Otolemur_garnettii Locus PABPC4
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii PABPC4
Otolemur_garnettii
PABPC4
GeneScaffold_689
SNORA55
7951..8082
13821
GTGGCCGCCCCGCCTCGGGCCCCCGGGCCGAGTGGGCGGGCACGACTGCGCCCAGGTCG
CGAGGCGCCCTTCGACCAGCAGCGCCCGGGGCGGGCGGGTATAAATGGAGCGGTGGCCTC
CCCCAGCCGCCTCTCTCCGCCCCGGGTCGCTGCTGCCTCCTTCCGCATTCGGGCTCAGCA
GCCTGAAGAAAAAAGAGAAAAGGATAAAAAAAAAAAAAGGGAAGACGCGAAAACGCCTTT
CAAATCTAAAAAAAAGAGAAGGGACGAGAAAAAAGCGAATCCTCGGAGAGCCCGCGGGGA
AGTCATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGTTCAAAG
ACTAACCTTTTACCCACCCTCACTCAATCTCCATAGGTTATAAAACGGATTTGCCTCATG
CACCAAATGGCACGATAACAGAGTAACGATCTATCAATTATGCCGTTCGTATCTCCTGTT
TAATCTCACCTGACGATCTAAAAATGGTGGGGGATGGGGAAATGAACGCTGCGGCTAGCA
GCTACCCCATGGCCTCCCTGTACGTGGGCGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTATGAAAAGTTCAGCCCTGCGGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGA
TCACCCGCCGTTCCCTGGGTTATGCCTACGTCAACTTCCAGCAGCCAGCTGACGGTGAGT
AGAAGCTGTGCCCACACATGCGTGGGATCCCAGGGGACCCCAGGAGCCATCTTCTAGACA
GGCTCTACTGCCAAGGAGGGGGGCTGGGCATCACTACGCCATGCTACCTCAGAAGCCATA
GTGGGTTGCAGAGGTTGAATACGCAGCTGATAACAGATGATCTGAATTTCAATCTTGATT
TTACCTCTTGCTAACTGGGTGACCTTGGGCTACCCAGTGGTGATGGTGGGGTTAGAGCCC
AAGGAGACTATACACAGGGTCAGAGTGAAGTCACTGTCATTCCATTTTGTGTGATCCTGC
CCTAGTGGGGCTAGATTGTTAGAGACCCTCACCTTGTCAGTGGGGATGGGCTTGTGCCCC
TCACAGTCCTGCCAAAAAGGCAGGATGATTAAAGCATAGTTCCCTTCAAATGTTCTGGGA
CTGCTGCCCTCCCTTCCCCACCTTTACCCTAGACTAAGTTTGATTTTGTGCTGATTTAGG
GCAGATAGGAGGCAGGGGGGATGATTTTGTGCATTGAACACTAGCAGTGACTTGTGGTGA
TGCCACTGGAGCTGCAGATGCCATGCCAGTTCTTCAGTATGTTTGTCACTGGAGTGGAGA
AGTGCTTTGCTGTGGATGAGTGATAGGTATAGTCTGGGGAAGTGTCATTTGAAAATCCAC
TGGGCTGGTGGCATTTATCACCTCACCTGTGAACAGTGCTTTACCACTTGTCAAAGCTCT
GTTCCTTAATCCAATCTGAAGAAAATGAGACTCTAAAGAAAAAGAACTGCAGAAAGTTGG
AGGCCAAGTTGAGACTCCAGTGCTCTGTCACCCCAGATTGTGGCCTTAGCATGAGCAGTG
GAGAGGTATGCTGCAGCGTGGCAGGAGTGAGGCCAGCAGAAACCTAATCTGGCTGCACGT
GACCCCAGATTCCCAGATTAAAAGGACACTGCAGAGACCATCAAGACTATTACTGGAGAA
ACAAGCCATTCTATGAGAATGAATTCCAGATCCCTATTTTTGTCCCTACTGTGTTCACTG
TCCATGAGACACTGAAAATGTTACTTGCCCAGGTTGCAGTTGAGGCCAGAGAATTAAACA
CTAGGTATTGATTGCTACCATCAATCCAGTGTACTCCAAGCAGAGTTCTGTCTGTAGCTC
CAGGAGCACAAAAAGGTTAGCTAGTGTGGTCTTTAGGGAGGAGTAGCTATTGTCTGCTTT
CTTGCCTCCTCTGAACAAAAGTCATGTCACGTAGAGATAGGAGAAGCCATTGGTCAGTGT
GTCTGCCAACACATACTTCTGCAGGACCTCTCCCTGCTATAAATAAGTGCAGCCAGATTT
GCCAGACCAAGCCAGCTTGCTTTGTGCAGTGCCATCTGGAAATAGACAAGGAGCTGTGTC
CAGGTACGCTCTTTTACTGCTAATTAATGAAATGGTTTGGGGTCCTAGACTGTTTATCTC
TGATAGCCATTGCAAGTGAGCTCCTCTGTACCTGGACTTCCTTTGACTTGTATCTGTCAT
CTCCCTGTCATCTCCCCTTTCACCAACTACACATGCAGCTCTGGTGGTACCAACACAAGC
CTCTGCTAGAGTTTAATACAAGTAAGCTGCCTTCTGAGGAAGATGGAAAAGATTATTAGA
AATAATTAGTGAAAAGAAATGTCCTTGATTGACTGGATAGTGGAACTTGTAGGAGGACAG
GGAATTTTGCCCCCCTCACCCCCTTTTAAGCACAGTATTGCTTTAAGTCAAGGAACAGGC
AGGCTCCCCTGCTCTGACACTGTCTGCATCCCCTCATGGAGGAGGCTGTGGGTGATTCAT
TGCTATGAGATGTGTAATAGCTTAAGGAAAAGTAGCTACCAGATCTGGGCATCCGTGTTG
CCACTAGTGAAGGGAAGTGTTCCTGGCTTGCAGGATATGATATGTTTTAGCTTCTGGTTC
TTCACAAGATCTCTGTGGTGCACAAATGGACTTACTAGGAAAACTAAAGAAGCATCCCAA
GACACTGGATGGAGAACTTGGTTGTGCAGCAGGGTGTAGTTCTAGAATTCTGTAGACTCA
GGTTAAAGCTTCAGAAGGCCTGGAAACCCACGTGTGACCAGTTGTATCAAATTGATGATT
GAGGATTTTTTTTTCTTTGTCTAAATCAACTTCTGTTCTTGGAAATTGAAAATACAGGGG
AAGTGAGCTGAATTCAGGATAGCTGTTTTTCTGAACTATTTGTCCATAGATTTAAATGAC
AGCTCTTTGATAACTTTGAAACAATACCCCGCTGAAAAATAAACAAGAATCTGATGTTAG
TTTCCTGATCACTAGCTAGATGCACAGCTTAGCCACCCTGAACGCAAATTTGTTCACTTT
ATAAAATGCATAATTTCAACTGTCCCATCTAAGTCACAGTGGGTGGTAGGCTACAAATGG
TAAAGCTTAGTCAATGGGAGGTGTTATCATTGGATCTTGGTGCCATTTAGATTATTTTAC
CCAACAAGGACACATGCAGAGGGGTTGAGACTTCTATCATGAAGTAGAGTGATTAGTTGG
AACTTACTCTACCTTCAGTAACATTGTAGGCTAGAAGAATCTGATGCCCTTTGATTTTAA
CAGAGTTGCTTTTCATCAGAGTGATTACCTTGAAAAGTCCTGGAGTAGTCTGTTCTTGGG
ATGGTGGCCTACATGAATTGATGTTTTATATCCTTGATTAAAATTTGTTTCTCTTACAGC
TGAGCGGGCCTTGGACACCATGAACTTTGATGTGATAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACTGAAATCTCTTGTGGGCTTGGA
AAATGGTTTGTCTTTCTGTAGCACTGGTTTGTACCCAGGTCTCGTAAATGTCTTTTAGTA
CAAGTAAATAAGAAAATGTTTAGGATGGAAGACTCCTGTAATAATGGCTACCATTTGTGA
ATGGAGCACTTAGTAAGGGCCTGATGCTATGCTAAGTGTAAGAAAAACCAAACCTGGTAT
TATTTGGCTGCCTTTGGCCTTGGGGAGGTAGGGAGCTTCTTAGATACTAGAGAGCCCAAG
GCTCTTGACACATCTGGACCAGTGGTGCCACAGTGGTCTGCCTTGTTTTTGACAGGTGGT
GTGTGATGAGAACGGCTCTAAGGGTTATGCCTTTGTCCACTTCGAGACCCAAGAGGCTGC
CGACAAGGCCATCGAGAAGATGAACGGCATGCTCCTCAATGACCGCAAAGTGTGAGTGTC
CCAGTCCGGAGCAACAACCATCGCATGAGCCAGCTGTGGCCCCACCTGGTATTAACTGGC
ACACACAAGGCGGCTACTGGTTCTCTCGGCCCAAGAGTGGCCTCCTCCTACCTCTCCACT
CCAGGGCTGGTGAGTCTCCCTGCCCGAGCTGTGGCAGCCCTTTTGACTCGCCAAGGTGGG
CTTCCTGCCCAAGCCATGGCCTGCCTGCCGCCTCTCCCTTAAAGGCATTCGTCCATGGGT
TTTGTGAGCATCGGCAACTGGGGCTGGCTGGAAGGCAACTCTAAGCCCACTCTGAGTGGG
GGTCTTGGCCAGCGGCAGAGTGGAGAGGGCCCTGGACTGACCAGGAGCTGTATACTAGCT
ACGTGACCTTGCCTTTCCTGTGACACAGGTCTGTCCATGCATTTCTTGCTGGTGGTTGAT
GACAAATTGTCCCCTCTAGTTCTCCATTTTCTAGCTTATGACTCAGTCATCTAATACAGG
GCTGGCTCCAGAGGAATACTTAATTTGGTTACAATGAAAAATCTCATCCTTTGCAGAGAC
ATTTCATAACAGACCTTGTTGTTTTGGTGTGGTTACTGTGGAATGGAGAGTGGGGGAACT
TTGCAAAGCCATGTGGGAAGGAAAAGGGGCAATAAATCTTGGCTATTACAAACAAAAATA
ATCTTTGTCCTACGTGTTGTTGAATAAACCAGAGGTAGAAAGGTTGTTTTTAATATCTAT
TTGTCCAGTGATTGATCTATAGGTATTACCAGGATGAATGTAAAATTTTTCAGATGTGGA
TACATTTTCTTCTTACATGTAACAATACCAAAATGAATAAAGTAAAAAAACAAAGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTGGGGCCAAAGCCAAGGAA
TTCACCAATGTGTACATCAAGAACTTCGGGGAAGAGGTAGATGATGAGAGTCTGAAAGAG
CTATTCAGCCAGTTTGGTAAGTTGATGGTCCTTTGCTCCATGTGTCCCCTAGAATCACCT
GAGTTCAGCCAGAGATTTACTTCAAATGGGTTCTTAGAGACAAAGAATCTTTTTTTCCTT
GAGCTGTGCTAGAAGTGGTTTTATTAATAGTTCTGTCCTTTGGTAATAGGTAAGACCCTC
AGTGTCAAGGTGATGCGAGATCCCAGTGGGAAATCCAAAGGCTTTGGCTTTGTGAGTTAT
GAGAAACACGAGGATGCCAATAAGGTGAGAATACCATGAGAGTTGGAAAAAACTTGGAGG
AGGTTGCCCAGAATATAGGCAGAGCCTTGCTAGCACACATTTGAGCAGAGCTGGAATGGT
CTGAGTATCTATCTAGTCGATGTATAGTTAACTGTACTCTGGAATTTTCTTCCTGAGGAG
CTCCCACATGTTAATATATCATTTAATTCTTCACAAAGCACTTAGCACATATGTACCTCT
GCTGCCAGTTGTTGAAAGAATAGGACATGAATAAGGTGTTTTTTCCCCTTCAAAGGTGAA
GGAAGGAACTAAAGACCAAAGAGTTGCTGATTTTACACCATCACAGCAGCTACTTGTGGA
CAAAGTATTGTGCTGGGTCTTTGACATTGACTACATAAATACCTACAAAAGAGCCTGTGA
AATTTATTAACAGCTGGAATACAAACTAGGCTTATGTCACCAGCCTTGTATTTGTGCAAC
TATATTATTTTTTCTGTATTATTTGGACTGTTAACCCATAAATGTTTGGCTTAGTGAGTT
AAGAGTAACACAAAGGTTGCCATCAAGGTGAGAGAACTATGAAGATACTTTGCAGAGGAG
GAAATTTGGGATTTGTTCAGCAAACTTCACAAGTGGAATGAAATTAGTTTTTAGCCCTAT
AAGAAAGATTTCTTTTTCAGAATATTTGGTGGCACTTATCTCCTAAACAAGACTCCTGTC
TCTGTAACTTAATTTTAAAAGGCATGTATTTTCTCTCTAGGCTGTGGAAGAAATGAATGG
AAAAGAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGTAAATC
TCTACATTAAGAACTTGGATGACACTATTGATGATGAGAAGTTAAGGAAAGAGTTTTCTC
CTTTTGGATCAATCACCAGTGCTAAGGTATTTTAATACTGAGATTTTGAGTTTGAAAGCA
GTAGTCAGGAGTATTATAGGTTTATTGGGATTTGTTTCATTGCAGGAATAGGATCTAAAT
TGTGTTTATTTCTGAGAGTAGCTACTACGTTGTTCCTTACATATGTGAGTATAAGCCATG
GAGGACGTTTCGTTAGGTTAATAGTACACTGTCTTCCAAACATGGGTATGAAGAGGACTC
TAACCCAGCCCCTCCCTGCCAGCCCTCCAGAGCACCTATATCTTTCCCATTCCTTGCTGA
TTCGTGCTGGTGTGGGGACAGATGGTGCTATAGCATCAGCAGAGGAAATCCAGACAGGTT
TTCCATTTGTCTTGGGGCCTGTCTCTACAACTCTGCCACATTTTTTCTTCCTTAAGAATA
AAGGTATTTTGGAGCTGAGGTTGGGAACTTCTACCCCAGTCCTATAAAGAAGAGGAAAAT
GTCCTTGTTTTGAAATGTGTGTGGTTTTTTCTTTGATAATTATATCAACCATGTTAACAG
GGTAAGTAGGAACCAATTCTCAAGATAAGGAATTTGAGTCCTTGAACAAGAGAAGCAAGA
ATGCTGGTATGCTGTGTGCATATCCTTGGCACTTTGGGAATATGACAGAGACTTATGACA
TGTGAATGTTTTGGGTCATAGCCTGTTAGAGACACTGGGTCCTGTTCATAAGAGGTGCAG
CAGGTGCCACAGAGTCCTGTAGGAGATGAGAAAGGAGCTGTGTGGGGTCGTAAAAGCTTA
ATGGCTCTGCCCCAGTCCTTACCATAAGCACTTCCAATCTGGGAACACTGCATTATCAGG
GAGCTGATCGGAGGCCAAGTCTGTGGGCTTTCCCACTTCCTTTAACCCTCTCCCTTGCTA
CCATGCTTTGACTGGCCCCCCATCAGTAGAAGGAGTTGCTTATCTACACAGTCTACATAG
TAGTAAAGTTGGCATTTGTAAGAGAGCAAAGAAGTGTATCTTGAAGCTTTGTAGATAATA
TTCTTAAGATCATGGTGTGGCATTTTTTTTCACACATCACAGACCCACCTCCTTGGTGTA
GAGAGTTGTTGGATTGATACACACCTTTACTTCCCTCTCCTCCAGTGAAGAAAAAAGTCA
TTAGCAAATGGTGAACTGCATGTGGAAAAAGACTACCAGGACCTATAGACATGTGGCTTT
ATAGTTGTTTGCCTTGAAGTATGTCATGGAAATTGAGGTTCAGAGGGCAAGACGACTAGA
GTTGCTCTTATCCTAGCTGATTGTCTCTCTTATTCCATTGAAGTAATGGTGACAGTCATT
GGTAACCTGAGGGTTTTATAATTCCTTTCTATATGTAGTATTTCAAAAGTCTTATCTTGA
CCTTGCTAAGAGCTTATGATAGTTTGTTTACTAATGTCTTAGAGCAGTTGAGCTTTAAAT
ATAAATGGCTTAATACTGCTATGAAGATCTCTTGTGGGTACCCAGGGAAAATAACTTTGG
GTTCCTGGCTTTAAAATGTCTAGGTCCATACTTTAGAAGTATAACTTAATGGCTCTAGGG
TATATCCTGGGCTAGGATTGACTTGGTAATTATGCAGCCGAATCCAGGTTTTCTGTCTGA
TTTTGTAGGTAATGCTAGAAGATGGAAGAAGCAAAGGATTTGGCTTTGTCTGCTTTTCAT
CTCCTGAAGAGGCAACTAAAGCAGTCACTGAGATGAATGGACGCATTGTGGGTTCCAAGC
CACTGTATGTTGCCCTGGCCCAGAGGAAGGAAGAGAGAAAGGCTCACCTGACCAACCAGT
ACATGCAGCGGGTGGCAGGAATGAGAGCGCTGCCTGCTAACGCCATCTTAAATCAGTTCC
AGCCTGCAGCTGGTGGCTACTTTGTGCCAGCAGTCCCACAGGTGGGTCTCCTTTGTGGTC
ATGGCTCTTTAGCAGCTGCCTCCTGACAGCTATTCCTGTATTCTACAGCAGTTGGGAAAA
GGGATTTTTGGATATTGGAGTTAGAGAATGTCAGAATAAGGACCCATCTAGTAAAAATTA
AGATAGACTTATCCATGCTCATAGAGACACTCAGTGGCAGAGGTAAAGCTAATTAGTCTC
TATTAATTGACCCCTCTGCTTTTGAGCAGAGGGAGCCTTTTTCCAAATTGTCGGCCTAAG
GCCTGGTATTGGGATGAGATACTTCTCTAATGCAGGCCCTTAAAAGCATTTGGGTATACT
TTTTTTACAGGCTCAAGGAAGACCTCCATATTATACACCTAACCAGTTAGCCCAGATGAG
GCCTAATCCACGCTGGCAGCAAGGTGGGAGACCTCAAGGTAGGTGGTAGGGATCAGTTTG
GTCACCCAGTGGATACCCATCCTGGTTTCACCTGCCTACCCTACTTGTGCCCTTTGAGGC
ATAGCCTAGCTTCTGGTCTGCATTGCAATGAAGTACAATTTTTGTCTTTCTATCAGGCTT
CCAAGGAATGCCAAGTGCTATACGCCAGTCTGGGCCTCGTCCAACTCTTCGCCATCTGGC
TCCAACTGGTAATGCTCCGGCCTCTCGTGGCCTCCCTACTACCACTCAGAGAGTCGGTGA
GCAAACTGGCCTTTAGAAGCTAGCCCGGGGAGGAGGGAGTCACGATGACTAGGCCTTTCC
CTGGGTTGGTCAGTTTGTTGGGCTCAAGTTTGAGTCCTGGTTCGGTAATCTTAGCTGTGT
GCTTAGGTAGGTACTTCAGGAGCAGAGAAACAATGAGTTCTAGATGTGTTTGTTATCATT
AACATTCTTTGTTCATTGGTGACTCATGTGATCAGTTAATTGTAGAAATTTGCTAGCTGG
ATGACTGCAAAGGCAGCCTCTTCTTTTGAGTGGGGGTGGGTATACAAGGAAACTGTTTTT
TGCAGAATATGTCCTGCACTTCAAGATGTGGAAAGAGTTGTATGTTATCCTTTGGCTCAT
TCTTGAAAGTAGCTGTAGTGGCCCCATTCGTGATGTCGTGTGTGAACTTGCTTGGAAATT
TCTCCTTCCGTGGGACGTGGCCAGTTGGACATCTGCCAACACTGATGTGCATTTGCTGGT
CTGTTGTAGGGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCG
CCCAGCAAGGGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGATGCACACAGAAGG
GGGAAAAATGGGATTGACGGGTCTTTGCCCAGATTGATGGACTTTAATTGTATCTCTTCT
TTCCCGAAGGCGTTCCCACAGCTGTGCAGAACTTAGCACCTCGTGCTGCTGTTGCTGCTG
CCACCGCTGCTCCTCGGGCTGTTGCACCATACAAATATGCCTCCAGCGTCCGCAGCCCTC
ATCCTGCGATACAGCCTCTGCAGGTGAGGTCCACCAAACAGAACACTAAAAAGGATTTTC
TGCGTTTCCACTTGATATAAAGGATGCTTTCCTTTGGTTCCTTCCCTTAATGTTCCTGCT
TTTTGTTAGAATCCTATGTTCTATGTATATGGTGATCCAAACACTATCCCTGCCTTTTAG
GGTCTGAGGACTAGAAGGAAGAAGGTACTGGAAAGTATTCTTCCTAATAAAAGTTTACTC
AACAAATGCCTCAGGAGGAAATGCTTATTCTATTTTGTGGAATGAAATGTTGGCCTAATT
CTAGAATCACAAATGAAGCTAATTGAGACTTTAAAAAAAAAATTACTTTAAAAAAATGCC
CCCAAGGAGACAGCCAGTGCTTTCAGCTCTTTTGCAATATGCATGGGCTACTCAGCTCTT
TGAGCCTCCAGGTCACTTCCACGTCCAGTGTTTGAGCCTTGGCTACTGTGCAGGATGATT
GGTACATCAAGGCAGGAAGTAACTTTCACTTACAAATAAGAAGTTCAGCTTTAAAGATGT
GGGAGAAGGGCTGAGTTCAGGTTGAACCCAGAGCTTAGATTTTCTAAGCTGTGGTTTCTA
TTTCTAGATCTGTGCCCCTAAAGGCAAGCTAAAATACAACTAGTTTGCTTCAGAGCTTGG
TAGCAGTTTGCTATGGAGGTGCCACACTAAGCCTTCAGATCCATAAGCTTTAGTAAATGG
ATTACTCTTGAATCATTCCGTCCCATAATCTAAACTAGGGATTTCCCAGAACCTGATGCT
GTGTAAAATACCTTTTTTCAGCAAAGCCCTACTTTGGAGCTATGACTGGCATTTATGCCG
CATATTGACAGTTTTAAGTGAATTGTCAGAAAATGCTTGCTTGCCATTGTTAGGGTTGCT
TTATTATATGCCTTTCATTTTACTTTCTGAAGTTAGTTCCTTGAGAGCAAGGACAACTAT
GACCATTTCCTGTTGACATAGGTTAAAAGTTCACAATGTTGACTGGTCAGGATCTATTGA
CTACTATCAGCTGTTGGCCTTCACACCGAGCTAACCCCCTACCTCTCCTGGTTCCCAGGC
ACCCCAGCCTGCAGTCCATGTGCAGGGGCAGGAGCCTCTGACTGCCTCCATGCTGGCCGC
AGCACCCCCCCAAGAACAGAAGCAGATGTTGGGTGAGTGACTCACATGCTTAAAGATGCC
AAAAGCTGGTGCCACTTTAGACACTGGTATCTTCACTGGGATTAGGCTTGGTTTTTTAAC
TATGCTCTCCACAGGAGAACGTTTGTTCCCGCTCATCCAAACAATGCATTCAAATCTGGC
TGGAAAGATAACGGGAATGCTGCTGGAAATCGACAACTCTGAACTGCTGCACATGCTGGA
GTCCCCTGAGTCTCTCCGCTCCAAGGTGAGCTGGTTCTCAGGCCCTGTCACTTCTGCTTT
CAGCTCAGGAGGATTGGAGGCAACCTTGGACACCCAGGTGCAGCAGAGAAGGATTTGCTG
CTCCCATGATCCCTCTCCTCATGTCTCACTTGTCATTAGGGGCTGCTGCTATGTGGGTAT
TTGGGAAAGCAGTGGGGACCAGAAGCCTAGGGATCATTTCTGCAGTTGGTTCTGGTGTGC
CTCTGGGCCTGGGCACCAGGGAGGGGTGGTGGCTTTCCTCAGATTCACTGACCACCTAGA
GATTTCCCTCAGGTGGATGAAGCTGTGGCAGTTCTACAGGCTCATCATGCCAAGAAAGAA
GCTGCCCAGAAAGTGGGCGCTGTTGCTGCTGCTACCTCTTAGACAAGGAAAAACCGTATG
TTTTGGCTATTTTCGTTTTCTGCAATGGTTTCAATTTGTGAATAGCTTCCTAAAAGAATC
GGGGCAGTAGATAGAGCCATGTTTCTGCCATTTAATCTGAAAGCTTGGGCAGCCTGTTAC
CTGAACATTTTCTGTCATCTTGGTTGCGTTAATATGGAGAAAAGAGAATACAAATTGTGA
ATTAAAAGGAGCAATTTCTTCCAAAAAGAGCACCTGGTCAGATCTTTCTCAAGAATCATC
TGTTGATCTGAAATGATGACAGATACATAAGAAGTTCTCAAAATCAGATCCCAAGGCCTC
ATTTCTGTGAGCATCATCATCCTGGTTTGGCCTGAGGTTGCCTGTATACCCACTGCCTAC
CTCTGGGAATGCAATAGGCAGAGAGAGGCCTTGACATCAGTGGTCATGATCTAACTTTTT
TTTTTTTCTTTCTGCCTCACATTGGACAAAGAAGAGTTGTCTTTGGGCCACACATTACAT
ACACAAAAACTAACCAAAGCTGATGAGCAAAAAATAAGGTCCGTGCGTAATTTTCGTGAT
ATCCGACCCCACAGATAAGCAAAACAGGCCTCAAATAACCCGCATGCGTGCTGCTGGTTG
GACACCCCTGAGTGGGAGACACACTCTTGATTTGTTGCACAGGGTGTCTTCCAGGTGATT
TCTTATCATGAGGGTGATGGACTCTTGTCTGCAGGGGTTTGGGTGAGTGAAGTTGAACTA
GGACCTCTGACTAGAACTGGTGGTGGGTGTTTCCAGATAGAGAATCAAGTGAGCAAAAGC
CGAGCATAGGAAGAAGCACATGGTTAGGGGCCAGAGCTGGTGTGTTAGTAGAGGTTGGCT
TGGCATTGCCATGACCCTCTGTGTCAAGGGCCTCAGGAGTCTTACATCTGGTGGGTAGAG
GCCAGGGATGCTGCTAAACATAGTGCAGTGCACAAGACAGCCCCAAAAGAATTGTGTGGA
CAAAACTGTTGATAGTACTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 3899..3935, 4098..4254, 4735..4850, 5756..5895, 6049..6143, 6880..7017, 7610..7705, 9308..9580, 9910..9997, 10136..10255, 10749..10835, 10929..11062, 12118..12211, 12314..12444, 12732..12821
1001..1193, 3899..3935, 4098..4254, 4735..4850, 5756..5895, 6049..6143, 6880..7017, 7610..7705, 9308..9580, 9910..9997, 10136..10255, 10749..10835, 10929..11062, 12118..12211, 12314..12444, 12732..12818
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved