Otolemur_garnettii Locus ENSOGAG00000007634
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000007634
Otolemur_garnettii
ENSOGAG00000007634
GeneScaffold_2810
SNORD73
6790..6855
8478
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGCTAGAGACTGGA
GGATTTAGATTTAAAGCTGTTAGAGTGGTTTCTGGGTGGTCACAGGGTTTTTGCTGAGGG
AAGTTAGAGCAGGGAAGTCACACACTCTGGCTGAGTACCAAGCCCTCTAAGGGTCAGGTG
CTTTCCATCTGCACACTTAACAGGCCACATCTCGCCAGGATGTGCTCTGTTATACCCTCA
CAGTTAAAAGAAATATTTTGAGTGGCTTGGGTACAAAACTAAAACTTTTACAGAGATTGC
ACTCCACTTTCTAAAAAGATCTTTTTATCCATGTGTAACAGGCATACGGGAAAGTACACA
AATACACATACAGCTTGATGAGTATTCACACACAAAAAGCTTTTACTATTATACAAAACG
CTACCTGAGATTAATAACCAGCACCCACATCTACAAGGAGAATACTACTAGCGTCCCTGT
TGTTACGCTTACTTAATCCTACTAACAGTCGTATCACTAAGCCCACTGTACATATTAAGA
AACTTAAGGGCAGAGAGGTCACAGGCAAAGTATTGCTGAAACAAGCATTTGAACCCGGCT
CCTATGACTGCAAAGCTCATGCTCTCGAGAATAAACAAGTTTGAGGGTTAGACAAAGAGT
TCAACTTTGAACGACGTGAGCGGGCGTGTGCTCCTAATAGACACTTACTTACGTCAGAGC
CACCGAAGTCGCACGTAACCAGACGCCGGCCCCTCGGGCCACTTACGCACTCTATTCAGA
GCTCAGCCTCCCGGGGAGCCCGCGACGTGCTACGCGGCCTCCCCACACACGAGGGCGCTG
TGTCATGTACAGTACGAGGAGTGTCGCTCTCTGTTGTCGCGATATTCTTGCGGCCGGAAT
GGCGAAAGAGTAAAGGTCACGTAGACGGCGCGCCCCCGACCCGTACTCGTAAGTTCTCGC
GCGAGTTACACTTCCGCCCTTTTGGCTCGCTGAGCACCGTCATGGCGGTCGGCAAGAACA
AGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGTAAGTGGCGACTGTCG
TGTATCCCTCCTTCTTGGGATCCTGCTAGGGTCTGCGGCCTGGTTCTAGGTCGTGGCCTG
GGCCGGATGGCGAGGATGCCGGTCGGATTGTGCTGGCCGTGGCGGGTTGGTGTTTCCAGG
AACGCGGCCTGTCAGGTGTGGGTGCTGTGTCGCGGGGTGTCGCCTGCCTCTTCTGTGGAT
TCTGGTCCTTGGCACGTGTCGCGTTTGAGCCAGATTGCCGGCGCCAATGATGCCTGGGTT
CTGTGTTGTGGATTCGCTGGGCCGTCTAAGTTCCGCGGGCTTTTGCTGCAGCTTTAGGAA
CAGTCCTTGCCCATGCCAAACCCTGCACGCTGTCTCTGCTTGGGTCCCGTGGAACCCGGC
AGCTCCCAGTAGGCTCGCCTGAGGTCCAGAAGAGTTTTAGTTACCAGTGTGTACTTCCAT
ATACCCGTGAAGTTCCCGAGACTGCGTGCAGTTAAAGGACCGATGAGGATTGGGAGCGAG
CAAAACTTATTTTCAGAGTGTACGGTCTATGCAGTGAAGAGTGGGAAGAGCTAAATTTAC
ATATGCACTCCAAACCTCACTGTGAGAGAAGTAGTTAAATCCAGTCTCGAATGGCCTGTT
AGTCTTTTAAAATTTAGGGAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCATTTTTTTTCAAATTTTAGGGTGATC
CATTTTCTAAGAAAGATTGGTATGATGTGAAAGCACCTGCTATGTTCAATATAAGAAATA
TTGGGAAAACACTAGTCACCAGGACGCAAGGAGCCAGTGAGTATAAATTGGGGGATACAT
ATCAGCCAGCATCTTGGCCTGCTTTGGATCCTGTTGGGAGACTTTAAGGCTTGCCTTTGT
ACTTGTGGTGCTTGCTCTTGGTACAGTACTGTGGAAGCAAGGTAGAGCTTTTAGATTATT
AAGAAAATGTGTAGTAGTTTTTAGCTGCTAATGAGTTACTGGCATCTAGATCCTCAATTT
CTGACCTTAATTTACATGTATGATTTTGTAGGCTTGTCTTTACTATGTGGTTCTTATTGT
TAGTAAGACATTTGATTCTTGTTTTGTAGAAATTGCATCTGATGGCCTCAAAGGTCGTGT
GTTTGAAGTGAGTCTTGCTGATCTGCAGAATGATGAAGTTGCATTTAGAAAATTCAAGCT
GATTACTGAAGATGTTCAGGGCAAAAACTGCCTGACTAACTTCCATGGCATGGATCTTAC
CCGTGACAAAATGTGTTCTATGGTTAAAAAATGGCAGGTGAGACCAGAAGACATAGTGCT
ATAAAGTGTGTGACCCAGGATGTCACGGTGTGATGACAGAAAGAAGCATGTTGTGTAATT
GTGGTTGAGTTTCATCTTAAATCCCTGATTGTTTTCTTTGTATCGCTGAGTGCTTATTTT
GGGGTTGGTAAACTGTGATCTTCCCATTTTGCTTACCGCTTTAAATTCAAGATTTAATAC
TGGGTTATTAAGTCAGGATTTTTTGCTTCTGGGATTAGTGCTATTTTGAGGAACATTTAG
GTGTAGTTGGGCAGTTTTGCCTATCTTCAGAATATCTTTGAACCTCAAAACCTGTAGTGA
GTTTATGGTGAAAGAGTCTTTGGTTATCTTTGGCAATAGAGCATAATAGTGGCAGAGCAT
TTGGTGTGAGATTGAAATCTTGGCTCCATTTCTCAATTGGATTGAGAGTAACTTAAGCTT
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGACTTGGTATTTATTAATTGGATGTGAAGGATA
GAATTTGGGAGTAACTTGGTAAGTTTACTTTAAGGAAGGTAATTCTACAAACCGGATACT
TACTGGACTACTTATATTGCATAATGAATATTTGACATTGCAGCTTTTCAGAATTACAAC
TTGAGGGATAATATTAAGACCTGTTATGTCTAACAGTATCTTTTTTCCCTAGACTATGAT
TGAAGCTCATGTTGATGTTAAGACTACCGATGGTTATTTGCTTCGTCTGTTCTGTGTTGG
TTTTACTAAAAAACGCAACAATCAGATACGGAAGACCTCTTATGCCCAGCACCAACAGGT
TCGCCAAATCCGGAAGAAAATGATGGAAATCATGACCAGAGAGGTGCAGACAAACGACTT
GAAAGAAGTTGTCAATAAATTGTAAGTGTTTCTTTCCTTCCTCACACAATAGGACTCTGA
ATATTTGATGATCCCTCTGATGAGAGAAAGCATGTGGTACAGGGTGGGGCCATATCACTG
TACATGAGTGTTAACGTGTGTCAGTAAATGGAATATAATGACTATATATATATATTTTTT
GGATGATGCTATCTCATAGCAGATAGACTTGCATAGAAAATGTGTTTGCTTTAATTAAAA
AATAACACTGAAAAAAATACCAAAAAGCAAATGCTGAATAGACAAAACCTTGCGTGATTA
AATGCATGGGCATAAGTGATGAAAAAAGTTTCGGTCCCAGATGATGTCCGATGATAACTT
ACATTTTTCTGATATTCCCATGCATTACATAGTAGGCTAAGAGGGTGTAATGAAAAAAGT
AAGGCCAGACTATTACATGAGGGCTTGTGTGGGATAAGGAGGTAGGTGTTATTGTTTGTA
GTTTATTCTAAGGCTTCTGTTTAAAGGGAATGGCTTATCTCCTTACAACTGAGAATGAGG
ACTTTTCAAGAAATATTAATTTCTGGCATTATTGGCTGTTTTCAGGATTCCAGATAGCAT
TGGAAAAGACATAGAAAAGGCATGCCAGTCTATTTATCCTCTCCATGATGTCTTCGTTAG
AAAAGTAAAAATGCTGAAGAAACCCAAGTTTGAGTGTAAGTAACAAATTGTAGAATTCCT
TAAAGAAAAAAATGTGGAGCCAGATACATTGTGGAGGGGTGTTTTTTTCTCTTGACCTTT
GTATCAGTCTTTTTTTCTCCCTGTCATGACTGTGGGATTGAAGGCAATTGTTTCAAGATA
CAATGCTATAACTAATAAAGTTTTTTCTTCCTTTTAGTGGGAAAACTCATGGAGCTTCAT
GGTGAAGGTAGTAGTTCTGGAAAAGCTACTGGGGACGAGACAGGTGCTAAAGTTGAACGA
GCTGATGGATATGAACCACCAGTCCAAGAATCCGTCTAAAATTCAGGCTTTTAATAATGA
CAAATAAAGAATCCTATTTGTGATTTTTTTCCCTGAACATTCTTTTTAAATAGTCTTGAC
AGAATCAAGAATCAGACACTATGATATGATAGTAAACTTTTCTGTCCTATTGTGTAGATT
TTATTAAGTAGTTGAAAAGGGCTCCTGTTCACGATTTTAAGCTGTAGTGATCTGGAAGTG
TTTATATAAATGGTTCATGAAAGGTGAAATGCTTTACTATATGCTTTAACATTTTGATGG
TTCTCAAATCATCTGGAAGGCCTGTTGGGCTCTGACCTTGGAGTTTCTGATTCAGTAGTT
CTGGGGGAGGCCTGAAAGTTTGCATTTCTAAGAAGTTTTTAGGTGATGCTGATGATCCAG
AGATTACTACTATTTGGAGAACCAGTGTGTTGAACTGAGTAATAGAAAGGGAAGAGCCCA
CTGGCTTTTAGGGTTTTTTTATTACTCTAAATTATACCTTTTGCCTCCAGCTATTTTTTA
GCAAATTGCATAGATAAATGGATATAAACATACTACTTTGCACCTATACTGCAGCTAAAT
TTGTCAAGAGAAACTGGTTGCTAGTCTATTACCAGTTGGGCATGTGCTGTTGCCCACCTC
TAGTCACCCATTTTGAATCTTCACCTCAAACCTTCCAATTTCTCATTCCTTGCTCAGCTG
ATGACTTTATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 2992..3095, 3389..3576, 6292..6500, 7065..7174, 7357..7478
1001..1062, 2992..3095, 3389..3576, 6292..6500, 7065..7174, 7357..7475
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved