Otolemur_garnettii Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii EEF1B2
Otolemur_garnettii
EEF1B2
GeneScaffold_149
SNORD51, SNORA41
2752..2830, 3120..3252
4778
TCGGGGGGGTCGGGGGAGGATGCTCAGTCTTTAGGCCTAGGTCACCTATAAACCTGCCT
CTTCCCGAGAGGGAAACGTCTTGCATTTTCTTGCAAAGGGAAGAAAATGCAAGCCTGCAT
TCGGACCAGCTTTGCCGGACCTCCTGGTCCTCTTCCTGCACTTTGTTTGGTCAGACCTGG
GATCATTGCTAACAGCCCTCACCTGCCGGTTCAGGGGATTCCGAGGCGGCGGAGCGGGGG
GGTGGCGCCCAGTCAAGGACGAGAGGAGAATGAGCTGCCTAGGCCAAAGGAAATAGTCTT
GTCAAGAAATAAACCGGTGTCCGAAGACCCCAGCCTTCACATCCAAACTCTACCTCACCT
TGTCGCTGGAGCCGCTCGGGTTCGGGGGCTAAACCTTCCGGACCACAACAACCCCCTCTG
AAACCGGGTCGTTCATTCAATATGGCGGCCTCAGCTTCGTCAGCCGGGCCTGAAGAACGG
AAAGCCAGAAGGGACTAGAACCTCAGATCGACAATTTTCCGATTAGGCTGAATTCGGCAA
TTTCCGTCAGCCTGCCAGAAGGCGGGGCGGGCGGCGGAGCGCAGGGAGGAGGCGGGGAGG
GCAACTTGAATCCGCAGTTCCGCCGGAAGTGGGCCGGAGCCCTGAGGCCGAACGTCTTCG
GTCGTCTCCGGCTTTCTAAGGGGCGATTCCCGTCATCTTCGGAAGCGGTGAAAATACGAA
CCTTAGGAAATGCCCCTTCTGTTAATTACTTAGAAACAGAACCGAAAAGTCCGGAACACT
TCTGGCCCGTTTAATTCAGAGCTTCTAATTTTTACGTGGGGGGACAATGCGAACGTGCTT
TGACCCTTTAACCCTCGGCCGGCGTGGTGGAGGGGAACGCCTCCGTCTCTATATAAGGAG
TTTTCCAGCCTGGTTGCGCCCTTTTTCTCTCTTAGCGCCGGGCGCTAACTCTTTGCACTC
TTTCATTCCGCTGCTGTCCGGCTCTCGGTATAGCCAGCATTATGGGTTTCGGAGACCTGA
AAAGCCCCGCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATTGAGG
GGTGAGCGGACAGGGCGGCGAGAGAGCGGCCTGGGCCGGGGCCACGTGGCGCGGCCTCCA
AAGGGGCAGGTGGAAAGCGCCGCTTTCCCGTCCCCAGGGGACCGGTGCCCTCCGAGTCTG
GCCCGGGTGAAGGGGCCTTCGAGGGGAGTTACCCTAAAGGCAGAGCTACGTTAGAGGTTA
CGATCTTTGGATCTGCTAAGTGGCCGGCATTACTCAGGATAGTGCAGCGACCCAAACAGA
TGGTCTCTGATTTTAAGGAGCTTATACAAACAACAACAAAAACCTAAAGCAGCTTAGGTA
ACCCTACCGGAGCTAGTTCCCGCTAATGAATGTAACAGATAACGCCGTTTGTCATTTATA
TGCTGATGTTTTTTAAAAGCGTATGTAATTTTTGTGTCTTCGTTAGGTATGTGCCATCAC
AAGCAGATGTGGCAGTGTTTGAAGCAGTCTCCGGTCCCCCACCTGCCGACTTGTGTCACG
CCTTACGTTGGTATAATCACATCAAGTCTTATGAAAAGGAAAAGGCCAGGTAAAATGATC
TTTGTATCTGAAGACCCACGCCTGCTGTGTGTGAAGTTTTGTCACTATTTTCACATTACA
AAATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTTCTTTTT
TTTTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCCG
TGGCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCAC
CTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACACCCGGCTATTTTTTGGTTGCAG
CCGTCATTGTTGTTTGGCCGGTCCGGGCTGGGGATTCGAACCCGCCACCTTAGGTGTACG
TGGCTGGCGCCTTAGCCGGTTGAGCCATAGGCGCCCGAGCCTCAAACAGAAATTTTCATA
CTGAAAGTAAATCATAGTGAGTATTGAATATAACCTCTGACCTGGTACTAATGTTTGTTG
GGTGAGAATATATAAAAGTATTTACCTGGGAGCGTGTGAAAGGGTAATTTTTACTACAGA
AGGGATCTGGTGGTAAATAGAGATGGAAACAAGTTTTCATGTATTGTCTAGAAAAGAACA
TTGTATCAACCTAATGGTGGCAAATTTGATTTATTTCAAGCCTGCCAGGAGTGAAGAAAG
CTTTGGGCAAGTACGGCCCTGCTGATGTGGAAGACACTACAGGAAATGGAGGGACAGATA
GTAAAGATGACGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGTATGACATCTTT
TAGAAGATTATAAATTGGTAGGCAGGATGTTGTGTGTAAGCATGGACCCCATAACCAAAT
TGGCTGGATTTGAGTACTAGCTTCACTTTTATCTGCCTTTTAAACATTCTCACTGGTTCC
ATGATGAATAAAATCAAATCACCATCTTTCGGCTGAGCTGGTGATGGATTTGCTTTTTTC
TGATAAAGCTGGTCTTTTTTGTGATGACCCTGCTAGCTGTAAATAGAACAACCAGCTTTT
TGAAATGTATTAAAATTTTTCTTTTCAGGAAAGTGAAGAAGCAAAAAGACTACGGGAAGA
ACGTCTTGCACAGTATGAATCAAAGAAAGCCAAAAGTAGGTCATTTTATAATTTGTATTT
AACTTCCTTTCATAGTAATGAGAGTAATCTTTTTTAAAACTTAGCCCCAGAGTAATTTCT
AACACACTTGTTGAATTAGGTCAGTATTTTAAAACATTATGTAGAGGTTCTTGATAAAAC
ATCCACAGCTACTGGTCTGCAGCTGTTCTTATGTAACAGTTGTGGCATTCCTCTGTGGGA
AAGAAACTGTTAACACAGTTAAATACCTCTTTCTTAGCAAAACAGAAAGTGGGTATACGT
GTGACAGACAGAAGATGTATTCTGCAGTTTTGTTTGGCTAAGGAGATGGACCATTTTAAA
ACAAATTGAGATTTATTGAGTGTCTTGAAATAGTGTGAAAAAATATGTGGTATTTGAATA
ATGTTTTTTTTTTGTTATTAGAACCTGCTCTTGTTGCCAAGTCTTCCATTTTATTAGATG
TGAAACCTTGGGATGATGAGACAGATATGGCAAAATTAGAGGAGTGTGTCAGAAGCATTC
AAGCAGACGGCTTGGTCTGGGGATCCTGTGAGTTTAGTCTTTGCTTTTTTTTTTTGAAAC
TGACGTCTGGAATTGATACACAGTTTTAACCTTGTCAATCAGTAGGACTTTTCTAACTAA
GATTTTTCTTCATGTTCTTTTTAGCTAAACTAGTTCCAGTGGGATATGGAATTAAAAAAC
TTCAAATACAGTGTGTAGTTGAAGATGACAAAGTAGGAACTGATATGCTGGAGGAACGGA
TCACTGCTTTTGAGGATTATGTGCAGTCTATGGACGTGGCTGCTTTCAACAAGATCTGAG
ATCCATCTGCACTTAAAATAAAAGCTTGAAAGATAACCCTTGTCTTTTGAATCTGTTTGA
TGGGGGTTATATATATTCCTTTCGTTTTGAGGGAAAGTAATAGATATGTAATTCCTAAGG
AAGTAACAATTTGGTTCTGTATTCTTGTTGGACATTTAGCAATTACAGTGCAATTCTGTG
CTCTTCGTGATCCCTCGGCATAATGCTGGTGATGTTATTTGTTTTAACCCAGTGTTGCCG
TTGACTAAAAAATAAGTCTGATTCTCCCTTAAAAATGTTAGCCATTAGGAAATAAGGAAA
TGATAATGATACTAGAGGCAACTTCATCCAGGGGAAGGAAATTATGTTAAGGACAGCTCC
CCAGACTACATCATGAATTATAACCACTTATTAACATAAATGTTGCAAATTTAAAGTTAA
AGGTCTTTGTGTAAAGGTAAAACTTAAATGTAAATGTTGGCACTGTGATGAAGTAGCACG
TCCAGGGTGGGGGGAGGTGATTGTGTAGGTTAACAGTTACTTCCCAGATAAACTTCACTT
TGCTGTGAGGGTTCAGAAGGTACTTGTGTACGGAGGTAGGATACTTAGCTTGAATCTGGA
AACCTGATAAACCCCAGTGCTGCAAGTAAATACTGAGGTGAGGTTAGTTAAGTGATACTC
AAAGTTACTATGCCTTGGAAGCAGCTGCATCTTAACAATTGGGAATATATCTAACATTCT
TTTTTTTTACACTATTTGCAAAATTACAATACAGAAATTGCCAATATCTAAAGGTCTGTC
ATATTTTGTAAATAAGGGCTAAAGATACTAAATGATTTGTTTTAGATCAATTTAATCATA
GGATAAGGTTATTTCCTTTCAATCTGATTTTATGTTGTGACTACCCTGAATATGGGAAAC
TGGTTTGGTTATAAAGATAAGGCTGGGTGCCATGGATTACAGGATCCCTGTAATCCTAGC
ACTTTGAGAAGTTGATGTAAGAACATTTGAGGCCAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1486..1608, 2500..2626, 2908..2974, 3381..3506, 3624..3778
1001..1080, 1486..1608, 2500..2626, 2908..2974, 3381..3506, 3624..3775
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved