAACTCAAGCAGCTGGACCAGAAGTGCAAGC
AGGCTCGGAAGGCGGGCGAGGCCCGGAAGCAGGTGGAGAAGGAAGTGCCCCGGTCTCCTG
GCACTGAGAAGGTGTCCCCACAGGAAAACGGCCCTGCCATCCACAAAGGTAAGGGGATGA
CCCTTTCCTACCAGCTGGGAACTCCAGGTCATTGTCATCTGTATATCATCTGCATCTTCC
TCACTTCACCTGTGACATGGAGTGTGTGGTGCCCACCTGTCCACATGCTGAGGACCCCAC
AGTGCCCAGTGCAGAGGAGCCCATGCGTATGGTGACTGCTGACAGCTCATCATCATCACC
TCTGGCCATCGTTACCATCGTTACCTCTGCCACTGCTCAGCCAGGGGCGCATGGGCTAGA
GGACTTTAACAAAACCACAGGGTCTTTTACCTGGAATGAGGGACGCCCACTTGCTCATTA
GAATCCATTTTTCCTGCCATTGAAGGAGAAGGTGCCATGGCCTTATGAAAGAGACATTGA
ACAGTTTTAGGAAATATGATCAGCTGTATTCTTTATAATTTTCTTAAATCATTTCAGATA
AACTTTTGTTAGGAAACAAGGGTTTATGCTAGTTTTGATTTCCTAAAGGTTCCTTGGTGT
GTGGTCTGATTGACATAGTGGCCTCCTGGCCAAGGAACACAGTGGATTCAGCAATTTTCC
TTTCAGCCCCCTGAGTGTGAGTGAAGATTGTGCCAGTCTTACAGGCTTGCCCAGATGGGT
GATGGAGGAGTTGTGCCAAGTGCTTTCTACCTTTTAGGTGCTGTTTCAAGTACGTTACAT
GAATGTAATTCTCGCAGAAGCCCTCAGGGGTTAGCATAGATGTTATCCTTATTTGCCAGA
AATAAAAAAGAATGGGCAAGGAGAGGCTGAAAAATCTGCCCGTGTCATGCAGCCTTTGAG
AGACAGGGTCTCTCTCTGTCACCCTGGCTGGAGTGCAGTGGTATGATAAATAACAGCTCA
CTGCAGCCTTGAACTTCTGCCCTCCAAGCAGTCTTCCCACCTCGGCCTCTCAAAGTGCTG
GGGATTATAAGTGTGAGTCTCCATGCCTCTTTTCAAGAAAACCTCTTCACTTGGAACTTA
GATCCCAGTCTGGCCGTTACCATGTAACCCTTGAGTAGTCACCCAGCTTCTCCACCCTTA
AGTTTTCTCACCTTTAAGTCAGTGGTAAGTGAAGCCTCCCTACAGTGTTTGTGAGGAACC
CTGAACTCGTGCATGTGGCCCACTGGGTGCAGTGCCAGGTTCAGGGCCATGGGTGGCCTA
GGTGTGAAGAGTAATGCCAGCAGGAAAAAGTGCTTGCAGTCAACCTTAAGGCCGCTGAGC
CTCTCTGAGCCCACTGAGGTGTTTATCTGTGGCTTGTTTCTAGGCTCCCCGGAACTCCCT
GCCCAGGCAGCCCCCACCCCGTTCCCTGAAGAGGCACCCACAGTGTCTCCAGCTGGGGCT
CAGAGCAATAGCAGTGAGGAAGAGCCCAGGGAGGCTGGGTCCCCAGCACAGGAGTTGAGC
AAGTATCAGAAGTCACTTCCTCCCAGATTCCAGCGCCAGCAGCAGCAGCAACAACAACAG
GTAAACGGATGAGACGGTCGTAGGCTGTCAGACACAGACCTGCTTACTGACCAGACATGG
CCTTCCTCCCCCCTACCCCATGCCCACCTTCAGTGAAAAGCATAGTGAACAGCATGGGTG
TCAGGAGTTACACCTTGAAACTTGTGGCTTTGGTAAATCAGCCCCCCGCAATTGCTGACT
TCTCCAAGAGCTGAAGGCCCCGTGCAAGGTACAGCCCTGTTGTGCTTTATTGGTCCTGCC
TTCTAGGAGGTGGGAAGAGTCACTGTCTTGAAGAGTGGTCCTTTTCGTTGCGGTAGTCCA
CTTGGGATACTCCATAGTGCAACAACAGTGGCTCTGACTGGGAGAGGTCTGCCAGCTGTG
TCCAGAGTAGTCAGAGGCATGTTGGGGTTAGGGACATAGGCTTGTGAGTTCCCATCCCAG
CAGCACAGTCATGCTCCTCCAGCTCATGTTTCTTCAGAAACTTGGACAAGCAGATGCTGG
CCTCTCGGTGTGACAGGGACCCTATGAACAGACTTGGCAATGTATCATTATTGGTGTTTT
ATAAACTTTAAAAAGGGACCTGCCTTTCGCCCAGAGGAAGATCATGCAGATAATGGTTGT
GGTCATACCCGTCTCCCTGGTCCTGATCACCCCTGAACACTCAACAGCAGTTGTGTTTCT
TAGAGTATAAGAAATAAGGAAGAAAGTCAGCCTCCCTGAGGAAGAAGTGTGCTATGGTGG
GAGGATGAGATGACATGTAGGCTTCACCTGGTGCGTGTCCAGCAGTAAGGTGTGCAAGAT
GCCTTTGTTAATATTGCTGAGAATGTTTTAGAAAAATGTGTCACTGGAGCAACAAACCAA
GGGCTGCAGCTTCTGCCACTATCTCATTTAGTTTCCTTTAAGAATTTCAGCCTGGCTCGG
CGCCTGTGGCTCAAGTGGCTAAGGCACCAGCCACATACACCTAAGGTGGCGGGTTCGAAT
CCAGCCCAGGCCTCCAAACAACAATGACGGCTGCAACCAAAAGAAATAGCCAGGCGTTGT
GGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCTTGAGCCCA
GGAGTTGGAGGTTGCTGTGAGCTGTGGTGCCACGGCCCTCTGCCCAGGGGGATAGCTTGA
GGCTCTGTCTCAAAAAAAAAAAAAAAAAAAAAGAATTTCAGCCTGGCCGCTCCTTCTCTT
TGGGCCACTGGGAATGTTGCAGTGGTGCCTTCATAGCACTTTACAGCATCATGGTATAAG
TGTGCAACGCGCAGTTGCCATGTTCTTGGAGCAGAATTGCTGATGAGAGAGATCTCTGGA
ATTACTCATGATAAACAGCATGACAGCTGCTCTCAGGAACTCCTTGGAGGGGTAGGGGAG
GCAGTGGTGGGCAGCTCCTTCTTTAAGGACAGAAAGGTGTCTAAAGGCACAGGGAAGCCT
GTCTGTTGAGATTCTGTGGGACCTGGGGTATGGCCAGGAGGAAAAGCTTTGGGGTAGAGG
CTTGCAGCTGCTATGTGTGCTGGAACTGGTCTTGCCAGATGACATCTGTTTATTGAGTGC
TTCTAAAGGGGACTGGGGTGCTGACAGGGAATCCAGTCCCAGAGGGCCTGAGAACTGCAA
GCCTGGCTGGGGAGCTTTTTTGTTTGCAGAACAGAAGTAGGTGTGCTAGAGGCTTCTTGG
GTAGGTTGTCCTCAGAGTCTAACTCAGCACTTCATTCTTTCTGGGATGCTGTTTCAGGGT
TTGTTTAGGAAGTTGGCACCAGAGGTCACTAGTGGAATAGAGTGAGGTTTGAAGTGAACT
CTCTTGAATCAGGTGCCTTAACTTTGAATATTCCATTGATATTTCATGTTCATCCTTTAG
TGCAACAGATAATTTAATCTTGTATAGTGAAGTGTGGTGCCAAGGGCAAGGATGCCACTG
TCAGCTAGGCATGCACAGTCTCTTGGGACTTAGCGAAGGATACTACCATCAAAAATAGTT
AACTGAGGCTGGGCTTGGGGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCCGAGGTG
GGTGGATTGCTTGAGCTCACGAGCTCGAGACTAGCCTGAGCAAAAGTGAGACCCTGTTTC
TACTAAAATAGAAAACCTGAGGCAAGAGGATCACTTGAGCCTGAGTTGGAGGTGGTTGTG
AGCTATGACATGATGGCACTCTACCCATGGCGATAGCTTAAGACTGTCTAAAAAAAAAAA
AAAAAATACAGTTGACTATTGAGAGTGCTACAGATGAGCACCTGCAGTTTCATGGGAGCA
GAGAACAGGGTCTCATTGTGACAGGCCTCCTAAAGCTTCGGTTCTCAACTTGTGGGTCGT
GACCCACAGGAACTGTATTAAAGGGCCGCAGCATTAGGAAGGTTGAGAACCACCGTCCTA
GAGTAAGTGTTGTGTTGCATATTGTGTATTTGTAGTTGGGATCTTGCTCCTTTGCCTGGT
TTATAGGGCAGTGGGGCAATCACAGTTCACAGCAATTGCACACTTCTGAGCCCAAGTGAT
CATCCCACCTCAGCAACCCCAGTAGCTGGGACTACAGGTATGCCGTTATGCCCAGCTAAA
TTTTGTATTTTTTGGTAGAGATAGGGTCTCAGGCTGACCTCTTGACCTCAAGTGATTCTC
CTGCCTCAGGCATGAGCTGCTATACCTGGCCAGGAAGTGTTTTTTAAGCTAGATACCTGA
GTTTATGGTTATAGGGAAGAGCCTAGCAGAGGTCCCAGCGTGTTGCCATGGCCTGAAGTG
GGCAGGCAGAGATGTGTGGAGCAGAGAGTGGAGGGCAAGCCCTAGAGTCACAGCTGAAGG
CACAGCTCAAGCAAGGTCTCATAAGACCTTGTAGATCATGTGTATCCTGCTCTGTTCAGG
CTGGTTGGTGAGAGCAGTGGTGAGCCACTAAAGCCTCTGGTGAGCTAGGTGCTGACATAT
TTGGGCATGGGGGTTGCAGGGGTGGCTGGGTGGAGAGTGGTTTGAAGAGGCCAGGTGGAG
GAGAGAAAGGAGGGGCCCCTGTCCACAGGTGGTGGCAGCAAGTAAGAAGTGACCAGCATG
TAGATATTCCATAGGAAGGGTGCTGGTTTGTCACCAGGAGTGTTTGATCTAAGTGAAAAC
TGAGCCCCCTCATGTGACATTGGTGTGAATGGGCCACTGTGTGATAATGGCTTAACTGTC
CCCCAAGGGCCCCCCGCCTGAGCTATAACATGGGGGCTTCGCCTTGAGCAGCTGCCGTCC
CATCCATCTTTGGTCTCTTTCTGGGAGAGCTTCTGTGCTGCCTGCTGGAAAGTGTCTCTG
ACCATCCCGCGTCAGCCTGACCAGCTCTCTCTGCCTGGGCAGGAGCAACTTTATAAGATG
CAGCACTGGCAGCCGGTGTACCCTCCGCCCTCCCACCCCCAGCGCACCTTTTACCCGCAC
CATCCCCAGATGCTGGGCTTCGACCCCAGGTGGATGATGATGCCTTCGTACATGGACCCT
CGGATCACCCCCACACGGACCCCCGTGGACTTCTACCCCTCTGCCCTCCACCCTTCAGGT
AAGCGTAAGCACCACGCTGTAGCCATTGGTCTATACTTGTAGAGCCCAGGATAGTGTGGT
GGCTGGGGTGTCACCTTATTAGTTAGACACACCCACCTGTATTCTAGTCGGACCTCTTGG
TCAAGTCACAGGACTGTTCTGAGTTTAATGTTCTCCTTTGCAAAGTAAAGGTATAATAGT
AGTTCCTTTCTTAAAGAACTGTTGGGAAGGCTCAGTAAGATCATGCATTATAGATTGCTC
TACTTAATCTTAATCTCTCCCATGCCATCTGCCTCTCTCTCCAGTCTTTAATGCTTTTCT
TTGGACCTTCTCTTTCTTTCTTCCTTGGTTAGTCTTTCCCAAGTTTTGTCTGATACATTT
TTTAGAATCAGCTTTTGGGTCTTTTGTTCCTCTATCTTATTTGGGTTTTATTTACATAAT
TTCTGACTTTTTTTGTTATTGCTTCAAAAATTATTGTTCTTTTTCTGTTTAATAGTACTG
GATGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TATGATTGTGGATTTGTCAAATCTTCCTTTCGTAAGCCTATCAATTTTTGCTTTCTATCT
GGAGCCATATAGGTGTGGAATTATATGATCTTGTTCTTCTGTTTTTATGTAGCACTCTGG
TTATCTTTTTTTTTTTTTTGAGACACCCTGGATAGAGTGCCACTGGTGTCATAGCTCACA
GCAACCTCAAACTCTTTGGCTCAAGTGATCCTCTTGCCTCAGCCTCTCAAGTAGCTGGGA
CTACAGGCACCCACTGCAATGCCCAGCTATTTTTAGAGACAGGGTTCTCATTCTTGTTCA
GACTGGTCTCGAACTCCTGAGCTCAAGCAATCTGCCCACTTTAGCCTCCCAGAGTGCTAG
GATTACAGATGTGAGCCACAGTGCCCGGCCCTTTGTTATCATTAATAACACTTACTGTCT
ACTTTGTCTGACAGTAATGTAATTATTCCTATTTCTTTTCTTTTTTTAGTTCAAGAGGTA
AGGTCTTGCTCTGTTCCCAGGCTGAAATGCAGGGCATGACCATAGAATACTTAAATCCTT
TAACTTCTCAATCTTTCATCTCTGCCTCCTGAGCTTCTGGGACCATAAGCACCCATCACC
AAGCCCAGCTAATGTAAAAATATTCTTTGCAGAAACAAGGTCTTGATATGTTGCCTAGGC
AGGTCTTTAGGGTTGGAGTTTAGCTTCCTACCTTAGCCTCCTAACATGCTGAAATACAAG
TTCCAGTTTTCTTTTAATTAGGATTCATTTAATATCTTTTGTTCCAACCTTTTGCTGTCA
CCCTCTCTGAGCCTTTATGACTGGAGAGTTAGTCCATCTTTTACCCAATATGAAAATCTC
CTGACTTTCTATCACCAGATGACTGACAAGTATTTAAAAAATAAGGAAAAGAAAATCTGT
GATTTTTTTTTTTTTTCTGAGACAGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCCCTGG
CATCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGTGAGTCTCCTGCTCAGACTCC
CAAGTAGCTGGGACCACAGGCGCCCCGCCACAACGCCCAGCTATTTTTTTGGTTGCAGCC
ATCATTGTTGTTTGGCGGGCCCGGGCTGGATTCGAACCCACTACCTTAGGTGTATGTGGC
TGGCACCTTAGCCACTTGAGCCACAGGCACCGAGCCAAATCTGTGATTCTTAATTGCCAA
AGTTGGTCCCTTTAGGTTTGTTGTGATTATTATATTTAGATTTTCCAGTTGTCCTGTTTT
ATGTATTCTGTTTATCCCTCTTTCTGTATGCTTTCTTTTTATTTCTTGCCTTTTTTAGAT
TAAGTTTTGCTATTCTTTTTGGGGGGTTTTCCTTCTATATTCTATTACTAGATGTTATTG
GTTACTTTGAAATTCTAACACATTAGTAACTTAGCAAAGGCTCATCAGTATCATACTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCA
TGGCATCACGCTCACAGCAACTTCCAACTCCTGGGCTCAAGCTGAGTCTCCTGTCTCCGC
CTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACACCCGGCTATTTTTTGGTTGCAG
CCGTCATTGTTGTTTGGCCGTCATTGTTGTTTGGCCGTCATTGTTGTTTGGCGGGTCCGG
GCTGGGGATTCGAACCCGCCACCTCAGGTGTACGTGGCTGGCGCCCTAGCCAGTTGAGCC
ACAGGCGCCGAGCCCCCCATGTGTCTTAAATGAGGAAGAATATATGAAAGAGAGGTTATC
TCTGTGTTGCCCCCTGGGAAATTGCCTCAGAACTGTTTTCTAGTTCAGTTCTCTGTCTAG
CAGTGTCTAATCTGCTTTCTTACTATCCCAAGTAGCCTTTTAATTTTGGTAACTGGAATT
TGTTTCTACAATCTGTTCATTTTGAGGGGGTGGGTGTTTGTTATTTTTCTTAAATTTTTA
ATCCCTTTTATGGCTTTAATCGTGTTACGTATGATTCTCTAGTGTTTAACAGATTATTCT
GTTATCTCAAGTTCTTGTGGAGGCATCTTGTCCTGGGGATCACTGCAAACTGGTGGTGGG
TTATTGTCCACATGTGTTCTGGTAGTTGGGATGGCAAGTTCAGTTTTACCAGTTTTTTCA
CTGAGGACCCAGTATGGTTGGTGTTGAGCCATATATATCCTTCCAGTGTGGTATTGGGTT
TTCTTCTGCCAGTCCAGAACCACCTTTTATGTTAACATGGGAGGCCTCTGGACCACTGTG
GGAAGTAGACATCTGCACTCTTCCCTATCGCAGGCCTTACGAAAGCAAGCACATTGTTTT
GGGTTGGTGGGGGATAGTTGTCAGTGCTTTTTTTCTGTCCTAGGCCAAGACAGACTTTCT
AGTTAATTCCCACTACTAAAGGGTGTATGTTTGTCTACTATGCTTTCTGAAGCAGTAGCC
CTTTAGAGGTCTTTATTTGAAGGGTCATCTCAGTTGCAGTTTCCTGCCCTGTCCAAAAAG
GCCTCATCACCTGTCCTGTGAGGGTATGAAAGGGTATGTTTTCCAGCGTGCTTCCCTTGC
TCCTTCCAGGGAAGTTATGGTGGTAGTCTGGGTAGACTTCATAGGCCTTGGGACAGTTCA
GATTGCGTGCATGAGTACGGTTCTCTGGTCAGAAGAGATAGGAATCCCATGGTGTTTCAG
TGGGCAGGCTCTGTGTGCCTATGATAGTTGGGGCTAACAGGTCTGCCCTGAGCCCTTGAC
CCTGAGATTGGGTAGGCCTCTCTCCATAAAATGACAGACTCTAGCCTTTGCCTTCCCCAG
GACTGATAAAACCCATGGCACCTCAAGACCCTCTCGGTGGGACTGGCTGTCGCTCTGAGG
ATCAGAACTGTGTGCCCCCACTCCAAGAGAGAAAGGTGACCACCATGGATCCGGCTCCTG
TGTGGAGCCCAGAGGGATACATGGCCTTGCAGAACAAAGGCTACTCGATTCCCCACCCGA
AGTCTAGTGACACTTTGGCTGTGGACATGCATGTCAGGTGAGATGAAACCTAGTCCTACC
ACCTTGCCACTGGAGGGAGACTCCAGGGTCCTGACTGAGAGGGCCTTTGGGGAGAGGTAG
TGCTCGTGGGAGACAGGCTCCCCCAAAGGGACAGGCAGGCAGTGCCTTCTGGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAGTCCCCCTCATTGGCAGAGCAAGAGGCCCCGGCAGCCCCTGGGCAGGGAG
AATGGGGGCTCCGACTCATGTGGAACCCGGCGCCCATGGACAGAGGCTACACCCCAGACT
CCTGCCGGCACTCTGAGTCATTCAGCAGCAGGCCCTTTGAGGATGGCCGCCTGGAGGACA
AGAGGTCCTTCTTCCAAGATGATCACGTGGCAGATTCTGAAAATGTAGAGAACCGGCCCT
TCAGGAGAAGGCGCCCCCCACGCCAAGACAAGCCCCCCCGCTTCAGGCGCCTCCGGCAAG
AGCGTGAGTCACTGGGCCTGTGGGGGCCTGAAGAGGAGCCCCACGTGCTGGCGGGTCAGT
GGCCAAGCAGGGCCAAACTCTGTCCTGGGGACAAGAGCAGCACCGTAGGTCGCAGGTCCC
CCGAGCTCTCCTACCAGAACTCCTCCGACCATGCCAATGAGGAATGGGAGACGGCCTCCG
AGAGCAGCGACTTCAGTGAGCGGCGTGAGCGGCGAGAAGGCCATGGGGCTGAGCCTGACC
CCCAGGGGGATGCTGGCCTGTCCGGGGCCAGTTTGGGTGAGAAGAAGGAGCTGGCCAAGA
GGAGCTTCTCCAGCCAGAGACCCCTGGTTGACAGACAGAGCCGAAAGCTGGAGCCGGGAG
GGTTTGGGGAGAAGTCTGTTAGGCCAGGTGGTGGTGACACTTCCCCCCGTTATGACAGCC
AACAGAATGGGACGCCTTTGAAAGCCAAAAGGTAACACCAGAACACCATCCCAGGCCCTT
TTTGTTGTCGTTGTGATGTTTAGCAGCACTGAATTCATGCATGCCTGCCAGCCATGGGTC
AGGTGCTCCGCAGGCGCCTGCCCCAAAGGCCATTGTGTGTGAGTGTCTCCATCACTCGCT
CCTGCATTGCTTGTCTGCTTCTCTTGTGGTGGTGTTGTGGCTTGACAAAGCTAAAGCTAG
ATGGCCCCTTTTCCCCTCAGTTCTCTTGTGGCAGCTGTCCTGGCGCCTGGCCCCAGAGTT
CAGCCTCTGTAAGTGTCCTTGGAACCTCTCCAGGGGCTGCTGCACAGAGGGGCACTGTCT
GTGCTTGGAGCCTGGTGAGCCTTGGTCCATCCACTAGATCCTTCTGCTCTGGAGCTGCTG
CTAGGCAGGGGTCTGGGGGCACTGCTGGCCTTCTGGCTGTGCAGAGGTGACTCTTCCCAA
GTGGCTGTCCTCCTCAGTGAGGAGACAAAGCACTGCTGCCGGGGTTGCCACCTCAGCACA
GTAGGGGCCCAGCAGGTGAAAAAGAAGCAGGCTGCCTAAGGCCTATGTGTCTTTCCTCAC
ATACAGAATTAAGGGACTTCCTAGAGGAGGGTCTGTGTTCGGTGCTGACTCTTGGCCAGT
TGTGCTGCAGGGTTTATTGATAGCCAGAGTTCATGCCTCAAGTGGGGAAGCAAGGCTGTG
CAGAGGCCTTCCCTGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGA
TCTGGAGAGCAGCAGCAGTGAGAGCAGCACGTCTGTCAGCTGCTACCCTGAGGTGACCTC
CAGACCTGGGCTTTCTTCTTTGGGGCATTCTGCCTGTGAGCCAAACAAGTGGAATATTAG
CTGCTTGTTGGGTTCCTCTGAGCCACAGTGGTGAGGGCCAGCTTAGCTGTATTTGCTGCT
GCAGCCCCCAGACAGGAATACACATTTGGTTGCCTGTGATGTGATGGAAGAGTAGACCAG
TCATTATGTCCAGTGATGTGAAAGAGGACAGCCACATGACCTGAGATCTCGGGGGATGGG
ATCTACTTTCTTTGCCATGTCAGAGTCATCCTTTTTTATCTTCGATGGCGATCCCAGCAA
GAGTCCTAAAGCTCCCCTAGCTGCCATGTGCCTTTCCTGATCCAGGTGGGAAGGTTTATA
AACTCCTAGAACAGTCTGTGGAAGGCAAACCTGGGTAAAGCATATCTTACCTTTTGGAAG
ATTTGTTTCCTTGAGAAATTATTTTCTAAATTTTAGATCCAGTGCTGTTTTTCTGATAAC
TTTTCCTTTTAAAATACAAAGCCAGCTCAGCACCCATAGCACAGTAGTTACAGCACCAGC
CACATACACCAGGGATGGCGGGTTCAAACCCAGCTCAGGCCAGCTAAACAACATTGACAG
CTACAACAAAAAATAGCCAGGCATTGTGGCAGGTGCCTGTAGTCCCAGCTACTGGGAGGC
TGAGGTAAGAAAATCACTTAAGCCCAGGAGTTTGAGGTTGCTGTGAGCTGTGATGCCATG
GCACTCTACTAAATGCAACATAGTGAGACACTGTCTCCAAAAAAAATTAAAAATAAAAAT
AAAAATAAAATAAAAACCATTTTAATTGAACAGGTTCTTTTTAAATGCCTTCTTTGCGCA
GGGCCCTGTGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGGGCTTTTTAGATTTGTCTATGGCCAGA
TCCAATCTCTCCGGCCTCAAGATGTAATTGTATAGCCAGATTTGTCTTGGGTGCCATGGG
AGTACATATAGAACTCCTTTTTCTTAGGTTAAGCGCCTGTAGCTCAAGGTGTTAAAGTCG
CAGGCACATACACCCAGAGCTTGCCGGGTTTGATTCCAGCCTGGGGCTGCCCAACAACAA
TGACAACCTACAACCAAAAAATAGCTGGGCGTTGTGGTGGGCGTCTGTAGCCCAGCTACT
TGGGAGGCTGAGGCAAGAGAATCAATTAAACCCAAGAGTTTGAGGTTGCTGTGAGCTGTG
ATTACACGGTACTCTACCCAAGGTGACAGCTTGAGACTATCTCGGGGGAAAAAAAAAGAA
CTCCTCTTCTTCCTGCCCTCTGAGAAGGTGCTGGCATTGCTGGGGTCTCTGGCTGCCACA
CACTGATGTGCGTGGCTCTTGGCCCTTTCCCTGATCTGTGTACCTTTCGGACTTACTGCC
AGGCAGTTCTGGGCCTCACTTCTGCCTTTCTTATCCCTTAGGTTGGGCCAGGCCTGTCCC
TTTTCCATCTGTCATTCAGTTGTTGGTTCTGCTATGCTGGGTGGTCATGGTCATGGCAAG
AGCAGACAAAGAACCAATGAACTTGAGGAGCTGGTGAGAGCCTGATGGCCAGCCCTCTAC
CCCATCCAGCCAAATTAGAATCTGCATTTTTTTACACAGTCCCCTGGGGATTGTTACAGG
ACCAGCGCAGCCCTGGTCTCTGCTGTCCCTTCCTCTGGTGTCTGGCTGAGGGATCTGCAG
GACTGTGTAGCATTACTTCTGGGAGGACTTTTTTCTTAGAGGCCTTGGGTGGCTTGAGGT
TGAGGTGGCATTTAGGAGTGAGATATTCTGTCTGTTCTAATCAGGGTACTGAAGAGGCTA
ACGTTTTCCAGGCGTTTGGTCTGGTGTGAGAGGCTTTGTTTGCTTGTCTTGATTCAGCCC
CACAGTTCTCCTGTCTATGTTGGAACTGATGATACTGTATACAGTCAGTAACAACTCTAC
TTAAGACACAGCTGCCTTTTCAGTGGCCCACATGCGTCCATTTTGTTTAACTATAATCTG
ATTCTTTAGGACAAGAATTATATCTTTTTGAGATTAAGATCAGTAGCTTTGTAGGACTAT
AAAAATTTTAGAACTAGATGAAGCTTCTAGAATCAGTTTCATTTCCTCTTTGGGGTAGGT
GAGGAAACATGGCCAGAGGGTGACCTTGGCTTGCCCACGATCACACAGCAAAGGGATTGG
AAAGCCAAAGCCAAACTCTGGGCTGTAGCTCTTGTCCTGCTTCTCTTAAGGGTCATGTAA
CTCAGGGACCTTACGTGCCTTAGCTCTTGACTGGAAATTGACTGAAAAGTGAGTCTTTTG
GCTTATCCGATCTGTTGGCCTGTAATAATTCCCACCAGATTTTACCACATTTGGCAGTGG
GAAGCATCATGGAAAGGTCTGCAGGTTTCAGCCTATGAGCTGCACAAGCACCCTACACCC
CAACTGGAATGACAGTGCTTTGTTCTTCTGTGAAGGGGTATGAGGGGGAATCCCTTTGTT
AAAGGTGCCACTGCTGACTAGAGTCGGAAAACACTGCATCAGGAATTCCCTCCAGTGCTG
ACGTGGCCTCTGCTGCTGAACAGTGTGTGCTGGCCCTTGTGGGGCTGAGTTGGGATGACT
CTAGACTGTTGGTGAGGGCTGTCTTCATTTCTCTGGGTTGTGAGATCTGCAAGCGTACGC
CACTGCTGTGGAGAGAGGAGGCCACATCTCATACTCGCCTTCCCTCTGCGTAGGTCTCCT
GTGTCTCTCACAGTCATCCTCCCCCAAGCAAGCTCGCACCCGTTGGCCAGGTGTCCACCC
CCAACCTTCCCTGTCAGGTGTGACAGCTATTCACTTTTAGGTTTTTGGTTTTTGGTTTTT
CTTTTTTTTCTTTTTTCTTTTTTTTTCTTTTTTTTGTGAATGAGGGGGGTCCCTTGACCT
TCAGAACCTCATGCAATCCCTCCTCCCCCTCCTCTTTCCTCTCCCCTTTGCCCCCTTTCA
ATTTCCAGATGTGACAAGCTGGAGGGAGGGCGGTGGGCGAAACATAATTTCTGCCACGTC
TCTGAGCGCCTCCCCAACTGAGCTGGGCAGCAGGAACTCGAGTGCGGGAGACGGAGCCCC
CTCCTCGGCATGCACCAGCGATTCTAAGGACCCCTCTCTCCGCCCGGTTCAGCCTGTCCG
AAAAGGGGCTTCACAGTTCATGGGAAATGTATACCACCCACCTACATACCATGACATGCT
TCCTGCTTTTGTAAGTCTTCAGAGTGTACTTTTTTTTTGCCCATGAAGTTGGATTGTTCA
TGTCCAGCAGAACCTAGTTCAAGTGGTTGAAAATCCACCTTGAATTCTCCCTCCTGATTT
CCCGCTTTGCCCTGATACCCCCACTTTTTGAGGTTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTGAATTCTAACACATTAGTAACTTAGCAAAGGC
TCATCAGTATCATTACTCTTCCCCTAAACTCTAATTACCTCTACCATCAATTTTGTGGTT
TTTGCCTAAAATTTCAGTTCTTCCATGTTTCTTTCTTTCTTTTTTTTTTTTTTTTTTTGA
GACAGAGTCTCAAGCTGTCTCCGTAGGTAGAGTGCAGTGGCATCATAGCTCACAGCAACC
TCCAACTCTGGGGCTTAAGCAATTCTCCTGCCTCTGCCTCTCAAGTAGCTGAGACCACAG
GCGCGTGCGACAATGCCTGGCCATTTTTTTTTTTTTTTTGGTTGTAGCCATCATTGTTGT
TTGGCGGGCTTGGGCTGGATTCGAACCCGCCAACTCAGGTGTATGTGGTTGGCACCTTAG
CTGCTAGAGCCACAGGCGCCAAGCCTCTTCCATGTTTTTATGCCCACCAAATAGTGATTA
TTATATTTGATATTTTTCTAATCTGTGCTTATTCAGGTTTGCCTGTATACCAGATTTTTT
ACTTTTTTTTTTTAATCTCTGGGTCCAGTTTATTTCTCTGTGAAGTATATTCTCCATGTC
TTCAGTAGAAGTTTCTGGCAATAGATTATCTTTGTCTACACTATTTTATAGTGTAGCAGG
GTACACAATTCAAGGTTGGCAATAATTTTCTTTCAGTACTGTGAAGGTGGTAATCTCTTT
TTCTTTGAGACAGAATCTCACTATGTCTCTCTTGGTAGAGTGCTGTGTTGTCACACCTCA
TGGCAGCCTCAAACTCTTGAGCTTAAGCGATTCTCTTGCCTCAGCTTCCCTGGTAGCTAG
GACTACAAGGCGCCTGCCACAACACCTGACTGTTTTTTGGTTGTATTTGTCATTGTTGTT
TAGCAGGACTGGGCCAGGTTTGAAACTGCCAACCCTGGTGTACGTGGTTGGTGCCCTAAC
CACTGAGCTACCGGTGCCAAGCCTGGTAATCTCTTTTCTTTTGGCTTTTTTTGTTGTTGG
AGATAGAATCTTACTTTATCCCTCTCGGTAGAGTGCCGTAGTGTCATAGCTCACAGCAAC
CTCAAACTCTTGGGGTCAAGTGATCCTTTTGCCCCAGCCTCCCAAGTAGCTGGGATTACA
GGCATCTGCCACAAAGGCTGGCTATTTTTAGAGATGGGGTTTCACTCTGGCTCAGGCTAC
TCTGGCTCAGGCTGGTCTTGAACTCTGGAGCTTAGGCAATCCACCCACCTCGGCCTCCCA
AAGTGTCAGAATTACAGGAGTGAGCCACTGCTCCTGGCTCTCTTTTGGCTCTTATTGTTG
CCAAAGGTCTGATCATTTCTGGGTACTCCATTTTCTCTCTGCTAATTTTACAGTCTTCTC
CTGTCTTCGGTGTCCTGGGTTCTGCCTCCATGTGGTGTGCCTGGGTGTATGCCTGCATCT
TCACCTCCCTATGTTTAGTATTCACTGTGCTTGAGTCTAGGAATGTAATGTCTTCGCTCG
GCGCCTGTGGCTCAAGTGGCTAAGGCGCAGCCCATTACACCTAAGGTGGTGGGCTTCAAT
CCAGCCCGGCCCGCCAAATAACAATGACGGCTGCAACCGAAAAATAGCCGGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTTGAACTGAGGATGCCC
TGCTGCTGTCTCCAGGGACCATAGGGGGGCCCACCCGCGGCCACTGCGTTCTTCACTCTC
ATTTGACTACAGGGGCCACCACCAGTACATGGCCCAGCCACTCTGAACCGTGTTTAAAGA
TAGAGCAAATGTTGGTGCTTGTGTTTTTTTCTTTCTTTTTTAAAAAATTTTTTTCTTTTT
AAAACTAAGCTCTGTGTTCAGCATGGAAACCAGGAACCAGGCTCCAATCACATTGACTGA
TTTTTCTGGTTCCTTTTCAGGAATGAAAGCTCTTACTCTGCCTCACCGGGAAGGTCCGGG
GGCATAGGTGCCCAGCGCGATCTCTTTGAGGAGAGAGGGGAGGAGTACTTGAGTGCTTTT
GACAAGAAGGCCCCAGCAGACTTTGACAGCTGTATTTCTTCTCAGAGAATAGGCCAGGAG
CTTTTGTTTCTGCCCCAAGAAAGTGTTCAGGAAGCAGGTGCTCCTGGGGGTCATACTCAA
AACCTCAGGTGTTCCCCATTGGAGCCTGACTTTGTCCCAGAGGAGAAAAAGCCAGAGTAT
GGCAGTTGGGACGTTAGTCATCAGCCAAAGGCCACTGACACAGCCCGTGGTATTGAGCAG
GAGGCGCCCCAGGAGGGGCCTTCCTTTAATATCTCCTGGGAAAAGGATGGGAGCCCCAAC
AAGCAGCCGTCTGCAGAGCCTGAGTGGACTCCTGAACCTCGGAGCTCCAGCAGCCAGCAG
CAGGAGCAGACAGGCAGGACTCGAAGGTCAGGCCCCATTAAGAAACCCGTCCTAAAAGCC
CTCAAAGTAGAAGATAAGGAGAAAGAGCTGGAGAAGATGAAGCAGGAGCTCGGGGAGGAC
CGGCTGGCCAAGGAGAAGGAACAGGTTGGAAAGGTGGAGAAGGATGAGGATGAAGAGAAC
GACTCCACCCTGGCCAACTCCTCCCCCTCCACCTTAGAGGACAAGGCTCCCACCCATGCT
ACTTTTGGCCATGAGGCCAATAAGCTTGAAGAGGATGAGAAGCCCGACAAGTCCTGGGAA
AACAGACCCTCACGAGAATCCAGTGATGTTCCCCCGACCAAGAGAAATAACTGGATCTTT
ATTGATGAGGAGCAAGCCTTTGGGGTCAGAGGGCAGGTCCGGGGCCGAGGCCGTGGTTTC
AGAGAGTTCACTTTTCGTGGTCGGCCTGCTGGTGGCAATGGAAGCAGCCTCTGTGGTGGG
GGGGGTCTGGGGACTCGCAGTATCTACAGCAACAGCCAGCGATGTGGCCGGGGCCGGGGC
CTCCGTGAGTTCTCCCAGCCGGAAGACTGCCCCAGAGCCAAGCCCGGCGGAGGATTGGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTGGGT
TTCGGAAGTAAACAACAATCTCTTTCTCTATTAGGACACCAGAGAGAGACTCTGCCTGGA
GGCCTTAAGTGGCGGCAGCAGTGGAGCAAGCCACTCACTCTGCAGGCTTGATCGGGCGAC
CCATGTCAGCACTTGATGTTGTCTGGAAGCCTCCAGTAAGAAAGCAGAGAAAGAGGGCAT
AGTTGGCTGCTCAGAGGGCCAGGAGAGCAGTGAAGAGATCCATGAAACAGTTTGACCTGA
ACTATGGGAAGTGAGTCTGGTCCCCTTTCATCTGTAGAGGGAAGAACCCTAGGCAGGACT
GGGGACCACAGCGGTCTTGGGAGCTGGCATGTTTACTGCTCCTGACAACTACCCTGGGCA
GGTGCTGGGCTAAGTTCTGGGGATGCAGGATTGGACCACACAGATAAGATTTCTGCCCTC
TGGTTGCTCACAGCCTGTTGAATCCCCTTAAGACCCTATGGTGTTTTAAAGAAGAGAAGC
CTAAGGCCCAGAGAGGTTCAGTAGCGTGTCCAAGGTCACATAGCTGGTTGGAGCCAAGCT
GGGATTTAAGTGTGCCCTTCAAGACAGTTTTCTTAACATTCTTCTTTTTTTTTTTTTTTT
TTTTTGACTGGGGCTGGGTTTGAACCCACCACCTCCGGTATATGGGGCCGATGCCCTACT
CTTTTGAGCCACAGGCGCCTGCCCAGTTTTCTTAATTATAGTGGTACTTAGACCTCTTTG
GTTTGAAATAACAGTGTATTAGATCCCTGAAGATGTGAGAGAGGTGCAGAAATCAGGCCA
CACTTGTGCAGACCCAGGTGCTACCTGCCTTCTGAGCTGAGCCTGTTCCCAGATGCCAGG
TGGCTATTGAATTGGGTTATTCTTGCCTTCTGATGAATGCAAACATTGTCCATCCCTTCT
CATGAAATCTTGGTTCAGATGCCATCATTGAAAATTGTGGGTCCAGCCCTGGAGAGGAGA
GTGAGGTGGGCAGTATGGTGGGTGAAGGCTTCATTGAAGTCTTGACCAAGAAGCAGCGCC
GCCTGCTGGAGGAAGAGAGAAGAAAGAAGGAGCAGGCCGTGCAGGTGAGGGGCGGGGTGC
TAGGGTAGAGGGCAGGCTCCCCATGTAGCCCATGTAGCTCCTGCTAGCAGGGGAGTGAAA
AAGGGAGTCTTTACTAGACATGCATCATGCCACAGTACCTGTCCTCACTGGGCCTGGGGA
GTAGATGGGGGATACCACTATTTCTACAGAGGAAAAATCAATCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTAATTTTAGATCCAGTGCTGTTTTTCTGATAACTTTTCCTTTTAAAAT
ACAAAGCCAGCTCAGCACCCATAGCACAGTAGTTACAGCACCAGCCACATACACCAGGGA
TGGCGGGTTCAAACCCAGCTCAGGCCAGCTAAACAACATTGACAGCTACAACAAAAAATA
GCCAGGCATTGTGGCAGGTGCCTGTAGTCCCAGCTACTGGGAGGCTGAGGTAAGAAAATC
ACTTAAGCCCAGGAGTTTGAGGTTGCTGTGAGCTGTGATGCCATGGCACTCTACTAAATG
CAACATAGTGAGACACTGTCTCCAAAAAAAATTAAAAATAAAAATAAAATAAAAACCATT
TTAATTGAACAGGTTCTTTTTAAATGCCTTCTTTGCGCAGGGCCCTGTGCTGTGAACCCT
GAGGGTGCATAGACAAATTAAAGGCATTTACAGTTTGTGGTAGAACTTGGAGAGATCAAC
TGTTCCTTGCTGCTTTTTATACAAAGCAGCCTAGGCTTCCAGAGTAAAGTGACTTAATCC
CAGGGCCACATGACAAGCACCCAGGACTCTGGGTTCTGGGACTTGACTTTTTTCAGTGTT
CCCACATAGTGTATACTCATGTTCCTGGTGAAAACCGTGGTTCTAATACATTGCAAAATA
ACATTAGACAGTAGTCAACTCTGATTGCAAGGAAGTACAATGATCTTTAGATGAAACATA
GATGATGGCAAGTTTGGTAGAGTGCATGAGTGATGGGTATCATACACACACAATATAAAT
TGTCCAGAAATGCCCACCCACCAGGCTGGTTGAGCAGTATGTACAAAACTAAAGAGTCGG
CCCCTTCTGTCAGCTCTGTTCCTCCAGGACTTTGCAGTGTCTCATTGGTTGTTCAAACCA
GGGATGCATGGGTGCCTTCAGGGGGCCCCTGGGTCTCAAAATAACATGCACATTTTTGTG
TGAATATACATTTTTCTGGGCTTAGGGTCCATGGCTCTTGTCAGATTCTCATGGGGTCGT
GAGCTAACAAAATTTGAGTAATACCTACTTGGATCTTTTAAAGACTTAGAGAACTGCAAC
TTCTAAAAATACATAGTTTAATTGAAAGAAAGGAGTAACATAGCAGAAGGAATGATGGAT
AATTCAAATCAAAGTGAATAAAAGGTGCTGTTGTGTGTGCTGCTGCACATGATCTGTAAA
CTTCTGAGACATGTTTAATGAAGTCTATTGGGCGTTGGAAAGTTGGGTAAAGCTCTCAGA
TTGGCTCCTGTGTATCATCTGCTAATGAATGGGTCCTACACAGGCTAGGGTAGACAGTAA
GGGGAATCAGATTTTTATAAGCTTTACCTATACTTGTTGTCTAAAACTAAAACTCATCTG
TTACTGTCTGGTGAGTCCTCTTTGGTGCCCTGACTCTCTGTCTTCCTCCCCTAGCAGCTC
TCCCTGTGCAGGCCTCAGCCAGTGACTCCTGGAGGAAAGCAGTCACAGCCTTCAGCAGCG
CTGAGCCTAGCTCCGCAGAGGTGTGCGCTCACTGTCACCGTGGTTAGCTTGTCATGGACC
CCCTTTGTCCCACCCTGCCCAAGGCTGTTCCCACAGACCCTGGCTCCTCACTGGTTTTCA
GTTTGATTCCTGGTCTGTCCGGGATTGTGGGAGAAAGAGAAGGGATATCAAGAGGAAGCC
TTCCCCCCACCCTCCCAGCTAGGGAGAGGGAATGAGGGCCTCCTTTGAACCCTTCTTGGT
GGTCACTCAGTCTGGTTTGGGTCACAAGTGAAATCAGCTAGACGGTCTTGGTCTAGGACC
ATGGAGGAACTCACTCTGAGCATGAGCAGGCTGATGCTTTTGGCTGTGGGTGAGTTTTCA
GGCACCACCAACAGGTTAGGGTCAAGATTAGGACAAATTTCATGGGGGTTAGGTGGTTTG
GGGAGCCGTGTCTCAGGGCTCTAACCCACTTTGTGCTCTGCACATCAGGGTTTTAAGAGC
AGCCAGGGGGATAGTGGTGTAGACTTGAGTGCCGAGTCCCGTGAGTCGTCCGCCACCTCC
TCACAGCGCAGCTCCCCATATGGTACTCTGAAGCCAGAAGAGATGAATGGGCCTAGCCTG
GCGGAACCCAAGATCGACAGCCACAAAGAGCAGGCTCAGAAGCAGTCTGAGCAAAAGGTA
AAAGGAAGTCCCCCTGGGTGTCTTCTCTTCTCTTCCCCGGGCACATGGAGGCCAGAGGCT
GTGGTCATTCCAATGAGCATGTTTCTACCTCTCTGCTTTTCCATTAAGGATTCAGAACAA
AGCTCAGGACAGAGCAAGGAGCACAGACCAGGACCTATCGGCAATGAGCGTTCTCTGAAA
AACAGGAAGGGCTCGGAGGGGGCTGAGCGGCTGCAGGGGACTGTTGTTCCACCTGTTAAT
GGGGTAGAGATTCACGTGGACTCTGTGCTGCCTGTGCCACCCATTGAATTTGGAGTCAAC
CCTAAAGTGAGGCTTTGATTTGCCCCCCCCCCCTTTATTTTTCCTCTTTGGTCCATGGAG
AAGTGGGGTTTGGATAGGGTTTCTCGTAGAAAGAATAGGACAATGGAAGCTAAGCCAGAT
CCAAGGGCAAGAGTGTTGACCAGGAGTCATGGACAGGCAGATGGGATTGGCTGGCCTTGT
CAATACTAGCTTGGCTCTCAGCTGACCCAGACAGTGATCTTTCCTGTCCTCGCTGCCGGT
CCAGGGGTCAGGGGTCAGTGGGAGGGAGAAAGGAGTAAGGGTGGCTCCCTTACTCATATG
CTGCCCGGAAACATTTAGCCATCTTGCTCCCATGTGGCCCCAGTGAATGGTGTTTAGTGG
AGTTTGAGTTGTACCTCAGGGGAAAGGTGAGCCAGAGGATTCTAGGAGCTGTCGGCCCCT
TTTTTTAGGACTCTGACTTCAGCTTGCGCCGGTCTGCTCTGGTCTGCAGGAATCCAGTTG
TCAACTTCAGGACGCCTGGCCAGTAATGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCAATGTAAGTCCACACTTCACCTTGGCTGGTGGG
CCCTGGACAAGAAGAGAGACAAGATGTCCTGAGTTTAACTTGTGACTCAGTCACTACCCA
GCTATGTGTCTATAGGCAGGTTGCTTAAATATTCCATGCCCAGATTTGTGACCATTGGTG
GGTTACTGTATTTCCTAAGGTCTGGTTTATTTCTTTGTGGCAGGTGCAAGCTGAGAATGG
CACACACTGCACAGTTGGGGAGGCCCTACCTTTACTGCTAGAGGGTCCCTGCACCCTGTA
GTCTGGCTCTGTTAGAGTCCAGTAGCCCTCCTATCCCTCTCCTGTGGACTTGAGCTAGGA
GATGCATCAGTCATGGGTTACTTGGGGGGTTATTTTTGCTCATTGCTCTGTCCTGTCTGT
TGGTAGCATAGGGGCTCTGGCTATGCTAGGTGAGTAAGGCTTGCTGGGCAGCTCCACCCA
GGGATTTCAAGCAGTATGAGTGCTGCAGAATGTTTTTAGGTATCAAAAAAGAAAACAAGT
CCTGTGGTCACATATGTTTGAAAATGCTGGGCTGAACAAATTTCTTTACCCTGAGATTTC
TCAGAACAGCTGTCATATGCCATGGTGCCCGAGATCTGCAGGCAGAGGGTCTATCTGGTG
CTGCATTTCCCACCTGTTAACCAGGGACCTCTTTCTCAGTGTGCCAAGGTAGCCACAGGG
CAGGTGCCTGCTGAGCCAGCAGCCAGTTTTATGTTGCTGGCACGTGATTGTCCCTGTGTG
GAGGGCCTGGGGAAGTGTGGGTGTAGAGATGACTATCCATGGGCTGCTTCTGAGGAAATT
GAGGAAGGCAGCTTTCTGGAGGAGCCAGACAATGATCTTGGCTGCTGTAAAGATCATCTT
GGTGGTCTTGTACCTATGGCCCAAACTGGACAAGTCATAGGTGAATTTGAAGAGTGTGTC
ACTGTTTGGGTTTTTTTTTTTTTTTTTTTTGGAGACAGAGTTTCATTTGTCACCCTTGGT
AGAGTGCTGTGGCGTCTTAGCTTACAGCAACCTCAAACTCTTGGGCCCAAGCTTTTCTCT
TGCTTTAGCGTCCTAAATAGCTGGGACTACAGGTGCCCGCCACAACACTTGGCTGTTTTT
TTAGAGACGGGGTTTTGCTCTTGCTCAGGGCACCTGTGAGCTCAGGCGATCCACCTGCCT
CAGCCTTCCAGAGTGGTAGGATTATAGGTGTGAGTCACCATGCCCGGCCTGAGCATGTCA
CTTTCGCTATTGCTTTGTGCTCCATGGTGTCCTTTCCCCCCTCTCCAGGCGGGGCTAACA
CAGAGTATTCCCATCCTCCGGCGGGATCATCACATCCAGAGGGCCATTGGCCTCTCCCCA
ATGTCCTTCCCTACTGCTGACCTCACTCTGAAGGTAACACCAGCCTTGGGCTTGGCAGGG
GCCTGCATGGGGCTTTGTCTTGTGAGAGCAGGAGGGAGGAGCTAGCCTCTCCACTACTGT
CCCTCCTGGTGATCTGTATCCCTCCCCTCCCTTGCTTCTGCAGATGGAGTCTGCACGCAA
AGCCTGGGAAAACTCCCCCAGTTTGCCAGAGCAGAGCTCTCCAGGAGGGGCTGGCTCAGG
CATCCAGCCCTCGTCCTCCGTGGGCGCCTCCAACGGGGTCAACTACAGTTCCTTTGGTGG
AGTTTCTATGCCACCCATGCCTGTGGCCTCTGTAGCACCTTCTGCTTCCATGCCAGGTAT
CTCACCCCCAAGCCAGGCTTCAGAAGCCTTCTCCAGTTACTGTCAAGAAAAGCTCTGAAC
ACCTTCTCGGGGCTTGAGGAATGTGTAGAAATTGGGATTTGTTTGTAGGCTGGATGGTTC
ATAGCTTCCCAGGTGCTGCAGGTGAGGTACACGTCCTGCTTCCCTTTACTGGAAACAGAA
CCAAGTCTTGATGGCCAGGCTTTCCCATCTCCAGGGAGAGGATCGAGCAGCCTTGGCTTT
GAGTCACACCTGGGTCACATGCCAATTCTGTGTCACCTCTGCTAGAGAGCAGCTGGCCTC
TCAGAGCCTCTGCTTCTTCCCATCAGCTAAGCATACTCCATGGGGCTTGTATCAGCTGAA
CCCCACATCAGAGGTAGCTGTTTTTGTCCTTATTGTCACTGCTCTATATTGGTGCCCCAA
GAGAGCATACAGATTATGAGGGTGCAGCTGCCAACGTCTCAGTGATGTGGTTCCAATAGA
TCCTTCTGACCCTGCACTGTGGACTCAATAGCAGGGAGATGACGAGGACAGTGACTGAGA
GACCAAGGCAGCCTCAGTTACAGCAGAGTAGCCCTCCCGAGTGTCTGGGACAGTTGGTGG
TTAGTTAGGTGGGGAAGGTAAATAGGAGCCCACTTCCCTCCTAGAGGGCCGCCTCATAGC
CTGCCCAGTTCCCCGAGATGTGTCCCAGGTATGCTGTGAGCAGGTATGTGCTGCAGAAGC
ATGAGGGACCAAGCAGCCCTGCACACACTCGCCCCCCCCCAGAGGGACATGCCGAAATAG
CAACACTTCATCCCTTCCTGCCTCCCTCATTCTGTCTCTAGGCAGCCACCTCCCGCCTCT
GTACCTGGACGGCCATGTGTTTGCAAGTCAGCCCCGGCTTGTTCCTCAAACGATACCTCA
GCAGCAGAGTTACCAACAGGTGACAGTAGTGAGCCCGGCGGCCTGGGTTGGGGAGAGGAG
ATGTGGCAGGGGGCATAACTACTCTCTTCATTTGTTCATTTTCTGTCTGGTTTTCTGTGC
CCCTCTTGTGTGGTGCCCAGCCACTGGCATATCATGGCAGCCAGAAAGTATTTGTTGAAT
GAATCAACGAGAGACAAGGAAGAAGAAAGGAGTTCCATGTTCCAGACTCTGCCTAATTAT
CCTTTCTCAAAGTTCTCCTTCCTGTGTCCTAGCTGGGGGATTAGCTAAAATGGAATTTTC
TTTGGTGATCAGGTATCCTTCTGATGAAGAGAAGAAAGGCCTAGACACCCAGGCATGGAT
GCATTAGAAAGAGGTAGTTTTAGAAACGAACAGGTGTTTGTTGTCACGCAGGATGGGCAG
ACTTTCTGTGCTGCAGGGGAATGATTCAAATCTCCCTCCTACAGCTGGTGCCGGTTCTTT
CCAAGGGCCTGGCCACCCCTGAGACCCATGTACCTGCATATGCCACGACAGTGGGCCTCA
CAGGCAGAATCTATTCCAAGTGCAGATTTGAGGGCAGAGGATATGGCCTGTCCTGATGTC
TTTTAATGTATTCTTAACCATTAGATCATATTAGTTTTGCTAGATTTTAGAGTGCTCGTG
TGACTGGATCACATTGCATATAACCTTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCCGCTTGAGCCACAGGCGCTGAGCTTTATATATATTTTATAATTTAAC
ATCACATTTTTAAATTCAGCTCTATTCCTTGTAGCTAGGATTCATTCTTGCTACTCTACT
GAACCCCAGTGTAGGAATGATCATACCATGGTTTGGGGTTGCTACCAATTTCTCAGTATA
GGCTTTATTCTAAGAGGAAGGGAAGGGGTAAGGCGTTTTCCCCGAAGGACATGATGGACG
CACATTCGGAGCCTTTTTCTACCTACTGTGTGGAGGTGGCTAGGGAGGTGGGGACCATCA
TAGAGGGCCTTGCAGTCACCGCTGGCCTCCCTTTCCCAGGCTGCTGCTGCCCAGCAAATC
CCGATCTCCCTTCACACGTCTCTGCAGGCTCAAGCTCAGCTTGGACTGAGGGGGGGACTG
CCCGTCTCCCAGTCTCAGGAGATCTTCAGCTCTTTGCAGCCCTTCAGGTGAGTTCGTGAG
CCCCAGCCCTGGCCACCCCCTCTGCCCCTTCCCTGTGCAGCTGTCCACTCCATAGTCCAT
TCTTCATGGTGCGCTGGGAGAGGCTGTGGTGGGCCTTGTTACTTCCTTTTTTCCGTATCA
TTCTGCCTCCTTCCCTTGCCCCTCCCTCCTCTGCCCTCTCTTCCCACGTTCGCCTGTTCT
TCCCATATCTGATGTCCTGTGCTGTGGACATTATGGTGGCCATGTGGTGCCTGGCACAGT
GTAGATGTACTGTTTGTTGAATCCAGTGATGCGCAAGTAGTACCTGGGCCAGCACCATCA
GCTGGACCTGGGAGCTGTTACAGATGCCGAGTCCTGGGCCATCTCAGGCCCTCTGGGCAA
AGCTTGGGGTGGGGCCAGGGTCTGTGTTTGGGGGGGGGGGGATTCAGATGATTGTTGCAC
TTGTGACCCCTGCCCCCGCCCCCCGTGTCCTTATAACCCTGTGTCACTCTTGCAGGTCTC
AGGTGTACATGCACCCCAGCCTGTCTCCACCCAGCACTATGATCCTCTCTGGGGGCACAG
CCCTGAAGCCTCCATACTCGGCATTCCCAGGGATGCAGCCCTTGGAGATGGTGAAGCCCC
AGTCTGGCTCACCCTACCAGACCATGAGTGGAAACCAAGCCCTGGTCTACGAGGGCCAGC
TTGGCCAGGCTGCAAGTCTGGGTGCCTCCCAGATGTTGGACTCTCAGCTCCCACAGGTCA
GGACTTCAGTCACTGCCCAGCATGAGTTTCCTGTCATGATTTTGTCTTTTCCCTTTGCCC
CTTCTTGGTCTGTGACTCATGCTATTTGGGACCACCGTGCCAGCAGCTCAAGCTCAGCTT
GGGACTAAATCCTTGAGCTGTTAGGACTCAGCCTTTTTCTGTATGGGCCCCATCACCCAG
TTCTCCCTGAGCACAGCTGCTCCTGCAGCCCCTCCAAACAGAGGCTGCCCCCTCTCCTCG
CCATCCAAGTACTGTGGGTGGTGGAAATGGGGTCGGTGTCTTTTTCTCTCGTCGCTAGAT
CTCAGTAGCATATCCCGAGTGTGAGACGTCTCAGATGTGCACATCAGTGTCTGCTTCTCA
GCTTCTCTCAGGCTCTGTGCGACATCTGAGATGTCTCTCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGACCATGCCACTGCCTCGATATGGCTCTGGACAACAGCCGCTA
ATCCTGCCCCAATCTATCCAGCTGCCACCAGGGCAGAGCCTCTCTGTTGGGGCCCCCAGA
AGGATTCCTCCACCCGGGTCCCAGCCGCCAGTCCTGAACACCAGCAGAGAGGTAATGGCA
CCCCATCCGCTAGGGATTCTGGGCGTAGCCTTGTCTCATGAACCTCTTCTAGTGAGCTAA
GACCCCTGTGGGGGGAGGTGACAGTGGCTTGGGATGTAGGCTCTGGCCTCACCAGAATGC
TGCTTTTCTCAAATACAAAGTCTCGGAACCCCGAGATCAGGAACTCTTTGGTCCATGTGT
CAGGTAGTAATGTGCACAAGTGTGGGTGTGTATAGGGCTAAGCCAAGAGGAGGGTGCACA
TGTGAGGCCTCAAGGTAAGACATCACAGATGTCCATCCTGGATGTGTATAATTAGTTCTC
TCTCCTAACTTTAAAAAGGAAAAAATACTGTGGTGGTGGTTCCTCCTAAGAAAAAGCCCT
GTCTATAATCCTAGCACTCTGGGAGACCAAGGCAGGTGGATTACCTGAGTCAGAGTGAGA
TCCTGCCTCTAAAAATAGCCTGGTGTTGTGGTGGGCACCTATAGTCCGGGTACTTGGAAG
GCTGAGAATCACTTAAAGCTAAGAGTTTGAGGTTGCTGTGAGCTAAGATACCATAGCACT
CTATTAAGAGTGACAAAATAAGACTCTGTCTCAAAAAAAAAGCCCTTTTTTGAGTCTGGG
TTGGAAAGGAAATGGTTGCACCTTCTTTTGGAAGATACCTCCCTGGAGCGTCTCATGGGC
CTGTGTCCTCCCGGCCTATTGTGGTTAGTGAAGGCCAGGCTGCCTCCAGGCTTGTCCCAT
GACAACTTGTTACTACTACTCCGTCTCTCTCCTTAGCCCTCTCAGATGGAGATGAAAGGC
TTCCACTTTGCTGACAGTAAACAGAATGTTCCTGCAGGAGGGCCCGTGACGTCACCACAG
ACCTACAGGTAAAGACATTCCCTGGGGTTGAATGCCAGATAGCTGGGCATTCACTGGAGA
TGTGGCTCAGAAGATCCCGTGGGCCCAGGGAGAGTGGTTCGCATGATACCAAGATCTCAT
CCCCTTGTAGGCTGATGTGTCACCATGCTGTTTCACTGTTGGCACACATTTGTGTCAGTT
AACGACAGGAAAACAGTGAATCAGGAGAGTGGTTTTGCTGTTAATTATCATTAATAAGAT
TGCAGAACTTTCAGGAAAAGTAGGAAAAGGAATAGCTAATGTTTTAATGGACACCAGTTG
TGCTCCTGACTACTCAACTTTGTCACCAGATTTTTAAGATCAGGACCCATTAGCTGAGAA
GGCGACGCCTTGGCAAGGGGAGGAGTCTGGCCATTACCAGGGTCTCTTTCACCTTAGTTC
ACCCTCTGAACCCTGTCAGGGACTTTTTATTGCTAGACTTGTGGGACCATTCCTGCCACA
GTATAAATTGGCACCTTTTTGCCTCCTTTGTATCTGTCTCAGCTTCCCGTAACTGCCTCA
GGTCCCTTTAGCTGGGTTCAGAGGCGGCTCTGTTGGGTTTAGTGGAAAACCTCTGGCTCT
GGCCTTTTCACCTTTGCCGGGTTGTGAGGGCAGCCTGCTCCCGTTCCAGCTCTAGCCCCC
AGGGGTTTGTTCACTCAACTTTTGTTATGTGTGGGAGACTCCTAGAGATCTCCTTATGTT
TGCAAATGAGTGGGACAGACCCATGTGACCCACAGTGCCCTTGCTCCAGGCACCTTGAGA
TCACTCCATGAGCACTCCACAAGCCAGGTGCCCTTGTCCCAGCTTGTTCTTGCTGTAGTC
ACTCACTGTACCTCATTCGTCTGCCTGCCTGTCTGTCTGCCTCCACCATGGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGGGGGGGGCGAATCCAGGAGTCTGTTACGCTGTGCATGCAGCACTGATG
CAGACATCTAATTAATATCCCTGGGAACTTGCTAGTGGTCAGCGGGACACGTTTAGAATT
ACATTACACGTTTTTATTCCTCTGCCCCCCTTTCTAAAAGTAGAGACAACACAAATACTC
GGCAGCAGTCTTGCTTAGTGTTAGGCTTGTCGACCTTTTTGTCTGGGCCTGCCATTTTGG
TCCAGGCACTTGAAGCCCTGAGAGGGTCAATGTCCATCTCCCCACAGGACAACAGCAGTG
TCTGCCTATGGTGGGGGCCTCAGCCCCTGCTCTGTTTGTGGAGCTCTGCCTGGGACGTGC
CAGGGTAGACAGTGACCCCCAGCCCCTATCCCCTTCTGCATTCTTGACTGTCTTAGGTCT
CTGATTTTTTCTGTCCTGTATGTCTGTGGACTGCCCAGATGAGGTCTCTGGCCCAAGAGC
CCTTCCTTCCTCCTGCTGCCTCCCTGTGCTAGGCTTTGACTCCTTGTCTGTGGTGACACG
TTGTGTTTCTCAACCCCTGCCTTTGGTTTTTTCAGGCCTAGCTCTGCTAGCCCCAGTGGG
AAGCCCTCTGGATCAGCAGTTAACATGGGCTCTGTGCAGGGACACTACGTTCAACAGGTA
GAAGATGGCTTTCCAGACCCTTCAGCCCTGGACACTTAGGCCTCTCTCCAAGTGCCTAAA
GAGGAGGGACTGTGTACCCTATTTGGGCACTCTCTGTATACACAGATATGCCCTAGCAAT
CTGAGTAGGGAGCTGGGCAGCCCGAGTCCCTCCTGCAAAGGCATTTCTCCTCTTGATGGG
CATCTGGATCCTTCCTTGTCCTGCAGAGAAGGGAGGATGCTGGTTCCTCTAAGGAGGTGA
TGCCAGGTGTACCATCCTGAGCAATTTGGGGCTGTGAAGGTGGTCTGGGTGACTTGGTTA
GGCCTGCGGGTTAGCTTCAGAGGCTGGAGGCTCCAGCACCCTGTGTCTAGTCTTTGTCCT
GGCTGGGTGGGATCCCAGGTGAAGTTCAGTGTTTCTATTTTATAATAAATAGGATTTCTC
ATTGTTTTCCTGCAGGCATTCTGGTCTTCACTATGGCTCTAAGGCTGGGCTTTTAATCCA
GTCAACATGACTGGCTGGTGGAGGGGGGAGGCTAGCTACTCTTTTCTTTCTCCACGCTTG
GTTCCCCCTGGGGGTCACTAGCTGGATCTTACAGAGTGAGCTTCTAAAGCTTTCTTCCAG
AGTGCAGACCACTGTGCAAGGGCAGGCATGCTGGTCGCTCTGTGAAATTTAACTGTGGAG
GGCAATTGGGAATGTCACAGTCAAGCTAGGGCCCCAGGGAAAGCCTCCGCAGTGAGAAGC
AGAAGGCGGCGGGGGGTGGGGGGTGGGGGTGGGTGGGGTGGTAAATGGATCATGGCCAGG
GATCTGGTAGAAGCACCTGTGCACAGAGACCCCACCCCACCTCAGCACCACTGGGATTGC
CACCAAGGGGCTTTTTCCTGTAGGGCATGGGGTGCACTGATTTGAAAAGGTTCTCATCAG
TCTTGGGACCAGAAATGGGTCCACCTGAGGTGTGCCATTGCTGAATTCTTTGCAGAGGAC
CCGGTATCTTCTGCCTGTCCAAATCACTGCCCTTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1307, 2563..2759, 6102..6297, 12240..12456, 12646..13996, 13998..14014, 14016..14031, 14034..14069, 14072..14730, 16672..16877, 16978..17123, 18359..18484, 18487..18496, 61737..61819, 62265..62456, 62568..62765, 63188..63214, 63217..63225, 63227..63241, 63244..63255, 63258..63266, 64668..64772, 64903..65095, 65921..66018, 67119..67246, 67735..67975, 69915..70070, 70836..70927, 73775..73856
1001..1307, 2563..2759, 6102..6297, 12240..12456, 12646..13996, 13998..14014, 14016..14031, 14034..14069, 14072..14730, 16672..16877, 16978..17123, 18359..18484, 18487..18496, 61737..61819, 62265..62456, 62568..62765, 63188..63214, 63217..63225, 63227..63241, 63244..63255, 63258..63266, 64668..64772, 64903..65095, 65921..66018, 67119..67246, 67735..67975, 69915..70070, 70836..70927, 73775..73856
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved