Otolemur_garnettii Locus ENSOGAG00000014027
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000014027
Otolemur_garnettii
ENSOGAG00000014027
GeneScaffold_2965
SNORD24, SNORD36, SNORD36, SNORD36
1251..1325, 2247..2320, 2674..2750, 2975..3041
4457
ACCCGTCGCTCCTCCCGCCCCGCTGCAGGGACAGGGTCTTAAGGACATCATTCCTCCGC
TTACTGGCCGCCCCTGGGCCCCTCTGCCCTCTCAGCAGCCCCCCCACCGCACCCCAACGC
GCTGCCCTCTGGCTTTCACCCCCGACCTGCCCTGCAGCCTGTTTTCGGCCTGGGACCCAA
CCCGCAGAGCCGCTCGCTAGGAGCAGGAGAACAGTTGAACCAACCCTTTGTGTTCTCTCC
GCGCCAGTGTTTTGAGGGGAGGGAAAGTCGCACTTAAGAGAAGCCACCCCTGCTCGGGAA
GCCTGAGTATCCCAAGCGCGTGTCTGCAAGGCCAGATAGAGCGCCGAGACCAGCACTCCC
AAGTTTGCACTTACCGGCGTCGCTCACCAGGCCGGACAGAAGTCGCAGTCTTCTCCCCGC
CCTATCCTTCCGGCTGCACCGCCGCTAGCGACTCGGTCCCCAACTTTACGATTTAAAGGA
AATCTGTCACTTTAAATCTGAAATCCCGCGCAGGCCCTAGTTCTCGCGATCTCCAAGGCC
TCTTACATATTACCCACAATTCCTTAGCCTTTCTCTCTGCTCCAGCGGCTCAAGATGGTG
AGTGTGCTTTAGTTGTGCAATATTGGCATCGAGTTGCAGCTCTATCCGCTGCCATCCTTA
TCCGGGTGGCTCCGCGCAGGGCTACTTTTTCCGCCCAGGGGTATGGTAGCCCCATCGGGT
CTGGTACGGAGGCATCGGGCTGCGCTGGAAGCTGTGGCGGCCGGGAGCGGGGGGGTTCTG
GCTTCCGTGCCGCCAGGCCTGGGAAGGAGAGCTGGGGAGCGCGGCGTCGCCGTGTAGACT
CGCGGTGGACGGGATTGAGGCGCTCGAAGACAAACACGTTTTTGCTGAGATTGCCGGCAA
GGGCGGCCCCGGGCTGCCTGTTCTGTCACCTTTGGAGGGGGAGTCCACTCTGAATTCCCG
AGAAGAGGCGGTCGCTTGACAGGGATTTTCTTTGTTCCCAGCCGAAAGGAAAGAAGGCCA
AGGGGAAGAAGGTGGCCCCGGCCCCCGCCGTAGTGAAGAAGCAGGAGGCCAAGAAGGTAG
TGAATCCTCTGTTCGAGAAAAGGCCGAAGAACTTTGGCATTGGTGAGTGCGAGGGGGGCA
GCGCGGTCTGCCTAGGGCGCTCTGGGAGGTCTGGGGTCGAGCCCGTCGGCCCTGCCGGCT
CGGAGCGGCGGCGCCGCATACCCTGTACCGCCCTGGCTGCGGGTGTTTGTGTGCAGATGA
TGTGAGAGAATATTTGCTATCTGCGCAATGGTGATGACATCTTAAACCACCAAGATCGCT
GATGCACCATTCCCGTTGAGAGTGGCGCTAACCACGCACTTGACAGCGTTCTGCGCCACG
CTCATGGTGCTGACCTTACTCCTCAGGGCAGGACATCCAGCCCAAGAGGGACCTCACTCG
CTTTGTCAAATGGCCCCGCTACATCCGGTTGCAGCGGCAAAGAGCCATCCTCTACAAGCG
GCTGAAAGTACCTCCCGCCATTAATCAGTTCACCCAGGCCTTGGACCGCCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTACACTGAGGGGTGTGGATCTGAACTTCAACTAAAGCCTAACCCAAAGTAT
TTTCATAGCCACTCAGCTGCTTAAACTGGCCCACAAGTACAGACCAGAAACAAAGCAAGA
GAAGAAGCAGCGACTGTTGGCCCGGGCTGAGAAGAAAGCTGCGGGCAAAGGGGATGTCCC
CACTAAGAGACCACCTGTCCTTAGAGCAGGTGAGTGGGTGCCTCCCTTGGGAGGGGAGGG
AGGAGGTGTGAACTGTGGGGCAGGCTGCTGCAATGATGTACAAATGTCTTCACCTGAAAT
CACTGTGGAGAGTAAAATCGAGCTTTTTAACACTGAGTCACAGCTGGGCCCACATGGCCA
CAACTGTTTTGTGACCAGAGCAGCTCCCACAAGTGCTCATGCAGAGTGGCTATTTGTGTT
CTAGGGGTTAATACTGTCACCACATTGGTGGAGAACAAGAAGGCTCAGCTGGTGGTGATT
GCACATGATGTGGATCCCATTGAGGTACTTGTGGCACTGCTTTAGTACTGTGTGTGTTGA
ACTCAGGGTCTCTGTCCTCTGTTAAGCTAGAGACCCTGCCTAGAAGATGGGGTAGGTTTA
ATGCTGAGTCTGGCATGGGGCAGGTGATCAGGACAGTTAGTTGCCAGTTTATTTGAGGAC
AGTACTGGCAAGGGACTTAACTTGGATGTGGTTCTTGCAATGGTGTAAATCTCTCACTGA
ATTAATTACCCTGTGAAGTGCAAATATGTGAGCTTTTAAACCCTGAACATCACTTGAATG
TGGTCCCCAGCTAACACTTTGTTACAGCTGGTTGTCTTCCTGCCTGCCCTGTGTCGGAAG
ATGGGGGTCCCTTACTGCATTATCAAGGGGAAGGCCAGGCTGGGGCGTCTCGTCCACAGG
AAAACCTGCACCACTGTGGCCTTCACGCAGGTTAACTCGTAAGTATGTGACCCCAGATTC
CAGTTCGCCTAAAGCATCCCTCAGGTTTAGAGACTTTGCCAATGATGGTTAAGAATTTCT
TCACCTGAATAAACTATGTGGTCACTTCGTATCTGAGGCAAAAGGCCATTTTGAGCTAAA
AATGGAGGCATTTTCCTTCTAGAAGGGGCACTAAGAGGCCAAAATGCCATGTTTCCTTCC
CTTGCTCTGTTAGGGAAGACAAAGGAGCTCTAGCTAAGCTGGTGGAAGCCATCAGGACCA
ATTACAACGACAGATACGACGAGGTAAGAAGCAAGAGGCAGTTTTACACAAAGTACTATC
ATTTTTCCCCCCAAACTGGCTCTTATCCTGTGATAGCCAGATAGGAAAGTAACGTGCTTT
GAAAATCTCCAAAAATGACAGGTCAGGCTGAACTGCTGCCTCTTCTGTTTCAGATCCGCC
GTCACTGGGGAGGCAATGTCCTGGGTCCGAAGTCTGTGGCTCGCATTGCCAAGCTGGAAA
AGGCTAAGGCTAAAGAACTTGCCACTAAACTGGGCTAAACGTACACTGTTGAGTTTTCTG
TACATAAAAATAATAAATATTCAAGCCAACAACAACAAAAAAGGACATCAGGCTTGTGAG
CTCTGCTTCTGTTACTCAGTTCTCTCACTATGCTCAAGACGTGGCATCAGCTTGTGAATG
TATGTATGCGTCCATGTTTTGTCCATGGTTTCCGCCTCGCAAGGCCCGCAGACACTCTGG
TTTTTGGTTGTTGGGTGCCGTAGGCCTCGGGAGACAGGATCTCTCTCTGGCCTCTGTTCT
TTCACTCGCCCGAGGTGGGTCATAAGACCCCCATTCCCAAGAGGGTCCTGCCTCTCCCCT
GGGAGACGGCATCTGAGCTTCAGGACTTGGTGGTCTCATCATATCATACTCTTTCTTTCC
AGCCGCTTTCCACACGGTTGTCTGTTCCTCAGTCACACCTGTCCAGTGACGTCTCTGTGA
AAGGCCCAAGAGCACAGGGTCCCAGAGCTTCCCTGAGAGGGCATGGAGGCTCTGCGCCCC
TCCCCATCTCTCCCATCTGTGTCCTTTGTGACACCCTTTATTGTAAACTGGTAAATACAT
TTCCTTGAATTTTCTGAGCTGCTCCAACATGTGAAAGCCAGAGAGGGGTTCATGGGAGCC
CCAGCTTAAAGCCAGCCAGGGAGACATGGGTAGTATCTAGGGGGTGGTCTTGTGGGACTG
AGCCTCTCTCTGTGGGATCTGACACCACCTGGGTGGTGCTGGAATTGAATTAGAGGACAC
CAGCTGGTGTCTGCTGCATAATTGTTTGTTGCTGGGTAGGGAGAAGACTCCACATATTTG
GGGATCACAGAATTTTTCCTTGTTTGTGAGACCAGAGGAAAATCATGGTTTGGTTTTTCC
CAGCATAGGCCTGCTGTGTTTTGAAAACACTCCAGCAAGGGTGGCGCCTGTGGCTCAAGG
AGTAGGACACTGGCCCTATATACCAGGGGTGGCAGGTTAAAGCCTGGCCCTGGCCAAAAA
CTGCAACAACAAAAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 1406..1555, 2048..2188, 2404..2483, 2787..2917, 3133..3202, 3353..3457
1001..1121, 1406..1555, 2048..2188, 2404..2483, 2787..2917, 3133..3202, 3353..3454
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved