Otolemur_garnettii Locus ENSOGAG00000000597
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000000597
Otolemur_garnettii
ENSOGAG00000000597
GeneScaffold_2970
SNORA65
4478..4604
6447
TCTCTGCCTGTGTGTGCAGGCTGTCTGGGAATTGGCCAGGCCTGCAGAGCCAGCTCAGG
GCCCTCTTGTCACCCCACCTACTTGCAAGGATGGAGAATAGTTTGCAAATAGCAGTCTGC
CATCCCTCCCCAAGCACTTACTCTCTTCTCCCCAATGACCACCCCTTCCCCACCCCTCCC
CATCACCCTCCAATGACCACCACTTCTCATCCCTCCTAAAAGATCAGCTCAATCCAATCT
GCCCCAAATGTCTATCACTTCTCCCTTCCCTCCCCGACGTCCAGCCAAGATGGGGAGAAC
CACACCCATCTTTCCCTGAATGGGGTGGGCAGTGGCCAACCTGACTTTATGGGTGGCCCC
CACGTTCGTACCCTCGGGTGGACTCAGAGGGCTTGGTCATGGACTTGCGGTCGCAGATCA
CCCAGCACGGCCCAGGCAGAGCTGGAGTCTGGTTTTCTGCAAACGCAGGAGCTGGGGACC
ACAGAAACTCAGAATCTCAGAAAGTCATGCAGACCAGGATGACGAAGTCTGAGACTCTGG
GAACCAAGGAATCTCAAAATTAAGAGTTAGTCTGGATTTAGACCGGAATGATTGTTTTGA
TAACTAAAATTCACACACCACGAAAGGTCTAGAGGGGGCTCAGGGTCGCCAGCGCACTCC
CCTGGGGTGTGGACTCCTCAGGGGAAAGGCGGGGCTCTTGAGACTGGGCGTCAGGGACCC
CAGGGTGACCCTCACGATAAGGGAGCAGGGGAAGAGCAGGGCCCGGGATGTCGGGAGAAT
ACTCTTCTTCCCTGACTCCGCTGGGGTGAACTCCCCGAACCCCATCTCCGAATTCCTAGC
TACAGCTCACCGTGGTGCCTGGCTCTCCAGCTATCAGCTTCTGGCGTCTGCCCACAAGAA
ACATGGCGGCCAGGGCGTCTCTGCGAGGCTGGGCGGAGCCGACAGTTCTCGCGAGAGCGG
CTCTTTCCGGCCTATATCCGACGTGATTTGTACACCTTCCGGTCTTTTGGCTTTCGGGTC
GGAGGGGGCTAAGGTGCAACTTTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAG
CCGCCTCCACCATGCCGCCTAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGCTCTA
GCTGCGTCCGGGGCTGCGGGACAGAGCCACCCTTCTCCCCGCGGCGCCCGCCATGCGTGC
AAAGGTTTCCCATGTGGGCTCTGCAGCCGCCGCCTCGTAGAGGCCTTTCCTCGTGCTGTG
CGGTCTTGGCCGAGTCTCTAAGCCTTTTTGGGCCTCATTTTCCCCGCCTGTAAATGGGGA
GGGAGGACCGGACGACCGGAGCGGCCCGGCAGTCCGCACGCCCTAGGGTAAGGCTCGGCT
CCGGGCGTTCCTGCCTCCGTGATTGGGTTCGCCGGCTGTCGGTGCTGTTTCCACTCAGGC
CGGGTTTGCGGCTCCGAGCTGCCCCCCGCCGGAGGGAGAGGGGCAGGGGGTCGGTGACGA
GGTCTGAAAAACAGGAAGAGAGGGTTGTGCTGGAGCGCTCCCTCTGTAAAAGCACTAATC
CCTTCTTTCCTCTCAGTATACCTGAGGTGCACCGCCGCGAAGTCGGTGCCACGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTATTATTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTATCCCCTTGGGTAGAGTGCCA
CGGCATCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGAGAGTCTCCTGCCTTAGC
CTCCCAAGTAGCTGGGACCACAGGCATCCGCCACAATGCCCGGCTATTTTTTGGTTGCAG
CCGTCATTTTTGTTTTTGGCGAGCCCAGGCTGGATTCAAACCCGCCACCTTAGGTGTATG
TGGCTGGCGCCTTAGCCACTTGAGCCACAGGTGCCGAGCCCACATGGGTTCTTAAAAGGG
GGCAAGTGAGGGACTTTGCCTCGGCCCCCTGAGCCAGCAGCTACAGACCTGAAGAAGACT
TAAACCCCTTAATCCTCACATTCTTTTAATTTGGGTGAGAGGGAGACAAAGTCTCACTAT
GTTGCCTCATCCTCCCAAGTAGCTGGGACGGACTACAAGCGCCCGTCACAGCCCCTGGCT
AGTTTTTGTTGTTTGGTAGGCCAGGGCCGGGTTCGAACCTGCCAGCCCCAGTGTATGTGG
TTGGCATCCTAGCCACTAAGCTATAGGCACCTAGCCAAGCCTCACAGTCTTAACTTATGC
TATCGTGACAGCTGTGCTTTGATTTGATCAGGAGGGTACCCTTAGCTGCTTCAAATAGTT
TTCTGTGTACTGGATAAGAAAGGGCTGGGGTGTTTCCAAGTTGGAAATATTGGACTCAAT
GAAGTTATACCTTTATTTCTACAGTCTCCAAAAAAGGTTGGTGATGACATCGCCAAAGCA
ACTGGTGACTGGAAGGGTCTGAGGATTACAGTGAAACTGACTATCCAGAACAGACAGGCC
CAGGTATTTACTTCCACTTGATTTGAGGGAGGGCAAAGAGGTAATAAGCCCCTGAGATTT
CCTGGATAGAAAGCTTTTAACAGCAGTGGGAAGCTGAGAATAGTTCTTTAAACTGGGAAG
GTTTAAGAGTGTGGACTCTAAAGGCAAAAACATGGATTCAGGTATTACCTACGGTCACCT
GTGTGACATTGGGCCAAGCAGGTAATTTAATGTCTCCCAGGCAAGGAACATATTTTTTTA
GATTGTGAAAATGATGAGCATGTATTAGCCCAGTGTCTGACCCACTGTCTCAGAGGACTG
ATGTGCATGGCAGTACTGTTTGGTGGAGATGGGATAGCTCATTCACATCAAGAGTCTCTT
CTGCAGATTGAAGTGGTACCTTCTGCCTCAGCCCTCATCATCAAAGCCCTCAAGGAACCA
CCAAGAGACAGAAAGAAACAGAAAAACAGTGAGTTGTCTTTTCCTGGGATTGTAGTATTG
GACTCTGATTTATGTTCTGTTCCCAGTGATTGTTGCAGCTGTATTTTCCCTTTATGAAAT
ACGGGGTCTGCATGGAGATTGGGTGGGCATTTGGTTAAGGCTGTTAGAGCTTGGTGCTAC
CAAACAGTGCTATGTGGCTTTCTCTAACCTGAGGTGTCTGACTCTCAGGCCGTAGAGGGA
TGTCAGTAACAGAGAACTGAGTATGCCCTTACGCAAGACACAGACTGCTGGCAGATGCTC
CGGACAGCTTAGCTTTACCTGTAGCTTTTGTTATAATTTTTTGTGTGGAGACAGTCTCAC
TATATCACCCTTGGTAGAGTGCTGTGGTGTTATAGCTCACAGCAACCTCAAACTCATGGC
CTTTAAGCAGTTCTCTTGTCTTGGCCTCCCAAGTAGCTGGGACTATAGGCGCCTGCCACA
ACGCTCAGCTATTTTTTTTGTTGTTATTACAGTTGTTTTAGCTGGCCTGGGCCAGGTTCG
AACCCACCACCCTCAGTATATGTGGCTGGCGCCATAACCACTGAGCTTCCGTTCTCATTG
TTTAGCTGACCTGGGCTGGGTTCGAACCTGCCAGGTTGGGTGTATGTGGCCAGCACCCTA
CCCACTAAGCTATGGGCGCCGTTAGCTTGTTTCTTATTTCTAAAACATGAGGTCCCTTGC
CACTTCATATTGGTAAAGACTCAGTTGGTCTATAGCCACCCGCCACTGCACCTACCAGTT
TTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATAATAAACCCCAGCTTAGGAAACAGGGT
TGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTAGAAGGGTAAAGGA
CATAGGATCTGCTTTGACTTGAGTGTTTGTGACAAAGCTTTTCTGTTTCTTTTTTAGTTA
AACACAATGGAAATATCACTTTTGATGAGATTGTCAACATTGCCAGACAGATGCGGCACC
GATCTTTAGCCAGAGAACTCTCTGGTATGGATGACATACAACTACTTTTACTGTATTTGG
AGGCATTTTCATGGCTTAGCATTCTTTCTACTTGAGGACCCAATAAGACCCAAGGCTAGG
ATAAGGCCTTCTCTAGTTTTTTTTTGAGACATTGTCTCAGGCTATTGCCTGGGTAGAGAG
CCATAGTGTCGTAGCTCACAGCAACCTTGAACCACTGCACCTGGCTAAGCCTTCTCTAGT
AATGAAGGAAGGAGGAATGACTTGAGATCTTGAGCTGGAGGTGTGTCTCAGTATCAGGAG
GACTCATGGAAACTGTGCATTTAGGGGTTTTGTGGGTAGATGGAGCTCTAAACTTAGTAT
TAAAGGGCCAGAGATGGCATCCTTTCCCAGCCTGCTATGAATAGCTCCCCACTACGTGTA
TTGAGGATTGTGAGGCCTGAGAGGCAGCACATAAATCCACTTTGCTTTACTACAGGAACC
ATTAAAGAGATCCTGGGGACAGCCCAGTCTGTGGGCTGCAATGTTGATGGCCGCCACCCT
CATGACATCATAGATGACATCAATAGTGGTGCTGTGGAATGCCCAGCTGTAAGTGATTTG
CACCAGTTACATTGGGATGTAATAGGGTTTAGAGCTGGGCAGAGGGTAGGTACCTCAAGG
TATTCAAGGTTGAAAGATACAGAAATGGGTGGCCGGACTGGGAGATGATCTTTTTAAATT
CCCCTTTTACTAATACAGCTTTTTTTCTTTCCCACAGAGTTAAAAAGTACGAAGGAAAAT
GTTTCAATAAAGGATTATTTGACACCCAGTCAGCTTTTTAATGTGGTTCTTCCTTGAGGA
AGCTGGCTCCTTTGTGGGGTGGTAAATTGGGCCAAGGTGGCAGAACCTGTGGGGAAGCAA
TGATGTGGGCAACAAGCAAAATTGCCTTAAATTGCCTGTATGGGGAAGCTTGGACAAGAG
ACCTGGGAAGAGTGTACTTTTTGTAGGCACTAAGCAGTAAAGGTAACAGAAGCCTGATCA
ATCGTTTACTCATGTTAAAAGTGAGGTTTGGGTTACTGGTGCAGTAACTATAGTTTACCT
TTGTGGTTCCCAGAGGTTTCTCTAATTGTATTGCTATATATAGACTTATTTTCTGACCAA
CTTACTAGAGCTTGTGTTTATTACTCTCTTACATTTTTTTTTCTTAGAGTCTCAAGCTGT
CACCCTGGGTAGAGTGCACTGGTGTCACAGCTCATAGCAACTTCAAACTCCAGCACTTCT
CAACCCTATGGGTCGCCACCCCTTTGGGAGTTGAATGACCCTTTCACAGGGGTCACCTAA
ATACATCTTGCATATCAGATATTTACATTACAATTCATAACAGTAGCAAAATTAGTTACG
AAGTAGCAACGAAAATAGTTTTATGGTTGGGGGTCACCACAACATGAATTGTATTAAAGG
GTCGCAGCATTAGGAAGGTTGAGAACCCCTAGCTTAAGTGATTCTCTTGGCTCAGCCTCC
CAGGTAGCTGGGACTACAGGTGCCTGCTACAATGCCCGGCTATTTTTTTTTTTTTTTTTT
TTTGAGACAGAGCCTCAAGCTGTCCCTCTGGGTCGAGTGCCATGGCATTACAGCTCACAG
CAACCTCCACCTCCTGGGCTCAAGCGAGTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGAC
CACAGGCGCCCGCCACAACGCCCGGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1576..1592, 1595..1611, 1613..1649, 3204..3302, 3666..3747, 4677..4763, 5215..5335, 5343..5354, 5357..5381, 5393..5404, 5406..5447
1001..1127, 1576..1592, 1595..1611, 1613..1649, 3204..3302, 3666..3747, 4677..4763, 5215..5335, 5343..5354, 5357..5381, 5393..5404, 5406..5444
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved