Otolemur_garnettii Locus C6orf48
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii C6orf48
Otolemur_garnettii
C6orf48
GeneScaffold_5523
SNORD48
1643..1707
4451
AAATCCAGCACACAAATGACACGGAAACACTTGCATGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCAAGTTGAAAAAGTCTGGAGA
TCCGTTGTACAACAAATATGAATATACTTTACCCTTCCGAAACGTTCACTTAGAAGAGGT
AAGATAGTTAACACATAAAAAAACTACGTTCCAAATTGCATACTTGGAACAATGCAGAGT
TTATTACCCGTCATTTATATCTATATAAAGCTGCTTAACCAAAACACATGAAACTTAAGG
TGCTTGGCAATCTGCCTGCTCCAGCAGGGGGAGCAAATAAAAGATTTCGCCGGGTGTACG
GAGCTGGGGTGTCCGAGGGGTCAGGGGAATCGGACGCAGACCAAGCTCCCGCGATAACGG
TTACTGAAACTACCAGCCCACCAAGGGGTGCTTAGCTCGCGCCTGTCGTCCGGAGCCGGG
TCTTTCTCCTGCCTGGCCTGCCAGATCATCGTGTTTTATGTTTTTCAAAATTCACATCTC
CAAATATTTGCCCAGAGTAGTGTGACACATACTTTCATGGCCTTCTTTTCACTTTGTTTT
GTTCCTATTTGGACGAACGATGGGGGGGAAAATGCGCGTCAAGACAGGCAGGCAAGAAGA
CAGCCATACCCGTCAGGCCCCCGACTCAGGGCAGCCATAAATAGCCCAGGCCGGAGTCAG
TCTCTTTCTCTTTGGGTGGTGGGCTGTTTGGTGATAGTCGTGTGTTACTTAGTGTTTTCG
TCGCCTCAGTTGCGGAGCCTGAGCAAGGGCAGTTGGCAGGCCCCGCGCCGGCTTTGCACA
GCAGTGGGTGTACAGGTACCTCGGAGCCGCCTGGGGGAAGCACAGCTGACCTCGGCTGAG
CTGAGTATACTACCGTTGCAGAGTAGTTTCTTATATTTTCCTGAGGCCATTGCTTGGAAC
TGACCTAGCTGAGGTCGGGAAACTCATTGGAGTCGCTCCGGCCTCTGCTTGGTTTCTTCC
CAAGTTTTTCGTTTTTTGTGGGTTTTTTTTTTTTTTTTGAGACAACAGAGTCTCACTCTG
TCGCCCTCGGTAGTGCTGTGGTGTCACAGCTCATAGCAACTTCCAACTCCTGGGCTTAAG
CGGTTCTCCTGCCTCAGCCTTCCGAGTGGCTGGGACTACAGGCCCCCGCCACAATGCTTG
ACGGTCTTGTTGCAGTTGCCACTGCTGTTCTAGCTGGCCGGGGCCGAGTTCGAATCCGCC
ACCCTGGGTATACGGGGCCGGCGCCCTACCCACTGTGGCACAGGCGCTGCCCTCTTCCCA
AGCTTCTGATCCTCACAGCACCATGATGGTGAGTGGTTTGCACTAGTGATCACGATCGAC
TGGCGGTCGGCCTGGGGGAGGACGGGCATGATGACCACCCCGGGTGACTGAGTGTCTCGC
TGATGCCAATCACCGCAGCGCGCTGACCGCTCCCCGGGTCAGGATCCCTAGATCTCAGCT
CGGGGAGAAGTTGATTGCCTGGGGCTCTTATTAATCTTAAGTTCCTGTATCTCGTTTCCC
CATTAGGAGTTTTAAGACGTCCATCAGTGTGTTATCCTTGAATAAAGGTGAGTATCGGTT
ACAAGAGCTTCTCGAGTGGCTCTGATTTTGTTAACAGCTAATGGGCTATTATGGAGATCT
ACCTATTTTCTAATGAACACATACATCAATGAAATATTTCAAAGCACTTTTTTTTCTGAG
GCAGTCTAACTTTGTCCCCCTGGGTGGAGTGCCATGGCAATAGCTCACAGCAACCTCAAA
CTCTTGGGCTCTAGTGATTCTCTTGTCCCAGCCTCCCTAGTAGTTGGGACTGCAAGCCTG
GCTATTTTTAGAGACTGAGTCGTTATTGCTCAGGCCTGGTCTTGAACTCCTGAGCTAAAG
TAATCCACCCTCCTTTGCCTCCCAGTGTGCTAGGATTGCATGCAAGCCCCACCGTGCCTG
GCCACTTTATTTTAGTTAATTTTGAGACAGCCTCAAGTTGTGCCCTGGGTAGAGTGCTTG
AGCATCACAGCTCATAGCAACCCCCACCTCCTGGGCTTGAGATCTCTTGCCTCCACTTCC
CAAGTAGCCGGGACTACAGTGCCCGCAGATGCCCAGCTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTCATTTAGG
GAACCTGGATACTTGGGGTTTCTTAGAGGAACTAAATGGAAGAGGGCTGTTAACGTTGGT
TGTTCCTCATTGGTGGTTCTCTTTTCTAGAAAGGAAAGTTTTGGAAGCTCAAGCCAGTGG
CAGTGCTCCTTCACAGATACTGCACTAACCTTTATGGCCACAGGCCTAAAGTTTGGATCC
CACTCCCATGGGGACTTGGCTGTGGTGGTTAGATGATGGTTTCTACTACTGACCTTCAGG
CTGTGACCGGTGGACAGCCATGCCCTTTCTCCCTGGTTGCTGTGGTGAGTGTCCTTTTGG
TTTCCAACTCCAGAGTGGTAATGATGACCTGGTTGGACTAGAGTCTCTGAGCTTTTCTCT
GAGGAACTTTGAAACCACCTGATCCACTCATAGCCTCCCTTCCATCCTGTCTGGTGCCTC
CGAATGTGTCCACCTTCATATTTTTACTACCAGTTGACCACATTCTTTTAATATGTGTCC
CTTTTATGAAATTTCAGGATTTTGCTGTCACAAAGGATGTCTTCTAGCTGGTGCTGAGCA
GATTCTAAGAACTTCTTTCCTGTATTAACCTGTGTGAGCAGCTGTAGTCATTGGAGAAAA
AAACTCACCTAGAAATTTGGGGGCACTTGTGGGACAATTAGATAGATACCTTTAACTTTA
TCTTGTACAACTGTCTGGTTTTATCTGAAGAATTACAATAAAATAATTGAAAGCAAATAA
AAATATTGTTTGGTCTCTGAAACAGAACTATACAAAAATATTAAATGTCTCACATAAATA
ATCATCACAGTTTGTGTCCAGCTGTACCTCTTTACAGTTAGGTATAAAATACTAAGATTA
GGCTCAGTGCCTATAGCTCAAGTGGCTAAGGTGCCAGCCACATACACCAGGGCTAGCAGG
TTTGAATCCAGCCCAGGCGCAGCAAACAACAATGACAACTATAACCAAAAAATAGCCAGG
CATTGTGGCAAGTGCCTGTAGTCCCAGCTACTTGCGAGGCTGAGGCAGGAGGAGCTCTTA
AGCCCAAGAGTTTGAGGTTGCTGTGAGCAGTGATGCAACAGCACTACCCAGGGCGACAGC
TTGAGACTGTCTCAAATAAAATGAAAAATGAAATCTAAAATACTAAGATTAGTTTCTGTC
ATAAACTAAGTCAAGGATTTCTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTC
CCCCTGGGCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1026..1036, 1039..1054, 1057..1092, 1095..1106, 1109..1120, 1123..1125, 1129..1140, 1144..1161, 1166..1177, 1189..1215, 1217..1222, 1225..1248, 1347..1352, 1356..1360, 3329..3350, 3352..3378, 3380..3396, 3401..3416, 3419..3451
1001..1024, 1026..1036, 1039..1054, 1057..1092, 1095..1106, 1109..1120, 1123..1125, 1129..1140, 1144..1161, 1166..1177, 1189..1215, 1217..1222, 1225..1248, 1347..1352, 1356..1360, 3329..3350, 3352..3378, 3380..3396, 3401..3416, 3419..3448
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved