Otolemur_garnettii Locus PTCD3
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii PTCD3
Otolemur_garnettii
PTCD3
GeneScaffold_390
SNORD94
48840..48976
51606
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCCCTGGGTAGAGTGCATGGCATCACGCTCACAGCAACCTC
AACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCAAGTAGCTGGGACCACAGGCG
CCCGCCACAACGCCCGGCCATTTTTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGG
GCTGGGGATTCAAACCCGCCACCTTAGGTGTACGTGGCTGGCGCCTTAGCCGGTTGAGCT
ATAGGCGCCGAGCCAGCTTTAGGACTTTTATTTTTTGCAGATTTTATTCTGGAAGTGCAA
CCCTCCCAAAGATTGAAGGAACTGATGTAACAAGTATGTATAAAAAAGTTATTGAAATAA
TTTCAATTTTATGTCAACACATTGTATTTATTCTATTATAGTTGTTAAATTAGGAAACTG
ATCCATGTTGTTATTTTTCACGTTAAGGGATTGAAGAAGTGGTTATTCCCAGAAAGAAAT
CTTGGTAAGTAGTCTATCAATGTTCATTCAGTAAGTGGTTGAGTGCTAATTATGAGGGAG
ACATAAAGGAATGCAAGGAGTCAGTGACAGGCAATCCACCCACCTCAGCCTCCCAAGTGC
TGGGATTACAGGCATGAGCCACCCCACCTGGCCACCTTTTTCTAATAGTCCAGTGAAGAT
TTCTACCCAAAGGTGTGGTGGATAGCTGGCCTGCAATTCTTACCATAAATTTATGTATGG
TTGAGAGGTTCTAAACCAAAGGACTATATCAGAGTCATCTGGAAAGTTCAGTAAGGGTGC
ACATGACAGTCATCTGTGGACCTTGGAAGCTGTGATGTAGTAGGTCCAGAGTATAGCCTG
TTATTCTCATATAACTGGATTAAGAGCCACCAATTTAGAGAGTAAAGGCAAAAGTAGTCC
AGAAAGCGGTAGTGGAGAGGATTAGAGGATAGAGGAATGAGTTTTTTTATTTGTTTGTTT
TTTGAGTCACCCTTGGTAAAGTGCCGTGGTATCACCACAGCTCACAGCAACCTCCAACTC
TTGGGCTTACGCAATTCTCTTGCCTCTGCCTCCCAGTTAGCTGGGACTACAGGTGCCCGC
CACAATGCCCGGCTATTTTGTTGTTGTTGTTGTTGTTTAGCAGGCCCTGGCTGGGTTTGA
ACCCACTAGCCCTGGTGCATGTAGCTGGCACCCTAACCACTGAGTTTGGGTGCTGAGCTG
AGCAAGATAGTTTTATGAGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTTGCTGAGCTGAGTAGATAGTTTTATGAGGTGAGGACGGCAATGACTAGCCCTAG
GTTGATGGTGTTAGGGACCAGCCCAGAATAGGTAGGCAAAGCAAAGAGGAACATGTACTA
ATTACCTTAGGCAAAAGGACTAGACAGTTTTCTCATTTTCTAACTTATTCTAGTGACTTT
GAGAGATAAAAACTGGCTGTAGATATGACCTGAAGTTTGTCATTAGCTAATACACTGAGA
GTAGAATCATGTGTTCATTTCGTGACTGTTAAGAGCTCTGAAGAGGGTTAACTTGTGATT
GTTATTCTTAGGGATAAAGTGGCCGTTCTTCAGGCACTTGCTTCCACAGTAAACAGGGTA
AGTAAGATTTTCTATAGGTTTTTAATTTGGCTGATAACACATTAATGTTCATCTCTGTTT
AATATTCAGAATAAAACTGTTGTGGATCTGGAAAGTCTCTTTAAAATTACCTAATCCAGT
TGCTTCATTTGACAAATAAGGAAGCTAAGGTTTTTTAAGTGACTAGCTAACTGTTGCTTA
GGATGTTAAAATGACTTAGTTCCATGTCTGTCATCTCCAGATACAGTGTTTTTACCGTAT
CAGTGATCTCTAATCATAGAAAGAGCTTGTTGAAGTGCATATTCCAGAGGGATAGTCTGG
GTGTGGTACCTATAGCACGTGATCTGTAGGCCAAAGTTGGAATGTAGGCCTTGATGGAAT
AATACATTGATTAAGAATATGAGTCTTGGAGCCAGTGCTTTAACAGCTGAGCAACTAGTG
TTGTGATCTTTGGCAAGTGACTATCTCTTGGTGCTTTTGTTTCCTGATCGCTAAGATGGA
GGTTGATCATAGTACCAAACTTCAATGTAGTGGTGAGAATTAAATATGCATAGAGATTTA
GGGCAGTGTCTGGCACAAAGGAAATGCTCAGTATATAATAACTATTTTGGCTCGGCGCCT
ATAGCTCAACCGGCTAAGGCGCCAGCCACGTACACCTAAGGTGGCGGGTTCGAATCCCCA
GCCCGGACCCGCCAAACAATGACGGCTGCAACCAAAAAATAGCCGGGCGTTGTGGCGGGC
GCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTG
GAGGTTGCTGTGAGTGTGATGCCACAGCACTCTACCAGGGGGACAGCTTGAGGCTCTGTC
TCAAAAAGAAAAAATAAATAAATAAAAATAAAATAAAGAAACACACACTTGTCTTAGCCG
CTGCTAAAATTAAAGAAAAAAATTGGCAGTTCAGTAGTATGACATTTTACGTTACCTAAT
CCCCATTAGCAATTATTTTTAAAGTACCTGTCCTTTTTGCATTTTCTTTATAACTCTCAG
TAAGTTTACAGGGTCAGGATAAGGAAAGAGAAGAAAAAAGAAATCACAAGTTTGGTCGGT
GCCTGTGGCTCAGTGAGTAGGGCGCTGGCTCCATGTACCGAGAGTGGCAGGTTCAAATCT
GGTCTCAGTCAAACTGCAAAAAAATAGCTGGGCATTGTGGTGGGCGCCTGTAGTCCCAGC
TACTTCCGGAGCCTGAGGCAAGAGAAATGCCTAAAGCCCAAAAGCTGGAGGTTGCTGTGA
GTTGTGATACCACAGCACTCTACCGAGGAAGACGGTTGTGAGACTGTCTCTAAAAGCAAA
AAATAAATCTCAAGTTTAAAGTTTGGAGTGTTCCCTCCCAACCCACACAATTTGCTTCTG
GTGCTGGCAAATTCCTTTTTCTCTGGGTTATTCAGAACCCATTTCAGCCATCCCCTGTGG
ATTTGGGCTAAGATACCATTTTAGAAAATCCAGCTTTGGTCCTCAATATGATATTCCCAA
AGAGGTAAGTAGACTACACAGCCAAGAACATGGGAAACAGCCTTTCAATTTGGGGGCTAA
GTAAGATACTAAATAACTAAACAATAGTTGGACGTGGTGGCTCATGCCTGCAATCCTAGC
ATTCCGGGAGGCCGAGGCAGGTGGATTGGTGGGGCTCGCCAAGTTTGAGTCCAGCCTGCG
CAAAAGCAAGACCTCGTCTTTACTAAAAATAGAAAAACTAAGGCAAGAGGATGGCTTGAG
CCCAGGGCAACAGCTTGAGACTCTGTCTCAACAACAACAACCAAAAAAGACATAGTACTA
GTTGTATTCCTAGTCCACTGAACAGGTTACTCCCCTACTATCTAGTAGTTTTTATTTGGC
CAAGTTATGAACACTTCACCAATCAACTGAAAAAGATCCAGCTGATTGTTAATGTGAATT
AACACAATTCTCCTGCAACCTGTTCATCTGTATCAGTTGCTGTATTTACAGTACTAGGAC
ATCAATTCTATCCTCTTAATGTATAGCAGCGGTTCTCAACCTGTGGGTTCAACCCCTTTG
TAACAATGAAAATACATCCGCATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACTGGTATTGTTTGGGCAGACACTGGGTGATTAGAAGTCAATCTTAACTGT
GATATGGTTTTTTTCATGATTTAAAAATATGGAATGCTTCACGAATTTACGTGTCATTTT
TGTGCAGGGGCTTTGCTAATCTTCTCTGTATTATTCTAATTTTAGTATATACATTACTGA
AGTGAGCACAGAGTTGCAAGTATTAATACATTTAAAAATCATTTTTTCTTTTGAAACCAT
TTGCAAGTAAGTTGCTGATCTGATGTTCTATCACTCCCAAATACTTTGGTGAACACTTTT
TATAAACAGGGACGCTCTCCAATATGACCATGACACAATCATCAAAAATAGTAAATCAAC
ATTAATAAATTATTACCATCTATCCCGAGACCCCATTCAAGTTTTGCCAATCTCTTAAAA
ACATACTTCAAGGCTCGGCACCTGTGGCTCAAGCAGCTAAGACGCCAGCCACATACACCT
AAGGTGGCGGGTTCGAATCCAGCCCGGACCCGCCAAACAACAATAATGGCTACAACCAAA
AAAGATAGCTGGGCGTTGTGGCAGGTGCCTCCCAGCTACTTGGGAGGTGGAGACAGGAGA
CTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCAGTGAAGCCATGGCACTCTACCCA
GGGTGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAACATACTTCAAAGCAAAAGTA
TCGAGTTCAGAGCCACCTGTTACATCATATTTACTGGTCATGTCTTTTTAGTCTCATTCA
GTTTAGAATAGTTCTTTTGTCTTTAACTCTGAAGGCACTGAGACTTTTGAAGATTAAAGG
CAAGTTTCACAGCAAGTCACTCAATTTGGGTATGTCTGATGCTTCCTCACAATCAGATTT
AACTAATGTGTCTTTGGCATGAATATCCAAAAACGATGCTCTGTTCTCACAGCATCATAC
AAAGTGGCACATGATTTCAATCTGTCCCACCAGGTGATGTTCACTTTGACCAACTGAGTT
AGGATGGGACTGCGAGGCTTCTCTAACTGTACAGTTACTGTTCCCAACCTGACCTTAGAA
ATTAATAAAGATTATGGATGTGTATGTGTGTGGGGGGGTATTTTAAAGTGTATTCAAACT
GAAAGTTTAAGAAGAAAGAATCACTAGGTTCATTCTTTCATTAGTAACAGTATGAACTCA
TGGATTTCATGGACTCCTACTTCATGTAACAGGTTATAATTGTTTATTATCATTATTTAG
TTTACTCTGATGCTCAATTGTGCCAGATTAGGCCAGTCTGAGCCTTTCACACAGGCTCCT
ATGTCCTTTTGACATGTCCCATCACTCCTAGAGCATGTTTTAGGCTGTTCTTGTCCTTTC
TTGGTGCCAACCCCAGATCAGCCATTTCTCCAAGAAGCCCTTTTAGAGCAGATGAGTATT
TAGAAACCAAGCTATGCTCCAAAACCTTCCCAAAGACAGAGCCAGGGGAAAATACACGTG
TACACATACACACACACACACTTCACATTGATACTTGANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGAGATCAAGAGAAAGGCAGAACAAAGGCCCCTCTAAGGGGAAGTAGAG
GGTATAGAGGAGGTAATTCTGGGGCAGATCTAAGTGGGGGCTTTGATCATGCTGAAGAAT
TGATCATGCTCAAGGTTATGGAACAATTTTAAAACACTTTAAGAAGTATAGAACCTTGGG
GCTCAGCATTCATAGCACATGGTTATGGTGCCAGCCACATGCACTGAGGCTGGTGGGTTC
GTACCCAGCCGAGGCCAGCTAAAACAACAATGACAACTACAACAACAAAAATAGCGGGGT
GTTGTGGTGGGCGCATGTAGTCCCAGCTACTTGGTAGGCTGAGGCAAGAGAATTGCTTAA
GCCCAAGAATTGCAGGTTGCTGTGAGCTGTGATGCCAAGGTACTCTACTGAGGCTGACAT
TGTAAGACTCTGTCTCAAAAAAAAAAAAAAAAAATGTAATATGGAACCTTGGGCACCAGG
ATGTGGAGAAGCTGCTGTTCACTTCTCCTGAGAAGCTTAAGCGTGTTTGGAGGAGGGATT
CTTGGATGAAGTTACACATGGATGGATAGTGACCATGGAGGTATCTGTCTTGGTATACTG
GTTCCAGGACTAGTATTCAGAGGATCCTTACGTATAGTTTGAAAACAGCAGTGGTCATCA
GTGATAAGCAGATTCATATCTTTAAGCAGCTGTAGAGTGAGTTGAACCATTTGCTTGTAT
TAAAGTTTTGCATAACTATAGGCAACTCGTGGCAAAGCTGAAGGGACAGGATATTGTATT
ATAATGTGCCTTCTGACTATCTTGGCATAAAATCTATAAAAATATGGATGCAGGGATTAT
AATACAAATTTCTGCAGTGGTTTACCTATGGTAATTAAAACTTACTTTTAGAATTTTTGT
TATTACCCAGACTCATAAGGTCATCTTTTTTCCTTCCACAGGACACCACGGCTGCACCTT
ATGCATTTCAAGATGATCCCTACCTTATTCCAGCGTCTTCTGTGGAATCTGTGAGTATTT
TCATATAACTTTTCTGGTATTATTTTTTGTCTTGCTAGTTAGTATAAAAGAATACATACA
CAATATAGTTGTAAACACCTTTGAAAAGTTAAGAGTTAAGACACTGATAGATAAATTGAT
AGGCTTTGTGAATTCTTTACAACTTTTATCAAAAAGATCTACTGTTGGGCGCTGCCTGTG
CTCAGCGAGTAGGGCGCTGGCCCCATATACTGAGGGTGGCGGGTTCAAACCCAGCCCTGG
GCAAACTGCAACAACAAAAAAAATAGCCAGGCATTGTGGTAGGCACCTGTAGTCCCAGCT
ACTTGGGAGGCTGAGGCAAGAGAATCACCTAAGCCCAAGAACTGGAGGTTGCTGTGAGCT
GTGACGTGATGGCACTCTACTGAGGGTGACAAAGTAGTAAGACTCTGTCTCTAAAAAAAA
AAAAAAGATCTACTGTTGTCTATGAGGAAGGAGAGGGGTTTTGATTTTTAATAAACTTAT
GGCTTTTTTTAATAATGCAATGACTCAGTTTAAAGGGTTTTTTTTTTAAAAGAAATACAT
ACTTAAAGCTGTATATAAAACATGACCTAAAACTATGTGACTTATTTCTTTTTTGGAGAT
GGATTCTTGCTCTGTTGCCTAGGCTAAAGGCTTCAGCATCATCATAGGTTACTGCAACTG
CGAACTTCTGAACTAGTGTCATCCTCCTGCCTCAGCTTCTGGAGTAGCTGGGGCTACAAG
TGCACATCATCATGCTTTCTCAATTTTTTCTTTCTTTCTTTCCTTTCTTTTCTTTTTTTG
TTTTTTGGTAGAGACAGGGTCTTGCCCAGGGGTCCTTAAACTTTTTAAACAGGAGGCCAG
TTCACTGCCCCTCAGTCCATTAGAGGGCTGAACTGCGGGCCCTGGGACGAATTGGCTACT
AAGCAGGACAGGCAGCAGCTGCAAAAACACCCGGCAGGCCTCATGTGGCCCGTGGGCCGT
AGTTTGAGAACGCCTGGTCTTGCCCTTGCTCAGACTCTTAGACTGATTTTAAACTCTTGA
CCTCAAGTGATCGTCCTGCCTCAGCCTCTCAAAGTGCTAGGATTACAGGTGTGAGCCACT
GCACCTAGCATGTAATTTTACTTCTAATTGTGATTTTGTGTGTTGTTAGATTCTTTTCCT
GAGGAGAGAATAATAATTTATGCTGAAAGTATAACCTTGATGTTCTTTGAATCTGTAGTA
CATGTAAATACCAGTTTGTATCTAAATCTTTTTGTTTTTATAGCGTTCGTTTTTACTGGC
AAAGAAGTCTGGGGAGAATGCAGCAAAGTTTATTATTAATTCACATCCAAAATATTTTCA
GAAGGACATAGCTGAACCACATATACCGGTAAGGAGAGGGAGTTGGATTTTTTTTTTTTT
TTTAGCTTAATGTTATATAAATGTAAATTAAAGCAAGAGTTCATGGCTAATATTTAAGTA
TCCATTTGAATATCCTGAGTATTGGATAAAGTTTTTTGAAGTGTGAAGTTGCATTTGTTA
AAAATACTAATCTTTTATGTATATTTGTCCTTCATCTTATTTTTTCCATTTACTTTCTGT
GACATTGTTGGGGTGGCAGTCTGCCCTCAGTTCTTGGTGTAAAGAGGAAGAATGCTTTTG
GGAGGGGAAAAATAGTAACTTCAGCTTGAGATTAGGAAACTTAGTTGGAAATAGGGATCT
TCAGATATAGATTAAATATTTATGTTGGGTGCTTTTATATTCCTGTCAAGCTAGAAGATA
GCTGTTTTAATAGTCCTCCTGTCTCAAAGATTGGGGAAGTTTTTTTGTTGTTTCTTAATT
TTTCTGAGTTAGATTCCCTATAAAGATATCCATGTTAAAATTGTATTTGGTGCAAGAACG
TGAAGTGGAACAATGATGTTTTATCTTGGTGTGTTAGTAATAAAAATATTGTCTTAGTCA
CCCCTTCACCTTTACCTGCTTGCCGTAGCTTAACCATCTGGTTTTCCTAGTGTTTAATGC
CTGAGTGTTTTGAACCTCGAATCGAAGAAGTAAGTGAAGCTGCCCTAAAGGAACGAATCA
AGCTCAAAAAAGTCAAAGCCTCCGTGGACATGTTTGATCAGCTTTTGCAAGCAGGTGACT
GAGTTTGATTCAAGCCCCTCTAGGAACATGACCTTAAAGTGGGCCACAGTTACATGATCC
AGAAAGTTTTGAGTAAAAGCTACAAGTACTGTTAACTCTAGAGCTTGATGGCTGTGTTCA
TACTTTCAGTAGTTGAATAAGTAATAGTTCATGTTCTACTTTAGCTTCGTTTTAAAATTA
TAGATGAAATAGAATTGCACTTTTTTTTTGAGGCAGTCTCACTCTTGCTCTGGGTAGAGT
GCTGTGGCATCACAGCTCACAGCAGCCTCCATGCCTCAGCCTCCCAATAGTGGGACTATA
GGCGCCCACCACAAAGCCTGGCTATTTTTTTATTTGTTGTTGCAGTTGCCATTTTATTTT
AACTGGCCCTGAGCAGTTTCAGCCACACCAGCTCTCCATGTATGTGGCTGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGGGCCTTGCTCCTAATTGTTCTTAGCTCTAAATCATGTGCCT
CTCTGAATTAGAGGTAATGGACCTTCAGGTGTACACATCTACACAGCACAGCTGATAAGC
TGTCACAAGAATGTACATACAATAACATCAAAGGCAGCTGGCATTATTTGTATTTTGGGG
AATCCAGAGTGCTGTTTGGTACTAAAACTGCTAAACACGGAAGAGATGGAAATTAGACTG
AATTACTCAGTATGTACTTGAACACAGGAAACACTTGCAGAAAGCTATGTTTGAGAATTT
CTGTGTGGAGCCTTAGTAATTAATCAGTTGTATAACTGGATGAGGTAGCTGTCCTCTCTG
CTTCTTGAACATGGTCAGCATCTGGTATGAGTCTGCATTAAAATTCTCATTGTCAAAGCT
TGTCTTTTTCTAGTTTTAGCCACTCTGTTGTGTAGGTATGTGCATTCAGTAAAGGCAGAT
GTCGAAACCATAGCTCAGTAATAGTGAGCTAACAAACCAGAGAAGGGATCATAGAATTTC
ATCGTTAAGCCCCTAGTAAGTGCCAAACACTCTGCTAAGGTATTTCACATACTCATTTTA
ATTGTATGCTTTCTAAGTTGATGTTTTATAGTAATCTTATAAAGGAAACATAGGTAATTT
CTCACATCTCTGACAGAGTATCACCCCAGTGAGTTACACTCTATAACCTGTACCCTCTTA
GACTACTTTCCCTCTGTTTTTAAATTTTCTAATGGGCTTTATTATTTATCAGTGTGCTTT
GATTAGAAAGATGTAGTTTTTCTCTTTTAAATAGTACCATCTCATACTTTTCTCCATCTT
GTGCCTTTTTTTTCCTTTTTAATGAGTGTCAAGAATGGGAACATAGTATTTTGACAAAAC
AGTCTTTAAAAGGCAACTATAGTTGGGCAATTATGCTTATATTTTAGGCAAGATTTTAGC
GAAGGTCTCAGTCTAAATGGAATAATTCTACATATGTTTGTCCAAATGGACTTGGACCGA
TGGAACTGAGTGGGGATATTTTGCCGAGTGTTCAGTTTGAAGGTGATAATTAAAACCATG
AGATAGTTTCCCCAAGGATATAAGTACATAAAGTAAGTGTGCACAGGGTCAAACTTCATC
TTGTATTTTAATCTTTCATGTTAAACTGCACAGTTGGTAGGGATTGTGTTCATTACTCTG
TGTTTAAGTTGATGTTGACTACATGCTCATTAGTTGATAAAGTGCTAGATGACGATTAAG
TGTGTAACCAGCTAAGCCATAGCTAATAGAAAAATTAAAAAATTTTAATCTTTCAGGCTT
TACTTTCTTAGTGTTTAAAGGTATCTTTTCCCTTTTTTTTTACTTACAGGAACCACTGTG
TCTCTTGAAACGACAAATAATCTCTTGGATTTACTTTGTTACTATGGTGACCAAGAGCCC
TCCACTGATTATTCTTTTCAGCAAACTGAACAGTCAGAGGAATTGGTAATTACTTTTGGC
ATTAATTTTGTTTTTTAAGTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAGAAAGATTGTTAATAATTTGAATTAACTCTGGTTCCTCTCTTCAAAATATTCTGTT
GTAGCAGCCCGTATAGCTATGGCTAGGAGGAGTGAGAGTATAAGAAATACCTGTAATGGA
ACACCTTGGTGAAAAGGGCATGGAGAGAGATTTAGTTCTAACTAATATGAGAGAGCTCGC
GAGATGAGAGCATTGGTGAATTGGTAGTCTCTACCTCTGTGGTGTTGAGAGGCACGAGAT
CAGCCTTATATTAGGCTGGAGGAGCAGGCAGTCAAAAAACATGTGCATTCTATCATGGAC
ATGCTTACTCTGACTCTGTCTCCTCTCCTGCCTGCAGAACGCCAGCACAGCGACTCTCTG
CTGAAGATTACCAAGCTCTGCTAAAGACTAAGATCTGTCTGTTCAAAGAAGACTGCTTTA
CTCTCTCTAAGACACACTCTCTCTTTCTCTCTCCAGCTAAAGTAGATAGCCCTCAAGCAC
CTAAGAGAAACTGTTCCTGAGCAAGGTAGCTTAGCGGTCTGCGTCCGGAACCTACCTAAG
CTAGGCCCGAGACCTGGCCAGTCCCGGGCCCTGACAAGTGGTGTCAGAAGCAGATCCTGA
CATTGTGTCCTTGCCTATCTTCTTTTCAGGCAGTGCTTTGATCAAAAATGTTTGAGGGAA
AGACTCCATTGCCTAGGCCCCATCAAAAATGCATTCATACATGGGCAGAGAGGAGGTAGT
ATGCTAGGCTGGGGGATACACAAAAAGTGTTGTGCCAGAAGCCACCTGTAGGTTGAGTTG
TATCCTGTCTCTTACTTCTAGAGGTAAGGTTCCAAGCAATCCTTTGCATCAGGTGAACAG
ATACGGACTTTTTCTTTTCTTTTCTTTTTTTTTTTTTTTGAGACAGAGTCTCACTATGTC
ACCCTCTGTAGAGTGCTATGGGGTCACAGCTTATAGCAACTTCCCACTCTTGGGCTTAAG
TGATCCTATTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGCCCTGACCAGACCAGGTT
CAGACCTGCCAGCCCCACTGTGTGTGGCTGGTCCCCTAACCACTGACTGATGGGTGCCTA
GCCATGGACTTTTTCATAAGGGATATTTATGCCTTAATTGCCAAAATGTTGTAAATAATC
TAGATGTTCAATAGTAGAAGATGCAATTGTGGTTAAAGGGTGCCTTGTAGCTATTGAGAA
CACTAATGTAGATCTGTTTGGGTGTGGAAAGATCATACGAATGGAGAAAAGGCTATGTAG
TAATAAATACATACTGTATTTGCACAAAAATTGTTTTTCATATGTATAAAGAACATTTAA
AGGTATTTCTGGAGAAATATAAGCAGTTTGTAAATGGTAGTAGCTGAGTGATGAGATTAT
TATGAGTGTTTTTCATTATATCTTTTCTAATTTTTCCCCACTGAATGTGGATTTTTTTAA
TAAACAGAGACTCTTAAGTCTTTTGAAGTACATAGGCTGAGGGTTGTAGTCACACCATGC
TTTCCAGAGCATCATCTAAAGCCTAGGTGACCTTTTGCCTCTCCAGTCCTAGTTGTTGAG
GCAGCAGGCTGCAGAGCCAGCACCTCCCTCTGCAGTGCCAGCCAAGTCTGTCTCACTCAA
CAGCAGCTTGATTATAAATAAAGGATGAGACTTAGTCTTTAAAACATCTTCGCTCTGATT
AGTGTTGGACATTATATGTTGCCTTCTCTTCCTTTCACTCTAATAACGAACAATATTTCT
GTGGGAATAAGGCCAGACAGAGGAAGGCTCTGAGGAAGCAGGCTCTGTGGTGTTTGGTTT
TCCAGTTTCTATGGGCCAGGTCTTACAAGGCACTGGCTTCTTATTTCTAGGCCATCACTT
GTTGCTTTAAGGGCCATGATTGCTTTTCACCTGTGAATTCACCAATTTATACTTAAAAAA
TTAAATATATAGGTGTAAGTATTTCCTGGGCTGCTGCTTTGCTTTTTGCTGGATTTATAT
TTTCTTCATTTTTTCTGCATTCCCTTTACCATTCTGATTTTTAGTATCCTGACTGGGAGA
ATACATTCCATTGTGTTAACTTTTATTTCTCCTAATGATAATTCATTCCAGGAAGAGGAA
AGTAACAAGAAATTTAGGAGGAAAGCTGGTCATCAGATTGGAGCTACATGGAGGTATATT
ATAAATAATTAGAACCCTGTATTACAGTTTCTTATGGTGCATGTAATATGCTCCATCATT
CTGGGAAGAAGATGTAGTCCTGTAATCTACAATTATTTGTTTTTATTGTGCAATATAAAT
TTTATGGTGTATATTCATAGCCATTTAGACCTTTATTTTATAAGGTCTTAACTCCAGCTG
CTGCACGAGAATCTATTTAGAGGTTGATGCTTCATTTTCTTTTTTCTTAGTTAACTCAGC
ATAACCTTGACACGGTGTATATAGTTGCTTTGGTAGTTTCATCAGCAGTGCTGCCTTGGA
ATATATACCTCTAATTCTGAAATGTTTGTTAAATATACACTAGGATGTACTTTAAAAATG
TAGTAGGCTGTACTACTAAATTAAGACTACTGACCAGCAGGCAGAAATATTGAGCAGTTC
TTAACAAAAGGTGAGTAACACTTAACTACATTGAGGAATTTAAATTATCTGAGCATCTAA
ATGAATGATGTTTCATATGAGTATCTAGGGAAGGAAAGCTATCATTAATACCTGAAATTG
TTTTGGAAGTGATAAATTTAATAGAATCAAAGATTAAATATCTTGAGATAGATTTTAATA
ATTTTCTATATTATTTAAGAGCATGGCCTGTTCAAATCCTGATTCTGTCTGATTTCTGCA
ACATATTATTAAGGGGAGAGTCCAGGTTATAGGATAGTTTGCATAACATGGCACCATTTA
TTTCTCTTTAGGAAAAGGAGAAGAGGTAATGTACATATTAGAATTAGAAACCAGTTGGTA
GTTGCCCCTGAGGGGTTGCATCTGAGGATTTAAGAAGGGCAAGGAAACTCCACTAAACTG
TGTTAGGGTTTTTTGTTTTGTTTTGTTTTTTGTTTTTGAGACAGGGTCTCACTTTGTTCC
CTAGACTAAAATTTAGTGGCAGCATCATAACTCATTGCAACCTCTAATTCCTGAGCTCAA
GTAATCCTCCTTCCTCAGCCTCGAGGGCTGGAGCTACTGGCATGTGCCATCATACCAGAT
CATTTTAATTTTTAGTAAAACAAGGTCTTGCTGTTCCATAGGCCGGTCTTGAAATACTGT
GGGTATTTATTACTTGTTCATAAACATTTCCTTTTCAATTCTGATTCTGTCACATAATTG
CAAATCCTGGTGTTTGGGCCTTGATATTTTTTCCCATTTTTAAAAATAATGACATTGCCC
TTTTCTGGATAGTAAGAAATTGAGTAGTATGTATAAAATGTTTCACATGTTTTCTTGAAC
ATTATAAACTGTTAGTAAATGGGGGTAGCTATTACTGGTCTTTCCTGTTTTATTCTCGGG
TCTAGCGCAAAAAACATTGCTGAAGAATCTTTACTCTGATGCCAGAGAAAATTCACATTT
CTTACTGCACAGTCGATCCGAGGGATGGTGAAGGTACCTTTGTTTTATTTATTTTTATCT
TTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACTTGTCCCTTG
AATTATTGAACCACCAGAAATCCCATGGTAAAGTATGTTTTGGGAATTCCCTTCCATCCT
TCTCTCCTTTCTTCCCCTTAAGAATCTGTGAAATCTTTGGATCTTTCAGTGACTGAGTTT
TTGCCTCAGTCATTGACCTGCATTTTGTCTCTTCTTCTGACATCAGTGATTGAAGCAGGA
GGAGAGATTCAGAGATGAGACTTTTTCAGTTACTTGTTTTTGTGTTTTTGTTTGTTTTGA
GACAGAATCTTACCCTGTGCCGTGGGTACGCCATGATGCTTGGCTAGTTTTTTTATTTTT
AGTAAAGATGGGGTCTCAGCTCGGCACCTGTGGCTCAAGAGGCTAAGGCGCCAGCCACAT
ACACCTAAGGTGGCGGGTTCAAATCTAGCCCGGACCCACCAAACAGCAATAATGGCTGCA
ACCAAAAAATAGCTGGGTGTTGTGGCGGGTGCCTGTGGTCCCAGCTACTTGGGAGGCGGA
GGCAGGAGGCTTGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCAGTGAAGCCATAGCA
CTCTACCCAGGGGATAGCTTGAGGCTTTGTCTCAAAAAAAAAAAAAAAAGATGGGGTCTC
ACTCTTGCTCAGGCTGGTCTTGAACTGCTGAGCTCAAGCAGTCTACCTACATTTTTCAAT
TTTGTGGAATTTGGGGATTAGTCAAGAGACATATAAGAATGACCACTTTGTTTTAAACTC
AGCCATTTAGGGGTTAGTTTTTGTTTTGTTGAGACAAAGTCTCACTATGTCGTCCTCAGT
AGAGTGCTCTGGCATTACAGCTCATAGCAACCTCAAATTCTTGGACTTAAGTGATTCTCT
TGCCACTATAGGCACCCACCCCAAAACCTGGCTACTTTTTTTTTTTTTTTTTAGCAGTTT
TTAGCCCAGGCCAGGTTTGAACCTGCCACCTCCGGTATATGGGGTCTGCACCCTACTCCT
TGAACCACAGGCGCTGCCTCCGGCTACTTTTTGGTTGCAGTTTGTCATTGTGGTTTAGCA
GGCCTGGGCAGGGTTCAAACCCGCCAGCCTGGGTGTATATGGCCGGCGCCCTGCCCACTG
AGCCACCCAGGGGTTACTTTTTGATCTCAAATTTTGTTATTTTACTCTTTTGCAGCTGAT
GTATTCACATTCAATGCATTGATTGAAGCAACGATATTAGGGCTGGATGTGGATTTTGAG
GAAAAATGGAATAAAACACTGGTAAGGAGAAACTCTCAGTTTATCTTTTAATGGATCTTA
AATAATCCTTTACTAGAAATAGAAAGGGAGGGAGGCAGCATTTCTTGAGCACCTATATGA
CAGTCGTTGTGGAGCAGTTACCTGTTAACCACCATTCTGGTAGCCCTGTAACCTAAGTAG
CAGTGTTATACTGAGAAGAAAGTTATTTGACTCAGAGCACATAGCTAGAATTCTGTAGAC
CTGGGTAGCTTTATTCATGTATTTATCATAATAATTTTTCTGTTACAAATGTACACGTTA
CAAATGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCAAATTGTCTTTCCAGACATAAAAAC
ATACTGCTTGCTCTTGATTCATCTAGGAGCTACTGAAACAAATGGTTGCACAGAAGGTGA
AACCAAATCTACAAACTTTTAATACCATTTTGAAATGTCTCCGAAGATTTCACGTATTTG
CAAAATTTCCAGCCTTAAAGACCTTACGAGAAATGAAAGCCATTGGAATAGGTGAGAATG
CATGTTTTAGAGTCCTCGCTGAAGATACTCTACTAACCAGAGATTTTAGGTCCATAGGTC
CACATAAGCAAATAAGACATGTAAATGCTTTTACTGTTTACATAATAGGTTAGGGATTTT
CTTTCCACATTTGACACACTTAACTAAATGAACTTACTGTGGAAGTGCCTTCATCATCTT
CATATTCTTTATTTACAGCAAATTATGGTGCTCTTTTAGTAACTTTTGATTATGAGAGCT
GATTGCTTTGACATAACTAGTTTTAAATTCCTTGACATTTTATCTAACATAATCAGGTAT
TTGAACCCATGTGTATGCTTTTACATGTTACATATTTTTAATCTAACCATGAGGAAGACC
TCATCTCCACAAGAAATAGAAAAATTAGGGCTGAGTATGGTGGCTCATGCCTGTAATCCT
AGCACTCTGGGAGTTCGAGGCATATGGATTGCTTGAGCTCACAGGTTCGAGACCAGCCTG
AGCAAGAGCAAGACCCCCGTCTCTAAAAATAGCTGGGTGTTGTGGTGGGTACCTGTAGTC
CCAGCTACTTGGGGGGCTGAGGCAAGAGAATCGCCTAAGCCCAAGAGTTTGAGGTTGCTG
TGAGCTGTGATGCCACAACACTCTACCAAGGGCAACAAAGTGAGACTGTCTCAAAAAAGA
AAGAAAAGAAAAGAGAAGAATTAGCCGGCCATAGTGGTGTGTGCTTGTTATCCCAGCTAT
TTTGGAGTCTGAGGCAGGAGGATCACTCGAGTTTGATGTTGGTGAGCTAGGATGACACCA
CTGCACTCCTGCCCTGGCAAACAGGGCAACCATGTCTTACAAAAGAAAAAGTGAACTATT
GTATATTTTTCTTCCTTAAAATAGTTTATTTCAGATTAATATGAGGGTAGTATATTTTTC
ATTAATTATTTATTGAAGTTCACTTTGGAAATCAGTTTACTTCAATATACTGTTCTCGAT
GAAGAATCCTACGGGTAATAGGTATTTGGACTTTTCTGAAAGTGAGAAAATCTTATGATA
ATTTTTCACCTTTACATTAATTAAATGAACTAGAAAATATCTTTGTTCAAACAAATAGAA
ATTCATCTTTTACTTAAATATTAACATTAATAGGTTTTAAATTCAATGTGCCTCACTCTC
TTTTTACTTTATTTCTTATTTTTTTCATATACCTGATAATTTGAGAACCCTCGCTTGCAA
CATATCACCATATTATTCAGCTGTTTTATCAACGTGGTATGTATGGCCATAAAATTGTAT
TAATTTATGCAGAAGATTGACTGCTTCTTTGAATTTATGTGATTAATTATTGTAAGTTAT
ATTGTTGGCATATGAATTAAGAGAATTCATAAATTAATGTGTGCAGCCTGAGCAGAAAGC
TATACTTGAGAGTAATAATCTTGTTTCTGATGTAAAACTTGAGCTAGATGGGAGAGGGCT
ATAAAATGTACTGGCAATTTTGGTAACGGAAATAAAATTAGAAGGTATTTTAGTCCGAAG
TTTTTTTTGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAAA
AGAAAGAAGAGAGGAAGTAAAATAACTTTTTTTTTTTTTTTTTGCCATGGTGCTTAGTAC
CCACATATGGCTTAGCGGCTATCATATTCAGTGATGCAGATAAACGTAGTGTATAGAACA
TTTCCATCTTTTCAGGAAGTTAATGGGACGGTACTACTACAGAGGAAAGTTAAAGTAATT
GTGAAGCCTTTTGGAAAGTCCTTGAGGCTCCATTTGCCACCCACTTTTATGTCAGTTCCA
GATGGTACTTTGCTTTGTTGAATGGACTTTGGAATGAAGCGAATAAGAGCTGAAATTTCA
GCTCTGCCATCTATTTATTGTCTGTGTCAAAGAAACTGGATACCTACCTGAGTAATTGCA
TCAGGATGTGGTGGTGGTGATTAGTCTTACCCATTTGCTCCCAGCCTAAGAAAGTACCCT
TTGGTTCAGAAATGATAATTTTCTTCATTCCTTCCTGTGTAAACTGTAAGAACTATAGGT
ACAAACTTGATTCTCTCTGTTTGAAGGGCTAATTTGGCAAAATCCATACTCTCCCCTATA
TAAACAAGGAGGGTTTTTTGTTTTGTTTTATGTTGTGACAGAGTCTCACTTTGTTGCCCT
CGGTTGAGTGCCATTACGTCACAGCAGCCTCTAACTCTTGGGTTCAAGTGATTCTCTTGC
CTCAGCCTCCCAAGTAGCTGGGACCACAGGTGCCCACCACAATGGCCGGACTGTTTTTAG
AGATGGGGTCTTGCTCTTGCTCAGGCTGGTCTCAAACCTCTGAACTAAGGCAATACACCC
TCCTAGGTCTCCAGATTGTTGGGATTACAGGCATTAGTCACCACATCTGGCCCTATAAGC
AAGGGGGTTTTTTGTTGTTTTATTGTGTTTTGTTTTAGGGAAAAAGCTAAACGGGTAGAG
ATAGTTTCCATGATAACTATATCCTTTGAACCTTTATTCAACTTTGATGAGATTGTGGTG
AAACTAGTATAGCTGATCCCTTTCCTCATATCACTTTGGTTCAGTGCCAACCAAAGTCAG
AGGTACTTTTGTTTTTTAAGTGATTGTCATGACCACATAGACTGGGAGGAATGTGGATTT
GTCTTATGTATATAAATTGGATGTCTGCAATAATAATAATCTAGGAATTTACCCAAAGGG
GATAACTTAAAATAGCAAAGAAATAATACATAAGAAGTAGAATATTATATAATAAAAATC
ATTAGGAACGTTACCGGATGGAAGCATGCTTCATGAAATTGTAAAAATATATCTGTACAG
TCATTGTAACTATGTTATTGCTTACATGTACAAAAGGTGGGGAAGAGAGTGTAGATAAAT
ATTTGACTAGGAATAATATTTTCTGACCTATTAGTACTCAGCTTACATAAATTTTAAGAA
TTGCTCCCATCAATTCTCTAGTTTCCTTTTTATTGGACTTCTCATTCTGACTATATGTTA
AGGGGAACACAAGGGATTATTAGCAAAAAACAAGTTTTTTCGCAAGAATGCTGCTTTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTGTACTGAGTGCTAGGAGTTTCATGATAGTATGAGAAGTGGATTT
ATGATAAAACACATTTACTTTCTTGTTCTATAGAAAACATTTCAAAAGGATCATCCCTAA
TCATCTATGATATAATGAGTGAATTAATGGGAAAAAAATTTTCTCCAAGGGATCTGGATG
ATGGTATGTTCAAAAATTGTTATGTTTTCCTCCTGTAAAGGCAGGGCTGGTTTTCCTGAG
TGCCAGTTATTAGAGGCCTTGTGATGAGGACAGGGTTTCCTTTTACCTTAGTAGTATTTG
GGTGATCATGAGAAAGCGAAAATGTTGGGTACACTCACGTATACTGTCTGTCTTGAGTGT
TTATTCCCTTAGCTTGAACCAACACCTAGCAGTATTGTTGGTGGGATTTTTATTAATGTT
ATAGACCTGAAAATACATTTTATTTGTAATAATCAAAGGTTTTGTGAACTTTGATTTCAG
GTATGTTTTTTCAGTCAGCTATGAGAGTTGTAAGTACTATTTCTTGCTTAACTTCATTTT
CCTTTTTAGGTTACTATTCATTTTGTAAATTCATCTGTAATTGGAAAGTTCTCCCTGATT
CTTTTACTTCTTAGTTCTGTTCATATCTTTGCTTTCATTTTTCTTCTTTCCCTAAAATCT
ATGCTTTCTGATCATATAACATTTCTACCATGTTTATTGTATATGCTGACTTTTCATGCC
TCTGTTCCAGTAAACTTTTAGTATATTTCATAATAGAAACTTTTAAAATTGATAATGGTT
TTTATTTCAGTTTTTTGTTTCATCATGGGAAAAATTTCAGGCAATTTTAAGATGAATAAA
GTGCATCTTATTCTGTAAGGGTAATTACTTTATTGTTAATTACGTATCCTCCCAGGTTTT
CTTCTCTAAGTTCTTAAATTTATGTATACCCAGACACATTTGCATGATGTTTTGTTAACA
GCAACCACTATTTCACAGGAGGAATGAACTGTAATTTTACTCTTCTGTGGGTGGCTCTTA
GTTATTTCATGGAGTTTTGCTAGTGCAGTGGTGGCAGGCTGAGCACTCTGTCTTTTCTGC
CCTTGTCCTGATGTTTTAGTACAATTCATTCCTAAAGGTACAATCATCAAATTGAAATAA
TTTTATTAAAAGTTTCCAAAAACTTAGTGTATCTTTCCCTTCATCACCAATTTCTCATAA
CTTTATTTGCTGTCGACCAGTTATAAATTGAATCAGCATTTTCATAAGGAACTTTGTATT
TTTTCTTTAGTGACAGCTGGTTGGTTGATAAGGATATCACAATTGCTACTTACTGTTGCA
AATTTTCAAGTGCTCATCTCTCAGAGATCTGAGACTTGCTTACCAGGTAACATAGCCTGG
TAAACACTGGAGATAACCGGAAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATTTAGAAATCAAAGTACTAGAGCTCAGAGAGGCTCCCTAAATGGGTTTATTTT
TATGCAGACATAAATGCAAACTTAAGGAAGTAACCTGTTAATAGGTACATGAGGATTGTT
TTCTGCTTGTCTAAATCCTTGCTTTAAATTCAGTGTTTTAAAAATTAATATGATATTCAG
TATTTGCTCACCATGACGCTGCAAGTGTATTGAGGAGGCAATTATGTGTAGTAAATGACC
AGGTGGGATAAGATGTTAATTGGGAAGTTGAGCACAGGTAGGCAACTCTGGTTCAAGAAT
TGGCCCATGAAACTTGAATTTTTACAAATATATTAAAATTCTTGCTAACTAGCACATATC
ATATAACTATGCTGTAATTTCACTAATTTCTTAGAACTATGTTGTAATTTCCCCAGTTAC
TTCCCCTGTTGTTAGACCTGGGGATTTTAGACTAAACATACTTTTTCTCTCCACCACAGT
TCCAAGTTCTTCACTTTAATTTGTCTAATGGAACAAATTGATGTCACCTTGAAGTGGTAT
AAGGACCTGATACCTTCAGTAAGATGGTTCATTACTTGTCCTTTATCATTGTAGATGAAT
TTGTGGGTGTTTTAACTGATTAATGCTTTCAAAATTTATTTCTCTTGATTAGGTTTTCTT
TCCCCACTCCCAAACATTAATAGATCTTCTCCAAGCATTGGATGTGGCCAATCGGCTAGA
AGTGATTCCTCAGATTTGGAAAGGTTAGGTTTTTTTTATCCCCCTTCCTTTTCTTCTTCC
ATTGTGCAACAGCCTAGGGCAGAGAGAGAGGCCAGTCAGTGGTTCAGGGTTAGAGTATTT
TGGCATAGGCATTGTAGGAGGGTAGACCTGTCATAAACCCAAACCCAAAGTCTGAATTAA
AGTCTTTGATGTCAAAACCTATACCATTCCTCTGTGCCAATGTTTCATCACTTTGCTTGC
CACAGTTGCCATGGGTGTGGGTTTGTGTTATATGTATAAATTGACTACAAAATGAAACAT
ATTCTGTATCTCTTCCATTAGCTGACTATTATTACCATAAAGTCAGTTTTTATCTGCCTC
ATTTTTCATATCTGAGAAACTGAGGTGATAGTTCTGCCCTACTACTTCAGAGGGCTGCTC
TAATGGCTGTGTATAAAAGAACATTGAGCGCCAGGCCTGTAACCCTAAGCGCTAGGAGGC
TGAGGTGGGAGGATCACTTGAGGCCAAGTGTTTAAGACCAGCCTGGGCTATAGCAAGATT
ATCTCTACCAAAAGCTAGGCATAGTGGTGTGCCCCCTTGTAGTCCTAGCTACTTGGGAGG
CTGAGGCCCCAAAGCAAAGCCCAGTTTCAAAAAAATTAGTAACATTGAAAAGTACCAAGT
ACTGTAAAATAGTATCTTACCATACAGAGCTGTGTTTAATACTTCACTGGGAACCAGTTA
CTGGCATAGGCTTTCACTGCTCTAATTTGTTAGTGTAAATCATCCTGCTGGTTTTTAGGA
ATCCTGGGATAAACCTGGAATAAATAATGTCAGCAACTGGGCGGCAGCTGTGGCTCAGTG
GGAAGGATGCTGGCCCCATATACTGAGGGTGGCGGGTTCAAACCAGCCTCAGCCAAACTC
TAGCAAAAAAATAGGCAGGCATTGTGGCGGGTGCCTGTAGTCCCAGCTACTCCAGAGGGA
GCCTGAGGCAAGAGAATCACCTAAGCCCAGGAGTTGGAGGTTGCCGTGAGCTGTGCGACG
TCATGGTACTCTACCGAGGGCAATAAAGTGAGACTATCTCTACAAAAAAAAAAAAAAAAA
GTCAGCAACTTATTTTTTACCTGCCAAAAAATACAGCTAACATTGGACAAAAGCTAGCCA
AAAAGTCTTGGTTTTACATGACAGTGATACTCCTGTGTTTCTTTTTTTTGTTTCAAGATA
GTAAAGAAATGTGGTCATACTTTCCACAGTGACCTGAAGGAAGAGATTCTTGATTCTCAT
GGCAAGGGATAAGCACCCACCAAAGGTAAGTCTGTATTGAAACTCAAGTTTTGTTACTGT
TACTAGATTTTTACTAACACATATATCCTCTGAAATTGAGGTCCTTTGAAGGTTGGTTTC
CCTGGTTTCATCTGTCACCGTGGAAAGTTCTGCCTCCCAAACTTAGATTGAAGTTACCTT
CTTGTTAGCATAATACCATTCCTAAAGTCACCCTCATTTCCTTAGTCTAAAGCAAGCAAC
GTGAAATTAGCTTCTTTCTGTCTTCAGCTTGCTTTTAAAAACAATTTCCATCTGAAAAGA
AAACCCAAGGCTGGGTGCAGGCTCACGCCTGTAATTCTAACACTCAGGGCGGGTAAGGTG
GGTGGATTGCTGGAGCTCACAAATTGGAGACCAGTCTGAGTCAGAGCAAGATCTCATCTC
TAAAAACCGCCTGGCATTGTGGCAAGTGCTGGTGATCCCAGTTACTTGGGAAGCTGAGGC
AAGAGAATTGCGTGAGCCCAACAGTTTGAGGTTGCTGTGAGCTGTGACGCCATGGCATTC
TACTGAGGACTACAAAGTGAGACTTTGTCTAAAAAAATACATATATAAAATATAAATAAA
TAAATGAAAAGAAAACCCATAATTGAATTTGAAAGATATGGCTAATCAATTTATTTATCC
CAGGACAGGGCTACTATATTACTTGTGTGCTGTACATGTGATAACACTCAAGTGGTAAAA
TGGATTGCTCAAAAATTTTAATGTTTCAGAACTATTGTGAGCTGAAAATCTCATTAAACC
ATTAGGCAGTGCTGCTGACTCTGTGTAACCCTTTTAGCTTCAGGAGGAGTTTGCTGACTG
TGCTGCTGACATCAAATCTGCTTATGAAAGCCAAGATGGCAGACAGACTGCTCCAGGATT
GCCAAGCCATCCCTCTCAATTGTATAGCTGTCTTCTTTTTAAGAGCTGGGAGAACCCAGG
AAGCATGGGTGAGTACAGTGTAAATGAGAAGTATTGGGACTTGGGTTTAAAACATTTAGA
TTAGTAGAGGAGTAAATTGGGCTTTGTGATGTGTACTCTATCAGAGGTCAAACTAGTATA
TATAACAAATTTTTGATGAGAAGTTGCTGAAAAACAAACATTTTATTTTTAATTTTTATT
TGATTTTTTTATTATGGAGACAAAGTCTTACTCTGTCACCCTGGGTAGAGTGCCATGGCA
TCATAGCTCACAGCAACTTCATTTACATTTCCACTTACATGGAACAAAGTGATCAAAAAA
GCATAGTTTTGAAAATGTTTTGGTCTTCTGGGTTATTGATACTTTTTTTTTTTTTTTTTG
AGACAGTTTCACTTTGTTACCTTTGGTAGAGGGCCATGGTGTCACAGCTCACAGCAACCT
CTTGGGCTCAAGCAAGCCTCTTAACCTCAGCCTCCCAAGTAGCTGGGAATACAGGTGCTA
GTCACAATGCCCAGCTATTTTTAGAGTTGGGGGGGGGGGGGTTCTTGGTCTAGCTCAGGC
TGGTCTCGGACCCATGAGCTCAGGCTATCTACTTTCCTTGGCCTCTCAGAGTGCTGGGAT
TATAGGCATGAGCCACCATGCCCAACCTTGAAGCATCATTTTTGATTGCTTTTCCTACTC
CATTCCTCAGCTTAAAATGTGGGCCTCTATCTATACTTAAGCTTTGGAATCCACCATTTA
AGTGCGTTTATTAAACATGGCTTTGACTAAAACCCAAATTTATTTTGTGCCCTTGTATTC
TGCTTATGTTTTTATCAGCACTTTCTTCACATGCTAATTTTCTGTGTTTTCTGAATGGAG
ACCTTAATGCATATTCATTTTTCCAGAATTCAACCAAAAAGATTCTTCGTAGGGGTAGTC
ACAGTTAAGTGGTTCTGCTGTATTCTTTGCTGTTTATGTGTAGACTGAGTCAGTAAGTCG
GGAGTATTTGTGCACAGCACCTTGTACAAGAAAGTGACTTGATTTAAACATCTGATTGCT
CATCCAAAATGTGGCTGTTGACTATCTCCAGAAAGAGATAAAGGCTTATTGCCTCTTTTG
TCTTAACAGCTGTGGCTTATACACATGACTGTTAGCAACTGTGCTCCTGCTGGTGACAGA
AACATTTGACGTTTGCATTTGTTTGTTAGTTTACGCAAGTTGGCATACATTTCCTGTGAT
CAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAATCATGGGAGCTGAATGTA
TGTGTTTCTCCTTTGTCCTGCACGTGGCAGGTTGATGGTGAGCACTTACATGAGACTGTT
GCCTCAATCTGAGCCTGCTTGTCATAATGTAGTTTTAAGACAGACTCTGTTATGTTGTGA
GAGAGGGAAACAGACTGTTCCATGCCACTCTTTGAATTGTGCTTGCATAGGGTGAGGACA
GAGGCGACCCTGTGCAAGAGGACAAATTAGGTTGAGTAGGTTGAGTACCCTTTAATCTGA
AATGTTTGGGACCAGTGTGTTTTGGGTTTTTGGAGTATTTGCGTTATATTTACTGGTTCA
GAATCAGTAGCCCAAAAATCTGGATTTGTGAAATTTTGAGCACATTTGTGTTCAAAAAGT
TTTGGATTTTAGAACGTTTCAGATACTCAACCAGTCAGTACCAGCATTTCTCAGCATTGG
CAGCAAATTAGATCTACCTGTGAAATTTGTAATTTGAGGGAAAGGATTTTAAGCATCTGA
GGTGATGCTGATGCATAGACAGGTGGGAGCCAGTGGGGCCCACAGATGTGTGTCTTCAGA
AGCTTACAAAGGGGCAGAACAGCTACAGTTATCTGATTGTTTTTTAAAGATATTAGTTAG
TATTCATAATCATTTTCCTTTCTCATCTTTAACAGGAAAATGCTGGGGCTTTTCAGGAAG
CATAATAAGATCCCTAGGTAAGTTATAATTAACTGGCTGAGCCTGGAAGTAGCCACTGTG
GGTTTGACTCATTGTGGGTGATTGCAATTTTTTCACCTGCTTCAGCTATGGCATTTGGGC
ACTCTTCTGTCAGTTAGGCAGGCAAATTGTCAATCTCCCCTACAACCAGGGCATCCTGAG
GCAAGCACTATTTTTTCTATGCTCAAGTAGCAACACATAAGAGATATGTTAAATCATATT
GAATAAATACTCATAATCTCTTTGGCTCTTTAAAATTAGACTTCATGTAACTTTGCTTCC
AAAGTGTTATTGATGATTTTATTACTGAATTTATACTGGATCTTGCCTGTAAATCTTTGG
ATGAGTTTAGGAGTTAGTTGGAGAATGTTCACATTTTGCCCTTCTTTTACAGAAACGAGT
TGCTGAATGAGTTCATGGACAGTGCAGAAGCGTCCAACAGCCCTGCCCAGGCCATTGAAG
TAGTGAAACTGGCAAGTGCTTTCAGCTTACCTATTTGCGAGAGCCTCTCCCAGAGAGTAA
TGACTGACTTTGCCATCAACCAGGAACAAAAGTAAGTGAGTCTTGTGTCTTTACCATAAG
AGAAAATTTATAAAATGGGGCAGACCATTTGTCCATCCGACCATTTCACAATTCCAGATT
TTTGGGCTACAGATTCTGAACTGATAACCTCCCTGTATTTCCTAACAGAAAGTTAAAATG
TAATAATTTATTAATTATCTCATTTGTCATACAAGTCGGGGAAGCCTGTCATTTTGGCTA
TTGGAGCCTTTTCCTTTGTTCTTAATATAGTTTAGTGCAGCTAAAGCAAGGTCCCTTTTT
CTGATTTCAAAATGGATAGGTTAGAGGTGAATGTCATATACCAAAAACCCCAGCTCCCAA
CTGATTTGCATTGTAATTCTGGTTTCCTACCTTTGCAGGGAAGCCCTAGAAAACCTAACT
GCGTTGACCAGTGACAGTGACAGTGATAGTGACAGCAGCAGTGACAGCAGCAGTGACAGC
GACAGTGACATCAATGAAGGCAAATGAAAGTGGGATGTTCAGTAATAATGATGACGCCAC
CCTAGCTGCTGGAATCACACTTGAAAACAGATACTAATATTTAACAATGTTTCAAAGAAA
TAAGGATACAAATTTGGTGAATTTTGGTACTGTGAAACAGTGGATAGATGCTGCCTTATT
TATTATAATTTGCTACTAGCCAAACCACCTATTAACTGTAGCATTCGAGGCTTACCATGT
AAGCCACAGCTCTTGTGGTCAGGATAAGCTCTGTATACCTGAAGTGTTGGTAGGCTGACC
TCACAGTGCCCTCTCCCTGCAGCTGGACTAAAGCTTCTGTTGGCCTGATGTGTTGGTAAG
ATGCTGATCCTTTCTTCTTCTTAAGAGACAGTGTCTCATTACATTATAAGTACTATTGGG
TCAGTAGTATCCCAATTTCTGGGATATTTATATGTGAAGAATAACACATCTTACAATTGA
TTAAACAGGATAATGGCAGTTGAGACTGCACAAGTGATTAATGTAGATACATGTCTGTGC
ATTTCTATTACTTTAATATGGGCTTTGACATGGTCTTCCAGCTAGAACAGCTAAGAGTGT
TTTATTGCTGCCCCTCTTTTGTCTATATGCTGGCACTCTAGTGATCAGAATGAGGGCTGT
TGAGGACAAAATCATGTGGAATATCTAGACATCATTGTGTATTGCTGGTAATCAAGTTGT
CAAGAACCTCTACTTCTAGCATTTCTTGTATCACTGTGACTTTTAAGTGGTACTTAAAGA
ACTTTGGAGATCTGCAGGATTGCACCCTCATAAAAGTTTCCACTACACACTATATTCTAC
ATGCACTTGGTTCCCAGATTTACTGAGGCACCTGAACAGTTTCATCTTTACCCTGCATGA
GTTGACATTTATTAAATGCTATAGTTAACTGACATTTGTTAATGTGTGTTCCCATCTCCA
TTTACCATTATCATACATTCTGAGGAACCTAAGTATTTGGTTCATGTGTTCTCCTAGGCA
TGTAATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 1167..1203, 2351..2396, 29861..29929, 31183..31287, 31910..32033, 33949..34064, 36291..36352, 37685..37700, 37703..37752, 37754..37772, 37883..37946, 39055..39140, 39806..39950, 41145..41195, 43293..43386, 43592..43595, 43685..43708, 44530..44567, 44569..44604, 44606..44638, 45179..45257, 45352..45442, 46617..46627, 46629..46669, 46671..46704, 47497..47572, 47574..47646, 49535..49576, 49972..50130, 50498..50539, 50558..50606
1001..1052, 1167..1203, 2351..2396, 29861..29929, 31183..31287, 31910..32033, 33949..34064, 36291..36352, 37685..37700, 37703..37752, 37754..37772, 37883..37946, 39055..39140, 39806..39950, 41145..41195, 43293..43386, 43592..43595, 43685..43708, 44530..44567, 44569..44604, 44606..44638, 45179..45257, 45352..45442, 46617..46627, 46629..46669, 46671..46704, 47497..47572, 47574..47646, 49535..49576, 49972..50130, 50498..50539, 50558..50603
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved