Otolemur_garnettii Locus RPL5
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii RPL5
Otolemur_garnettii
RPL5
GeneScaffold_3533
SNORD21
7132..7224
13714
TGCTGTGAGCTATGATGCCACAGCACTGAACTGAGGGTGACAGCTTGAGACTCTGCCCC
GCAATGGAAAAAAAAAAATTCCAGTGGATTAATATCTATAAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGAATTTGCAGTGAGGTATGACGATGCCACTGCACTATG
GTGAAGGGCAACAGAGTGAGAGAGACCCTGTCTCACAAAAGAAGAAGAAAAACAAAACAA
AAGGAAAAACTTAAGCTGGAGCATAAGCTCGAGCAAAAGAAAAGGAACAGGAGGTGCAGT
TAGGGATCAGGGATGTGATGCAGGTAAAGAGAGACAGGAACCGAGCAGTGCTTTGCCCAC
GAACCAAATACCGCACATCTACCAAAGGTCAGGGCCTCCCTCGGAGTTTGCCGTCCACAG
CGGGCTGAGGCAGGTGCGAAGGCGCTGTGGTAAGGCAGAGGGGTGACCCCCACCTAGGCA
AGGAAGGCTTCCTGGGTACCTCTACTCCCTAAGCGGAGATGGGTAGGTCCGGGAGAGGGC
AAGAGGGCGCCAGAGCAAATTCATCTTAACTTTAAATGTTGTTTCTGGCTTACAAAACTA
ACATATGTTTGTTCTGACAAAAAGGTTGAAAGCCTCCATTAATTCTCCCAGCTCGCGCTC
ACTACCCGTCTTCGTCGGGTTCTGAGCCCGGAGCCGTAGGATCCGGGGGCATTGAGGGTT
CGCGGCTACCAGGCGAAGTCCGGCGTTCACCCTCCTGCCAGGGGGGGGCAGCACGCCGCA
CGCCTAGTGATGGGCGTCCTCTCTCTTCCACACGTCGCTGGCGTAATCGGCGGTGCTACA
TACTGCGCCTGCGCGCGGGCTACGGTCTTTTCTCCCCCCCCTAGCGCTGCTGGGCCTGCA
AATTTGTGTGGGGCCGCGGACGCGGGTCTCTATTCTGCAGGATGGTGAGTGGGCACTTCG
ATCTTGAGGGTTCGGGCGCACGGGGGTTCTTTTTCCTGCGCTGAACTCCAGCCTAGGGCC
CATCTCGCGCGGCGCACGGATCGGATGGCTTTAGATTGTCGATTCTGCCTTGGTCGGGCT
CCGCTCCCAGCGTGGCCTTAATGGCTGCCGCCGGTGTGCGAGCTTGGGGGAGGGGGTGGC
TCACGATAGCGTGAGCTTGGGTGGTGGATTGAACTCGGGTGAGTTCAGTAAACACCTCCG
TAGATCGTGCCGTCTCGTCTGAGTGGGCACTGGCAGGCGGCCGGGCCGGGAGGTTGCATG
TAGTCGAGCTGACTAGTTGGAGGTTGGCAGAGTGCAGGCGGGCTGCGGGTCTTTGGCCTC
GGCTCCATCCCGACCTCTTCGTGGGCTTTCCGGGGAATCTTGGAGCGGGCAAGTCTTTCA
GGGAGCTTGTGCTTGTGGGCCAAAGACGTGGCTTTTAAGCCCAAACTGTCAGCGGAGATT
GGAGGCCGAAGCGTCCCTGGCTCCCGGAAGGAAACTCTTGAATTTGGAATATGCGCCTCC
TGCTTTCTCCAGTTAGTCCCTAGCACAAGTTTGCGACGATTGTCAGGGGCCCCAAAGGAG
GGGTGGTGTGTTACTTGAGTTGAGGGGGGGAGATAATTGCTGAATGTGCTCTTCCTCGAT
TAAATATTGTGGCAGCTAATCCAGGGTTTTGAAAAACGTACGTGGGAAGTGAGAAATACG
TAGATATCAGAGGTTAGGTTTTCGAAGTGGGATATAGGGTATTAGGAACAGTCTGACGTT
TGGTACCACTTGACTGCTCAAAGATTTGCATTGGTCTTGGAGGAAACAAGTACAGAAATT
GAGAGTAAGCATTTAAAAACTTGAGCAAGCAACGTGGCAGTAATTTTATGCTTGTTAAAT
CCCATGAATCAGGGTCTGCTTTTGTCTTTTTTCTTTCCTTGTTTTTCTAATGATTCGTTT
TTATTGTGTTCTGTAAAGCTATCAGTTTGACAGATGTCAAATAGAAGAAAGAGTGGTTAC
TGATCCCAATTGGCTTGGAAAACTTGGGCTTCTACAAAAGTGACATTTGGGTGTTGTCTC
TTAAAGTTCAAGTGTTATTCTTGACGCATGGTTAGCTGATGTCAAAAGTATTATTGTAGG
TTTACATTTATTGAGGTTTTAATATTCTTTTTTTTCTTTAAGGGGTTTGTTAAGGTTGTC
AAGAATAAGGCCTACTTTAAGAGGTACCAAGTGAAATTTAGAAGACGACGAGGTACTGTT
AATTTTTTATGGTTACAGTACTTAGAATTTTCTTTGCAGGGGAGTAGCCTTTGTAAAATT
ATTTTTTTCTTTCAGAGGGTAAAACTGATTACTATGCTCGGAAACGCTTGGTGATACAGG
ATAAAAATAAGTACAACACACCCAAATACAGAATGATAGTTCGTGTGACTAACAGAGACA
TCATTTGTCAGGTAAGTTGTATTCTAGATGCAAGCATTTCCCTTTACTGTGTTAGAGAAG
TGGCTGGGAAGCAAAGCACATGATGTGTTTGAAGGGTTGTCTAGTGCCTCTAGAGACAGT
TCGTTTTAGTAGGTTTAGAGTTGGAGTTTGGGAAATTGATACATTAAAAACACTCCACTG
AAGATCAGCCATGCTTGGAAATCTCAACCTAGTTTAATCCCATTCGTTTTCTAATTTGGG
GAAAAGAGGCCAAGAGAGATCTCTTAAAAGAGGGTGGTAGGGTGGGAAGATCAGAGACAA
GTAGAAGGTTCTTACCTATCACAATTCCATTAGCATAATAAGAGTTTTGGGCTAGTATTG
TGGCTCACACCTGTAATCCTAGCACTGAGGGAGGCCATGGCAGGAGGGTCGCTTGGAGAC
CAGCCTAAGCAAGAGTGAGACTCTTCTCTACAAAAAGATAGAAAAATTAGCTGGGCATGA
TGGTGTGTGTCTACTGCTACTTGGAAGGCTGAGGCAGGAGGATCACTTTTTTTCTCCAGG
AGTTTGAGTTTTCAGTTAGCTACAGTGATGCCACTGCACTCTAGCTGGGGTGACAAAACA
AGATGCTATCTCAAAAATAAATAAAAGTTTATTGTGGACTAAGTCCTGATTCTTGCTATA
CAGCCTTACATGCCATTTAAGCACTCCTAACTGAGACTCAAACAGGACGCCTAGGATTGT
TACTTCTGATTACTGTTTAAGATAGGTTTTAATAAAATGTAAAGGTATCTCCCACAAAAA
AAGACTTGAGGAAGTGGCGGTTTGTTCTGGGATGCTAGTATTCTAGGCTTTCCTGATACC
TGAGATTGGATGATCTTCTGCAGCAGCCAGACATACCTGTTTTCCAGGCAAATTTGTGAA
AGCAATTACCTACCTCTATACCCAAGTTCAGATAAATAAACATTAGGTACCCGAAACTTT
GTTGAACTTAGAAAGTACTTGAAATAGTTGGATGTTCCTCTTTTTTTTTTTTAAGTGCCT
TTTAAGTTCTTTAGAGTTTTTTCAGTGTTTAGAAGAACATCCTAATATTCAGTGTCGCTG
GTAATTTTAGCCTTGTCTGCTGTTACAGTCAAACATATTTACAGATACCAAAACTACCTA
CTATACAATTGCTCAACTGCTATAGAGTCATAAATTGTAGTTGGAGATGTTTAAGTTTAG
GAAAGAAAGATTTTAAGTGATGCAGATTTATGTATTTGGGTCTGTTTTCCCTCTCATTTG
AAAAAGAAAGTAAAAGGAACAGATTACTAACCTGGCTTTTCTCTTACCTTAGATTGCTTA
TGCCCGCATAGAAGGGGATATGATAGTCTGCGCAGCTTATGCACATGAACTACCAAAATA
CGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATACTGTACTGGCCTGCTGCTGGC
CCGCAGGGTATGTACAGATGACTTTAATTGATGTACCTTTGAGTTTAGCTTACTTGCTTG
GAGACTTGCCTCTAAGATGTTTGTACATGGATAACACTCAGCTGTGTGGCTTCAGGGGCG
TCCCTACTTCCTATTTTCTGCCCTGTTTATGGGTGTGTTTAGACCACCTTTGTCCAGTAG
AATTTTCTGTAGTTGGGGAAATCTGTAATCTGCTGTCTGGTGGATTCCCAGCTATGGCTG
TTGAGTGCTTGAAATGTGGCACTAAGCTACTAAGAAACTGAATTTTTTAATTTGAATTTA
AAAGCCACTTGTGGCTAATGACTATTTAATTGGACAGTGAAGACTTTTTCTACTCAGGTG
TACCTTCTGACCATCACCGTATGTTAAAAGTTCAGACTTGTGGAAACTACTCCAGAACTT
TAGAACCTGTATTATGATACGATGTCTAAAATGATTCATATGTACATTAAAATTTGAGGC
TCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCCACGTACACCTAAGGTGGCGGGTTC
GAATCCCCAGCCCGGACCCGCCAAACAACAATGATGGCTGCAACCAAAAAAAAAAAATAG
CCGGGCGTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTC
GCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTAATGCCACGGCACTCTGCCCGGGG
GGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAATTTGAGATGGGGCTCGGTG
CCTGTAGCACAGTGGTTAGGGTGCTGGCCCACATACACCAAGGCTGGCAGGTTTGAACCC
AGCCTGGGCCAGCTAAACAACAATGACAGCTTCAACAAAAAATAGCTGGGTGTTGTGGTG
GGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAAGAGAAATGTTTAAGCCCGAGAG
TTTGAGGTTGCTGTGAGCTGTGATGCCATGGCACTCTACTGAGGGTGAGATAATGAGACT
CTGTCTCAAAAAAAATTTTTTTTTAGATGGGCTGGGCATGATGGCTCACACCTGCAGTCC
AGCACTCTGGAAGGCTGAGGGGGGTGGATTGCTTGAGCTCAAGAGTTCAAGACCAGCCTG
AGCAAGAGCAAGATCCCATCTCTACTAGAAATAGAAAAACTAGCCAGGTGTTGTGGGCAC
CTGTAGTCCCAGCTACTCAGAAGACCGAGGCCAGGAGTTGTGAGCTGTGACAACATGGCA
CCCTACTCAGGGCAACAGACTTGCCTCAAAAAAAGATTTGCGACATTTTTGGAGGTGGGC
ATTGAAGAGAATATTCATTTTTTTCTTTTAATCATTTTTTTCATCTGGTTGACAGCATTT
CCTGTATAGGCTGTGTTATGTGGGTAGGAGATAAAAATGTAGTTTTGCCTTATTTTTGTT
ATCGCAGTTACTAACCTTTTTCTACCATGGAATTGTCAAGCTTATGCATCAGGGTTGAGG
ATTCACATCTTCATATGTTTATGAGAGGGACCTGTGTTATTATATATGAAAACAACTTGG
TGCAAAGGCACTGCTTCTGGTAAAACTATAGCAAGGTGGCTGGGTGCCAGCAGAGGAATG
GTCCCAGATTAACTGTCACCGGAGAGTAGAGCCACAAATGATGTCCTCTCGGCCCAGGAT
CTACCCCTTGAAGTTTTATTCCCTATTAAGTTAAACAAAACTAAATGTGATAATGTCTAA
TATTTAGTTATTGTTAGCCAAATATGATCCAAGAAAGGAAGTGATTACCTCCTTTGAGTA
AATGTAACAATCTAAGTTTATACATTCTAATTGATGGCTACATAAATCAAGTGTGGAAAA
CATGTAGCACAAATTCAGAAGCCATGAAACAAAGTTGTTGGACATAGTAGTTGTGGANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGCTGCCGAATG
ATGACACCCACTAACTGAGCAGTCAGTAGTTGGTCCTTCGGTGCATTTGATGCAATAATT
GTTCCAGCGAGGGACTGATGCCGCGCGCGTCGAGTGAATACCTTATTAGTGAACTATTCT
GGTCAGTCTATACTAAAATCTGAAAAAATTTATTTTAGTACCAAACGATTCCCTGGTTAT
GATTCTGAAAGCAAGGAATTTAATGCTGAAGTACATCGGAAGCATATCATGGGACAGAAT
GTTGCAGATTATATGCGTTACCTAATGGAAGAAGATGAAGATGCTTACAAAAAACAGTTC
TCTCAATACATAAAGAACAACGTCACTCCAGACATGGTAAAAAATTTACCTAAAAATGCC
TGTATTGGTTAATTTATCCAAATGAGTTTACTCCTTGTTTTGTGAGGGAGTGGGTTATAT
TCTTATGTTGGGTGTATTTCAGATTAGCCGTTGAAAGGTGAATATGGGCATGTTAGGCTC
ACATGAGGTATTCTGGGCTTAAATTAGGATGGTCCTGGATTTGAGAGTAGGTCAACCTAC
TGAGCTGGACTTGTCAGTATGGTTTTAGGAATCTTAGATTCTGAAGCATGGCAGGCTTTG
ATGGTTCTGTAATTTTTTTGGAGATGGAGTCTCACTTTGTCACCCTTGGTCGTAGCTCAC
AGCAACCCTCAAACTCTTGGGCTCAAGCGATTCTCTTGCCTCAGTCTCTCAAGTAGCTGG
GACTACAGGTGCCTGCCACAACGCCCACCTATTTTAGAGATGAGGCCTGGCTCTTGCTTA
GGCTGGTCTCAAACCTGTGAGCTCAGGCAATCCATGTGCCTCTGCCTCCCAAGGACTGGG
ATTACAGGTGTGAGCCACTGTGCCAGGCTTTTTTTTTTTTTTTTTTTGAGAGAGAGAAAG
TCTCACTTGGTCAACCCCAGTAGAGTGCCATGGTGTCTTAGCCCATAGCAACTTCAAACT
TTCAAACTTTTGGGCCGAAGTGATTCTCTTGCCTCAGCCTCCTGGGTAGTTGGACTTACA
GGCCACAATGCCTGGCTAGTTTTTCTATTTTTAGTAGAGACGGGGTCTCACTCTTGCTCA
CTGTGGTCTGGAACTCCTGAGCTCAGGCAGTCCACCCACCTTGGCCTCCGAGAGTGCTAG
GATTACAGGTGTGAGCCACTGTGCCTGGCCAGTTTTGTATTTTTAGGTGTCATTCTTGTG
ATCACAGTTGTAATCTGCTTTGTTTGGTATGAGGTGCTAGATAATTGACTAATTTTGATG
CCATTGGGGTGCAGAGTTCCCAAAGTAAATATTCGCTCCATTTTGGACTTGTTGAGTGTC
TCAGGCATATACACAGAAAGGGAGGTATACATAGTCAATCATTAGTTTTGTATGATGCTG
TAGAAACAAGGGGAATGTTCTGCAAAAGTGAATTTGGCTAGGGTCAGTGGCTCACACACC
TGTATTCTCATCACTTTGGAGGCTGAGATACCCAGGAATTTGAGCCTACAGTGAGCTATG
ATCAGGCTGCTGTACTTTAGTTTGGGTAACAGAGTAAGACTCTGTCTCTTAAAAGAAATG
TGGTATAATTTATTGTCTCTAAAGTTGGATTTCTGGGATTACCTCTGTTAAGAGATTGAT
TCTGGGTATGGTGGCTCTTAACCTGTAATCCTTGAATTGTGGGAGACTGAGGTGGGAGGA
TCACTTGAGATCAGGAGTTTGAGACCAGCCTGAGCAAGAAGAGGGTCTTGTCTCTGCTAA
AAATAGAAAAAAGTGTCTGAGTGCCTATAGTGCCAGCTGCTTGGGAGGCTGAGGCAAGAG
GATCACTTGAACTCTTTGAGATTGCTGTGAGCTAGACTGATGCCAAGGCACTCTGGCCTG
GGCAACAAGTGAAATACTGTCTCTGAACAAAACAAAACATTGACGTAATTGGAGGTTATA
GTAACCAATTTTGAAATTGTAGTGAACATGTAGAACACAAATCAAGTTAAAAAGTAATTT
GGGAAAGATTACTTTCTCTCGTACATTTTGGATACCATTTAAGGCTGAATAAACAGCTTG
AGATAGGAAAAGAATTAAGGCGAGTTTTGTATTGGTAATATATATGCATGTTAACTTTCA
CTTGGTTATATTCGTTTATGTTACTGCTGACTTCATCCTGGTAAATAGTTCTTTCAACTT
TTAGGCTTTGGTTCCTCTTGCCCTGCAGAATTTTTCTTTCTCAGACATATCTTGATCTAG
TCATGATATATAGTACTCGATCAAAACTTGAAACTCCCTTTCTGTGCTTCCAGATATTTA
TTTCCTGTACACAAGTTGTACTTCTGCTAGACTGCTTTTTGGCTAAAGTATTTTTCTAGC
TAGCTCATTTTATTTATAATGGACTCTTTCTTCCTGTGTGCCTGCTGAAATCCTCTACAG
ACATCTGTTGTCTCTCCAGCAGGACTTGTAATGCCTGGATTTGTTGTTGAGGCAGAGAAA
TTAACTTTTTTTTTTTTTTTCTTTGAGACAGAGTCTTCCTCAGTCTCCCTGAGGTTGAGA
GGTGTGGCATCATAGCTCACAGCAACCTCAAACTCTTGGGCTCAAGTGATTCTCTTGCCT
CAGCCTCTTGAGTAACTGGGATTTGTATGGGTGCCCGACATAATGCCCAGCTATTTTAGA
AAAGAGATCTGACTGTTCGTCTCCCTCTTGGTCAGGCTGATCTCTAACTCTTGAGCTCAA
GCAATCTGCCCGCCTCAGCCTTCCAGAGTTTTGAGATTACAGGCATGAGCCATTGCACCT
GCCCAAGAAATTAACTTTTGTGTGTGTGACAGAGTCACACTGTGTTAACCTGAGTAGAGT
GCTATGGTGTCACAGCTCACAGCAACCTCAAACTCTTGGGCTTAAGCAATTCTCTTGCCT
CTGCCTCCCAAGTAGCTGGGACTACAGGTACCCACCACAACACCCAGCTATTTTTTGTTG
CAGTTGTTATTGTTGTTTGGCAGGCCCAGGCTGGGTCCAAACCTGCCAGCCTTGGTATAT
ATGGCCAGCACCCTAAACACTGCATCTTAATTTGCAAAGCATTGAGCTGTATCATGTACA
AATATTTCAACCCTGTGGGATAATAGTGGTGGTGGTTTGTTCTCTCAGTTCTTTTAAAAT
TTTCTTTTCTTGGCTCGGCGCCTGTGGCTCAACCGGCTAAGGCGCTAGCCACGTACACCT
AAGGTGGCGGGTTCGAATCCCCAGCCCGGACCCGCCAAACAACAATGATGGCTGCAACCA
AAAAATAGCCAGGCGTTGTGGGGGGCCACTGTCGTCCCCAGCTACTGGGGAGGCTGACGC
AGGAGACTCGCTTGAGCCCAGGAGTTGAAGTTTGCTGTGAGCGTGATGCCACAGCACTCT
ACCCAGGGGATAGCTTGAGGCTCGGTCTCAAAAAATAAATAAATAAAGCTACTGAAGAGA
AGCCTTTTCAGTCAAGGCTTGAGAGTCCAAGAGCACAGCAAAGAAGAGAAATATGCTAAA
GTGAGTCCTACCTTCTCAGCTACTTTTTTTCCAGAACATTATTGATTTCTCTCTGGGAGT
ATAGAAGCCAGAAAGAATCATCCTAGCACTTATGGCAGCCTTACTGTCCTGGAGATACAA
AATTTGGAGGTCAAGTCTATTAAGGCAGCTTGGTCTTAAGAAGCCAACATCTCAGAGAAA
GCAATCACAGTAAAAACAAGTCAATCACTCTCCATGCCATTTTCACTCAGAGCATTTGCT
GATTCCTAACCTGCATAAGCAAGGGGCACAAAGCCAAAAAAACAAGCAAAAAGCAATCAC
TGACAGAAAAGAAAATCTAAGCAGAAATCTTTGGCTGCCTTATGGTGCTGGAAAGAATTA
AATAAAAGGAAAGGATACTGGTAAATATCTACCAGACTTTCAGTTGAGATTCTTTCCTAA
GTACACCCTGAGAGTAAAAGAAAATCAGGAATAGCCTCAATAATGCTTAAAACACAACCT
TGAACTATCTCAATTCCTAGCGTGGTCAAAGTGATCTTCCCAAATTTTCTATCTACCAAA
GAACGCCAATCAGATGTTCTTTGGTGGAAGAGCCTTTATACACANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTCTTTCTGGTTCTAGGGGCCGTAAATATTGCTGTATACTAGGGACTGTTAGGA
GAAAGAGGTGGTCTTTAGTATGGAATACTGACAATCACTGTAAAACACCTGTCAAGCAAA
GATGGAAAATGTAATCTGGAGAATATGCGATGTCAAATAAATTTGGCTTTTTGGCCCCAG
TGTCACAGTCCTTAGTCTCAATTAGGCAGTATCAGTGTTGTGACCATCTTGACACTGTAT
ATATTCTTCATCTCAATGTCTGAAATATTTTTGTTTTGACATGGATCCTCCATTCAATGA
AAGAATTTAGACCAGATACTATTTTAAATAAACGGTGCAATGTGTCTTTCTGTAGAAGTA
AATTTGCTTTAGAGTGACTGGAGAAGTATGGCTGACTTCCTCAGGAATACATACACAGAT
TTTCTGTATTTTTATCTTTTTCTTAAGACAAGAGTCTCACTTGATCACTCCTGGTAGAGT
GTCATAATGTCTTAGCTCGCAGCAACTTCAAACTCTTGGGTTCAAGTGATCCTCTTGCCT
CAGCTTCCGAGGTAGCTGGGACTACAGGTGCCTGCCACAACGCCTGGCTGTATTTTAGAG
ACAGGGTCTCGTTTTGGCTCAGGTGGGTCTTGAACCTGTGAAGTCAGGCAATCTACCTGC
CTTGGCCTCCTAAGTACTGGGATTACATGTATGAGCCACCCTGCCCAGCTACAGATTTTT
CTTAAGACAGATGTGAATTTTGTGAATAATTCACATTGCATAAGGTAAAAATCAGGAATT
TGTTAGGAACATGTGGGTTACACTTAGAAATTTGGGTTCTAGGGTGGTTCCTGTGGCTCA
GTGAGTAGGGCGCTGGCCCCATATACAGAGGGTGGCAGGTTTGAACCTGGCCCGGGCCAA
ACTACAGCAAAAAAATAGCCAGGCGTTGTGGTAGGTGTCTGTAGTCAACAGCTACTCGGG
AGGCTGAGGCAAGAGAATTGCCTAAGCCCAGGAGCTGTAGATTGCTTGTGAGCTGTGATG
CTACAGCACTCTACTGAAGGCAACAAAGTGAGACTCTGTCCCCCCCTTCAAAAAAAAAGA
AATTTAGACACTAAACCAACATTGACTTAGTTTATCTCTTTTTGAGAATCTAGCTTACAA
GGACAAAATAAAGCTAGCATAATAGCTAAATTAATAAAGTAGGGCATATGAAATGAAACC
AAGTACTGTTTGCTTTCCTTTGTTTCAGATGGAGGAGATGTATAAGAAAGCTCATGCGGC
TATACGAGATAACCCAGTCTATGAGAAGAAGCCCAAGAGAGAAGTTAAAAAGAAGAGGTA
TGTGTCTTACTATTGTCTTTTCAAGAGAAATAAGTTGGGAGCAGTTCCCGTACTGCTTCA
TCTTCACATCTGTGAAGTCTCATCTGACTCTCAGAGAAGTTGTGCAAACTCGATCACTGG
GTCTGCATGATGTGGCAGGAGCTAAGGGAACCAGGTTTGCTAAAGTAATTATGGTGATAG
GAATGTATTACCTCAGATGTTACTGAGGTTGCCCATCTATCCTAGTACAGGATAAGTACC
ACTTACTGCCTTGTTTTACTGGCTACCTTAAGAAGAAAGTTACTTTTTGTTGATCTTTCA
TGGTTTATCTTTTCACTCTAGTTTGTGAGTTAGTCTCATTTTGTAGTCCTTGGTAGAATG
CCATGGCGTCACAGCTCACAGCAACCTCCAACTCTTGGGCTTATGCAATTCTTTTGCCTC
AGCCTCCCAAGTAGCTGGGACTACTTGGCTATTTTTTTTTTTTTCTTTTAAGAGACAGAG
TCTCACTTTGTTGCCCTTGGTAGAGTGCTGTGGCTTCACAGCTCACAGCAACCTGCAGCA
GCAGCTTAGGCAATTCTTCTGCCTCAGTCTCCTGAGTAGCTGGGACTATAGGTGCCCACT
ACAATGCCCGGCTACATTTTTGGTGTTGTTGCAGTTGTCATTGTTGCTTTAGCTGGCCTG
GGCTGGGTTCAAACCTGTCAGCCTCAGTGTATGTGGCTGGCACCTTACCCACTGAGTTAT
GGTGCCGCTGCCACCCCAGCCTTTAACCACCATTCCACAGGGTATCAAAAGTCAAACCTA
AAGTTGCTAAGTGTACCTTTATTTACAAAATACTCATTACAAAATTTTACAAAATGTTTG
CAAAATATTCTGTATGTCTTGATTACTTTTTTGTAATGAATATTTTGTAAGTAAAGTTAT
GTTTAGCTACAGTTTCTCATTTACCCTGTGTTGCATGGTGACTATAGGGGCAACTTTTAG
GACACTGTATTTNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2202..2271, 2355..2470, 3772..3906, 6370..6572, 7298..7475, 12628..12714
1001..1003, 2202..2271, 2355..2470, 3772..3906, 6370..6572, 7298..7475, 12628..12714
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved