Otolemur_garnettii Locus MRPL3
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii MRPL3
Otolemur_garnettii
MRPL3
GeneScaffold_132
SNORA58
17654..17789
39860
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAGAG
TACATTACAACCTGATTCCACAGATGTAAAGTTTAAAGCAGGCAGTATAATACATTATTA
AACCAATACTTTCAAAGGTAGTTATTATTAAAAAAAAATATGAGCATGTAAACGTGAAAC
ATGTGAACGTGAAAAGGAGTGATTCTCAAACTTTATTTAGCCTTGTAATCATCTGGAGGG
CTATAAAACACAAAGATTCTGATTCAGTAGCTCTGGATTGGGGCCTGGGAATCTGCATTT
TTACCAAGTTCCCAAGGGATGCTTGTCTGGGGACCACACTTTGAGAACTCGTGTTCTAAC
GTAAAAACATGGATTGGAAAAACACATAGAGGCTCGTGCAGTTCTATTTCTTGGTCTGGA
TAGTGGTAGTGTGCATATTTTCTTTACAAAAATTCATTTTGTTACATATTTTATGTTTTG
TGTACTTTTTTGTATTTGGTTTTTTTTAAGGTTTATTTATTTTGCAGTTTTTGGCCAGGG
CTGGGTTTGAACCCACCACCTCTGGTATATGAGGCCTGCACCCTACTCCTTGAGCCACAG
GCACCACCCTAAGGATTTATTTATATACAGTAGAGCCTCCACAGTTCACCACCTCCTTAA
GTGGACTTAATTTTCATCGACCAGACATGCACCACATATATGTATCAGTACTAGGCCTAG
TTCCTTCTGTCGACCACCTCTGAATGTTGACAAGTTTGTTACAGGTCGCTTGGGTGGCAA
CTTATAGAGGCTCTACTGTATTTTAAGAGTGTGGTTGCTTTTCGAGGGATGGTATTAAGA
CTTTAGAGAATTCCTAATTGTCCCAGGGTTTTAAGTGGCTTGTGTGTAGTGTTAAAATAT
ATCTTGGCACATGCTTACTTTTTTTGTGTTTGCTTGTTCAGGTACAAGACTGTCATGTTT
TAAAATACACTTCAAAGGAAAGCCATAATGGAAAAATGGCAGCCCTACACGTAGGAGGAA
AAACCGTATCACGTTTCCATGTAAGGATGTATTCTCATTGGTTTCAGATCTGAATGCTTT
TATGTTTTGAGAATATTCCACAGCCACAAACTTGCGTTTGTCTATGTAGTAAATTGTATA
TTTGGGAGCAGCCGTCTAGCTGAGCCATTTTGCACAGGAGAATAAAAGACTTAGTTTGTT
ATGGTACCTCCCCTTGCGTCTGTAACAAGTAACTTTGCCTCTTTTAAGTTATAGCGTTTT
TAACATCTATAAAATAGAATAAAAATACTACTTACTTATTAGGTTTATCACAGGATGAAA
TAAGGGTTTCCAGGTAGGCCCAGAATGTAATACACTCAGTACATTTCCTTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
TGAAGACAGTTATTGCAAATATTAAGAATAAGGCTTCCTCTTGCATATTATAGCTCTTGG
GTGGGGAAACTGCTAATAGATTGATCATAGAGGATTATTTTTTAACAAGACCTATGAATG
TAAAATTCCAAATAACCCAAACATTTGGAAAAAATTGATTAAAACAGTTTTAATTACAAT
GGGTCTAGACTGTTAATTTTTTTTATCTGTAAGAAATTTATGCCTCTAAGAAATTAGACT
ATTTCACCTTTGCTATCTTGTATTATTATAAATAAAAACAGATGTGGTACATGGTGTTTT
TGAATGAGGAGGTTAAGTGGCCTTGTAGTTGATTAAATCAATTCATCTTAGGAGCAGAGA
AGCATTTTCATTGTGGGAAGGATAATTGTAGAGAACTTTGAAGAGGGAGAAAAGAATGCA
ACCTCATAGATGGGATTATCCAAGTGTGACAATGCTGTCAGTCTTTTAAATTGCTTTTTG
AAATCATTATGAATTTGAGAGTTTAGAAAAGAGGGAAAAAGCCCACCTCTTTTACATAGT
TTCTTGTTTAAACTCAACTTGAGCATTTGGTTTTTCTCATGACTGAGACCTAATTTTATA
ATACTTTGATTTTTTTTAAAAAAAATAAGCATTCAGTATTAGTGAAACTGGAAGGTAATC
AAGTAGTAAATGTTGCCTTAGTCCTTCTTATGCTTCAGTCTAAAAGTTACTTGGGTCAAG
ATGCTTATTTGTCTGTTTTATATTACTAAAAAAAATGAAGGATTTTTCTCAGAAACTTCC
TAGTATACTTTAAAGACTGGTATTTAAAAAATGCTATGCTTTATTAAGAATTTTATGAAC
GTTAAAAATCTGAAAATCCATTCTAAGCTGAATGTAGTACCTCAGGAAAATAATTTCAAG
GAACCACACTGATAAATAAAAATGTTGTGTCCTTGTTGTGGACAAAGTATAATTGAAAAG
GAAAAGCAAGGGCCTTGGGAGGAATGGTATTGGGTCTTAGTTTTAGATTTCAGTGTGTCG
GAAGTGAAGCCATAGGAAACAGTTGGAATGAATTTATATTAGGACTTCTGGAGGAAATGA
TAGCTTCTTGACAGACCTTCATGAGATACAAAACAATCTGAGTGGACATCAGAGCAGAGC
TTCTCAGTATTTGTCGTATAGCCCTGCTAGAGAACCTCAGGGAGATTAGAAAATCAGAGT
TCTATGTCTGCAGGCCCATTGCCACCCAATTTCAGGTCAACTAAAGAACATAGGTTTCCC
TACCCCTGGGAAAGAGTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTAAACCGCTTC
TGCTTCTGCTCAGCAGCTACATTTGGGTAAGGCTGGTGATGAGATGAGTTGCTGTTGCAT
AGAAAATAAACTATAAAAAATGTACATTATGACAGGAGGTGATAAGTGCTTTGAGGAATC
AGAACAGGCTGAGGAGATATCTAATGGAGTCTGAATAATATTGTGGAGTCAGTCATGCAA
AAGTGTGAGAGAATAGCACTCCAGGCAGAGGAGAGAGTACATGCAAAGTTCCTGAGACTG
ATGTTTGTGTTCTTGAGCCAGAGGGAAGGTAGAGGATGAGTTCAGATTGCCTTGTAAACC
TTGGCAAGGACTTAGAATTTAGGACTTTTTTCTGCTTGAGATAGAATATCATACAGCCTG
AATTTTAAATGATCATGCCAGACTATGAACTGAGAACAGGGAGTCTGGGGTGTGGAAGGT
TAGAGACTGGTTAGGAGGCTACTGGAATAATCCAGGCAAAAAGTGGTTGGGATTGGGGTG
GAGGGGGAGAAAGTGGATGGTGTGGGCTGTATTTTTAAATAAACTATATGAATTACAGAT
GGATGGGATAGGAAGAGTCAAGGGTGACTGTAAGATTTTTGGTTTAAACAACTGAAGTGT
GGAGTTACCTTTTGTTGAGATTTGGAGGCCAAGGGAAAGCAAGTTTGAGAGGGGTGGGGA
GTTGAGTTCACTTTAGACATGTTAAGCTTGAGCCGCTGTGTGGCACTGAAGTGGAGATAA
TGAATTGGCCGAGTACAATGTGGAAAAGTTACAAGAATAGTACTAGAAGCCAGTTGAAAG
TTTTTCAAGAAAAAAGCGGTCATCTATCTCAAGCATTGAGTATTGACTAGATCCAAGCAA
ATGAGTATTGACTAGTATACTTGACAATGTAGAGAATATTGCTGATTTTGACAAGTACTT
TTCATTAAATGGTAGAAGCTAAAAGTACCTGATTAAAGTGGGTACAGGGAATGGGAAGAA
AGAAAGTAGACTCAGAAAGTCTTTCAAGGAGCTTTGCTCTAAGGGAAAGCAGAAAATTTA
GCTGAAGAATTTGGAGATCAGGGAAAAGTTTTGTTTCAATATGTGAGTTAATGTCACATG
TTCTTATACTGATAGGAGAGTTCCAACAAAAGTGTAGCGATTGATGATTTTTAAAAGAAT
GAGACAGTTTTAGCAGGAAGGCCTTTGAATAGGTGAGAGACAAGTGGGAATCAGGGCTTT
TACGAAGAGTTGGAACAGTTTATCTGTCAACGTGATTCCCACTCCCAGTTTGACCATTGG
AATCATGAGGCGATTAAAAAAAATGCTAATGCTTGAGTCTCAGCCTAGACTAGTGAGATT
ATAATCTCCAAGCAGAGAGCCTGTCATTAGCAATTTCTAAAAGCTTCCCATGTGCTGTCA
TGTGTAACCTTGAATTTGATAGGAGTATAACAGTATATGGGTGCTGGTTATAGACAGTTT
GATTGACTTGGTGATGAGAGCATGGAGTTCTCTTGATTTTTCTATTTGATCAGCTCAGAT
GGAAGCGGGCAAGCATTGCTGAAGGTTTTACGAGAGGGTATGATATAGTTGCCTTGGATA
GTGTGAGAAGGATTTAACTGGAGAAGTGTAGGTTGGCCAGGCCACATTTGGGACTCCCTT
TGAAGTTTGTAGTCATAACATTTAATTGTGACCCATCCTGCTTTCTTCCACTTGCTTTAG
AAGTAAGTGCAGAGGAGGCAGAGAATGGGTTTCATGGGGTTGGGTTCTTGATGCAGTTCC
CAGTCAGAATTGAAACATGAGTACAACTCTTTATTTCTTTTCCTCCAGAACAAACATCTT
TCTTTCCCAGTGTAACACATTTGAAATACTATGTACATGGGTGGATCTTATTTGTTCATA
GAGATGTAATGGATTATAGCTATAAATCTCATCTCTTAAATAAAGGGAATTAGGTGATCT
TTATTCAGTAAGTGAATTGAGTGTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCGTCCAGGACAGTAT
GTGACGTCACAGCCAAAACGTAAGTCCTCTTGACAGGTTCTCTTTTCCTTGTGTTTCCCA
TCTGTTCAGAACAGTGAAGAGGAACAGTCTTTCAAGTCAGTGAATAAAGGATAAGTGCAG
TTACTAACTGTACTGGTTTTAAAATTGCACTAAATTAGTTGTATGTGAAGAGTTCACATC
AGGTTATAGCTATTAAACTGACATATGTGCTTCTTGAAATGGGGCTGAGAGAAAAGTCAC
TTTACTTAGGTACTTTGTGAATTGGCCCTTTGAAGACCAAAGACAACAAAGTTTGATGGA
GATATTTAGATCTTTGGGAAATAGTTTTTCAGAAATTACTGTAAGTCACCTCACTGTGAA
ATGAAGTAAGCAAGCCCTTATATATGTTAATTTAGAAACTCTTCATTGTAGTTTGTTGGG
ATCCACATGACCTAAACTAAACAAAATTCCAGTTATCAGCAATTTTCCATTCCTATAGTT
CTCTCAAAATAGGTGATAATTTCATTTCTCTTTGTGCCTCAGTTTTCTCCTTTTTGTCAC
ATGACATTGTATGCCAGGATTATCCTGACTAGTAGCTCTTTGGAAAAAACACTTGTCCAT
AGGTATTGGAGGATGGTCTTAGGATCATAGTGACAGAGCCACAGCAGCTTCTGTTCAAGG
AAACCAGATGAGTGCCAGCATCACTTTCCTTCACGCAGTCAGATACATTCCATGTTTCTC
CCCAGGGTCAAATATAGGCCATTACAAAAGCTGTTAGATGTATTAATACCTTTGTTTAGC
TATTTAGAAATGAAGTGGCATGGATTGATGATAGAGTGAGTCCTCTCTATAGGAGAGATG
AAGAACCTGGCCCTTTTTTTCCACCTGATTTCTGATTGTCAAGGATTTGTCCTAGGTTTC
CAAGGTCCCCAAAATTCCTTATTTCTTGGTAACTATGTTTGTTTTGCTTTCTTTTCTGAA
GAACTCAAAATATTGGAGCTCTAAATCTTTGGTTTGGTTAGTTGATGAAGTGTGTGTGTT
GTAAATCATTATTATTTCACTATTTAACTTCTAAATTATTATACATAATAAAATACCTCA
CAGTAATTCTGTTAATTTACACATGGTTAATATTGAGTAAATTCCATTATATATTTTATA
AGAATATATGCAATATTCTGAGAAGCTATGCAAGTCCTAGGCTTTGTTAGCAGAGGCCTT
GGGACAGGACTTCTGACTAGATTAGAGCTGAGTTTTTCAAGTGCCTATATTCAGTAAATG
CTTTTATCACATATGCTGCTGTTTGGTTTCCTTGGCTTCTTAAAAGTGATTTTTTAAGAC
CTCAACCTTCTTGTTAGTATAAGGTGAAAGGGAAAGTTTTTTTTGTTTTGTTAGGTCATG
TTCCCAGAAAACAAGATTTCGTAAACCTGTGTGCCAGCAGAGCACTTAAATAGCTATGTA
AACAAAAAGAATTACTAGCCCTGGGATACAAAATAGTGACAGTCAACTCTGGAGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGT
TAATAGAATCTACCTTAGCAGTAAAATTATAGATATTTTCTAAAAAGTGAGTAGTAACCA
AGAATAACAGCCTCATCTTGAAAACATCCTTAAATTTTTTTGTGTTCCTTCTTTAACAGT
TGCAATAGAAAATCTGCTTACAGGAAAGCTACATTATGTTTATGTGTACCAAATTAGATT
ATAATTTTCTACATAAATAGGTAAGTTTATCGACATTAGTTTAGGGCGCAAGGTGAATAC
TTACCACAGTTCTTTTAATATTTACTTTTATACCAGAAATAGCTTTTTTTTTTATCTGAA
GGTTCTAAGAATACAAATTCTTTTTAGATGGTATGGGAAAGATTTTTATATCTAAATGCA
TAAAACCATCTAGCAGAATAGTTTTACATAGTTTCATTATGTTATTAATATGTAATAAAG
CCCGGTCTTTGAAATATGGCAATTTCATGTAATTCATTTTAATAAAAATTTTAAACTAAC
ATGGCTCTCCTCCATACCCTAGAACATTTCTAAAGTTTGTATTCTTGTTCTGTTCTAATA
ATCATATTCCATTGTAACTTCTAAAAGATGATGGTTTGGTCTCAATATTAAGTAGCTAAT
AGATGATGTATAAATATAAATAATAGATGAGATGAGGTATGGCCATTGATTCTGTCCTCA
TCATAGGATGGTTAGCCCATTTTTTTTTTCCTGTTAAATCCTAGCAGTTCTTATTATATA
ATCTGTAGTTGAAAAAAAAAACTTGAGAAAAGAATGAAACAAAGAACAAAAAGAAAACTA
AAAATGATTCTGCTGTGTTTAGGAGGAAATATTAGGTCTCTTTCTTAGGGAATTTGAAAG
ATAGAGATGATGGAGATGCATCCGTAACAGTGGGCATGGTGGCACTTTCCTATCTTCGTG
AACTTGGAATACTTGACAGTAGCGTGACTGAAGTAGTTTTTTCCTCCTGGTTATCTGGAA
TGAGTGAATGAATGAATGAATTTAAATTTGAAAGTCTATGTTTGAAGTCAGAAGACTTCA
TGTACTTAAAAGAATTTTTTTTCTTTTTGGAAGAAAGATAATCTAAACTATTATCTACAA
GCCTGGACTAATTAAAACAGCCCATATATTATTAGGCATAATTTTTATTAGTTCAGTAGC
AATTTCAGGCATCTTATTACTTGAAAGTTGTCAGTGCCCTTTAAATTCTCCTTGCCTGTT
GGTCTCAGAATAGAAAAATAGGCACTTATCTTTATAATGTTACCACTGGTAGTAAAAATT
AAGGGATGTGGGGCGAGGGTGATTAGGGTAATTGATGGCGTACCTTCACTGACATTCAAT
TAGTTTGGGTTCTTTCGTTAGAGTATCAAATGTGTAAAGGCTTATAAAATGGTTAAGAAA
CTGGGTGGGTTCTCAAAAGAGTAAAGACTCTGGGCTCTATGCCTGGTCATTACGCTGTTC
AGTGAATGGTACCTGCACACCATCAGAAACCCTCCCCACTGGTTCGTTCTTCTGGAAAGG
AAGCAGTATGTCTTCAAGATACAGTTGCTGTCCAGTCCTATACACTTTCAATTTTATTTC
ATTTTTAATATTTAACTTTTTTTGCTAGTTACTGAAAGCATCCATTTTCAAGTATATTAG
TGAAACAATTTTTAAAATGAGTGATTAGACTATACAGGGAAATCGCTGTAAAAAAAGTCT
GTTAAATTAGTGAAGGTGAACATCTATTTTGGGGTTATATTCAGTTGTTTTATTGCATTA
AAATTTTTTTTATAGTAGTCATCTATAATTGCCTCGCTGTTTAAACTCTACAAAGCAGCA
CTTTTTAAATCCAAGGTCAGCAAAATTAAAGCTATCAAAGGTAGAAGCTAAAAGCATGGG
CTTCTCAGTAGCTCTGTAACCTAGACAGCTTTCTTAACCTCTTTGTGTATAGCCGTGTTA
GAACAGATAATGCCTGAAACGCTCTTAACTCAAGGCCTGGCACATAATGTTCAGGAGTAC
TGGCTATCCTATTGTTGATATTGCTGCTTTTTAATTTGTTTAAATTTCAAAAGGAAAGAT
GTATGTTTTCTTTAATATGAAATATTTTTGAAATGAGTGGAAAACGTGAAGTCATTAGAA
ATTCAATTCTCATATTTTCTAACATGTCAAGTTTGGCTTTAGTCTATGTTTTATGTAGCA
AGGAGTAAGCTTTACAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAGCTGGGACTACAGGTATCTGCCACAGTGCCTGGCTGTTTTT
AGAGATGAGGTCTCACTCTGGCTCAGCTCCAGGCAGTCCACCCGCCTTGACCTCCCAGAG
TGCTAGGATTACAGATGTGAGCCACTGTACCTGGCCCTGTAGTGAATTAATAAGCCTTTT
ATATCCATGTAATTTATTTTGGCAAAAAATACTCTTTTTTGTTTAATGGCTTTTTGTGTG
TGTTTTAAAACTAGGACCATTCGACAGTTTGAATCTAAAGCATAGTCACATGATTATTAA
GTTATAGCCCACAAGAAATTTTTTTGATGTCAATTTGCCATTTTGCCTTTATATTCAGAA
CTACTTTTTCATAGTTAAAGATTTCATCTTAACTCTAATCTGCTCTTGGTGGTTCAGTTT
TATAAAGGAGCAGCCCAGTCTTGATGTTAACTAGAAACTCAGGTAGTCTTCATTTCCTTA
TATTCAAACAGAAGATTTAACCATAACAGAAAGGCTGATTTTAAATCAGTGGTTTCTTCA
CCTTCCTACCCCCACTTCTATTTTTATTTACTAAATATGAAAATATAACCTGACCTTGGA
GCATTCTTAGAGAGGTCAAGAATTCTGCTTCCATTTAGTACCCAGTTACTGATTTTCCGA
GGACTACATACAAGTCGCTTAAACTTCCTACAGCAGAAATCAACTGAGGAGAGAAAGTTA
AAACTTCATTTGGAAGGCATACCAGTAGACCTTGCCTGACTCAGCTCGTGGCCAGGCAGG
GGGGACAGTGTATGCAAGAATAATTTGGAGTTTGTGCCAGCTCTAGCCAGCTTAATCAGT
GGCTGGGTAAACTGCAGTACTCCAACATTCTCTTGAGGAAAAAAGGGGGAAGAAAACTTA
CCGGAAATGTTTCTGATTGAAAAACCTCTCCTTACAGTATGGATTTTGATTTTAGTTATA
AAGAGGCTGAGATAGGTTGCAGGTAATGCAACACTTGTCAATAAACACTTTTTTTTTCAT
GGCAATAGTAGACAATGCAGTAGGAAAGGTGTTGGCAGAGGGAAGAGAATGAGCAAAGGC
ATCAAAGAGTGTCTTGTCTAGGGATTCATTGGATACTTTGCTGTAACTAGGGTTTGTGGT
AGGCAGTGTTTGAAAGTTAGGTTGAATCCAGTACTAAAAGACCTGTTGTGTCCTAAGCTA
AAAAAATTACTGGGGAACTATCTCAGGTTGTATCTTAGTTTGTTTGTTGTTATGTTTGTT
TTTTAAAGCAGGGAACAATCTTGTGTGATGAAATGAATCACTTTAGGAGTTTGACTCTAG
TGGCCTTGAAAAGATAGCTTGAAGAAAGGGAGATATTTGGTTTCTGTTTCTGAAACACTG
TAATTGAATGGCTGGGGCCTTCTGGATGTGGTTGGTACCATTGTGGAATGGGCTGATGGC
AGAATTCTTGGCCAGAGGGCAGGGTTGTGGAACTCCAGTTTATTAGTAATAGCTTTAGAG
GTCAACGAAACTTTTTCTCAAAGAACCAGATGCTTACCTAGTAAATGTTTTTGGTCTGTG
GGCATTGTGATCGCCACTGCCCTTGAAAGAACTACTCATTCTGCCATTGTGTCTCTAAAG
CATTAAGAGCAGAGCAGAGACAGGTAATATGTAAATGAATGTGGAGCACTCTTCCAATAA
AACCATTCACGAGAACAGATGGCTAATGCAGGCCAGGGTCTGCCAACCTCGGTTTAAACT
GTAGTGAGAAGAGAATCTGAGACAGAACTATGAGACCATCTTTTCATATAGCACCAAGAG
GAAGGACATTTCTCAAAGATTATTAGGCAAGCAGGAAAATAGGAAAGAATGGCAAGAGAA
GAGGGTAGTCGAGAATTTTGTGGAGAGATTCTACTTAAAAGATGCCATAGGAATCTGAAC
TGATTCAGATATTCAGTAATTACTCATGGGGTGGGGGGTGATGATAATATTGTGATTTTG
TTCTTTATAAGCATCCTTATCTTTTAGAGATTTATACTAAATATATTTCTGAATAAAATG
ATAGGCTATCTGGAGTTTGCTTCAGAATAATCTATTGAAATTGTGGAAGTAGAGAAGAAT
AGATGGAACAAAGTAGGGCTCGAGTCACCAAGTGTTCAATACTGGGTGATAGATACATAA
GAGTACATTGTATTAATCTCGGCTGCTCTTGAATACAAATTAAAACTTTCATAATGCCTA
ACTGTTTTAATTAAAGACTTTAGGATTTCGGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCTGAAT
TCAGGCCAATAATTTGTCGTGTTATTGTGTTTTATCCTTTTGTTTAAAGGTTTTTGAAGA
GGTTTCCCATTGTACACAACATAACGACATGACGTATTCTGGAACTGGATTGAAAAACAA
TCTGTAATTAAGCAACAGATAATTAGCACTTTCAGAATATAGTACTTTCATCTTATAATC
ATTTACTCTTAAAATGAGCTAAATTATCTTCTGTAATTTACCTGGCATGTGTTTTGTTGG
TGCATGAACTCACATTCTCTCTTTTTAACTAAAAGATAAATCAGTTTTAGAACTTAGAAA
GCACCAGTAAACTTTCCACCAAGAATGGCTTAGGGTTACAGTGTGGTATTTTGAAAACAT
GTTCATTTTAGGTTAGTGTTACCAGTCCCTCTCTCCTTTTTTTTTTTTTTTTTTAATGTT
ATTTGCCAAATGATATCATAAGTTCAAATGACTCTTTAGGTGTTTACTTTTTAATTTTTA
AACTGCCAAGCTATTTACTTTCCAAGTATGCTCTAAAATTCAGTGTAAAGTGAAACTATT
TTGTTAAATTTCTGAGGTATAATTTTAGTGAAATATTTTAGTATCTTATGTTCTCGTCTT
AGATATTAATCTCTTTATAAAATTAGTTAGTGGGTTTTCACTCAATTTATATTAAATTGC
CATTTTTAGTTCTTTGATCAGGAATAAGCATTATTTTAATTTTTTATTTCTGAGTTTTCA
GGGTGAAAAAAATCATGTACACATCATAAGTTTTGTGTTTTCTTGATTATTGTAAAGGAA
GTGTTGTAAGCTACATTTAAATTATTGATATACAAATAACTTTTGACCTATGAGTGGATA
ATACTTAATCTGTTAGGGTCTACACTTAATCATAATTGTTTTTATATTCTTGATTTATCT
GAAATAAGTTGTATTATCCATATGGGCTTTCTTCAATCCATTGCTCTCTGATAATTCTTC
ATTAAGTGCATAGCAAAGTACTTATGGAAATAACATGATTTTCATAATCTTTTCCTTTTG
ATCCTTGAAGAGTACACTAGTAGTAATAGCTAGCTTCTTTACTGCTAGCCACAGTCCCCT
TCCTGTACAATGGAACATCAGAATTTACTCCTATCTAATTGTAACTACGCATTGACCAGC
TTCTCCCTGTCTTTATTCTCTCCTTAACCTCTGGTGACTATTATTATATTCTCTACTTCT
GAAAACTTTTTTAGATTCCACATATGAGTGAGATCATGCAGTATTTTCTTCTGTGCCTGG
CTTAGGTTCCTTAAAAATGTCCTCTAGACTTATCCATGTTGTCACAAATGATAGGATTTG
TTTTAATAGCTGAATGATATTCCATTGTACTATGTACCACATTTTCTGTTGCATTCATCT
GTTGTTGGATACTTAGGTTGATTCCATATCTTGGCCATTGTGAGTGAATACTGACTGCTT
CAGTAAACGTGGGAGTGCAGGTACATCTCTTCAACATACTGATATCATTTCTTTTGGATA
CATACCCAGTAGTGGGATTGTTCTGTTTTTAACTTTTTGAGGCCCTCTTCCATACTGTTT
TCCATAATGGCTGTACTGATTTACATCCCCACCAATACTATGTAAGTGGTCCCTTTTCTC
CACATCTTCCCCAACACTTTCTTTCTTTTGTCCTTTTTTTTTCTTCCCAATAGATTTGGA
GGTACAAGTGTTTTTTGCAGCATGGGTGAATTATATAGTAATGAAGTCAGGGTATTAGTG
TATAGTGTACACTATTCAGGGCTTTTACCTGAATTGTGTATAGTGTACATTGTTCCTGGT
AGGTAACTTTTGATCCCTTAGCCCTTTCCCACCCTCCCCCTTTCTTAGTTTCCAGTGTCC
ATTATACATACTACTTTGTGTAAACCAGCATTTTGCTTCCATTTTTAAGTATTTGTTTTC
CCCTTCCTGAGATACTTCACTTAGGGTAATGGTCTCCAGTTCCATCTAGGTTGTGACAAA
AGACATTATCTCATTGCTTTTATAGTTGAGTAGTATTCCACAGGGTAGTGTAGATATATA
TATACACAGTATACATGCACACCACATTTTATTTATCCACTTACAAAGTGATGGGCACAG
GTTGATTTTATGTCTTTGCAATTGTGAATTGTGCTACAATAAACATACAAGTGTGTGTGT
TTGATCTAATGACCTCTGGTCTTTTGAGCAGATATGCAGTAATGGGATTGCTAGATCAAA
TAGTAGCTTCTTTTAATTCTTTGAGGAATCTCTGTACTGTTTTCCATAGAGGCTATACTA
ATTTAATGGATTCCCACCAGCAGTGTATAAGTGTTCCTTTTTTATCATATCCATGCCAAC
ATCTGCTATATTTTTGACATTTTAATAATGGCTGTTCTGATGAGGTGAAATGATATCTCA
TTGTGGTTTTAATTTGCATTTCCCTGATGATTAATGATCAGTTGAGCATTTTGCTTATGT
TTACTGTTCCATTTGTATGTTGTCTTTTTGATAGTAGCCATTCTAACTGGAATGAGATGG
TATCTCATAATGGATTTGATTTGCATTTTCCTGATGACTAGTGATGTTGAGCATTTTTTC
ATGTACCTGTTGGCCATTTATATGTCTTCTTTGGAAGTGTCTCTTGAAGTCTTTGGCCAT
TTTTAATCAGGTTAATTGGGTTTTTGCAGTTGAGTTTTTTTAAATTCCTTTTATATTCTG
TATATTAACCCTATGTCAGATACTTTGCAAGCGTTTCTGCCCGTTCGTTAGGTTGTCTCT
TCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTC
GCCCTGGGTAGAGTGCTGTGGCGTCACAGCTCACAGCAACCTTAAAGCGTCCTGGGCTTA
AGCAGTTCTCTTGCCTTAGCCTCCCAAGTATCTGGGACTACAGGTGCCCACCACAACACC
TGGCTATTTTTTGGTTGTAGTTATTATTGTTTGGCAAACCCAGGCTGGATTTGAAGCACT
AGCTCCAGTATACATGGCTGGCACTCCAGCCACTTAATCTATAGGCGCCAAGTCAATTCT
TCTTGTTTGTTTGTTTTGGGTTTTTTTTTTTATTTATTTTTTTGGAAACACTGATCTTTG
TGTGTTGATTTTGTATTCTGCACCTTTATTCTAACAGTTTTTTGGTTAAGTCTTAGGATT
TTCTATGTATAAAATTATCTAATCTGTAAATAAGGACAATTTGACTTAGTCCTTTCTAAT
TTGGATGCCTTTATTTCCTCCTCTTGCCTAATTGCATTAAGACTTCTAGTACTGTGTTGA
ATAGAAGTGGTGAAAGGAGGCATCCTAGTGTTGTTTCTGACTTGAGTATGTTGAACATGA
TGTTAGCTGTGGCTTTGCCATATATGGCCTTCGGCATGTAGAGGTACGTACCTTCTATAC
CTAGTGTGTTGAGTTTTACTAATGCCAGAACCCTGTGTTTGCTTTCTTCCTGCATCATGT
AATGTTTCTTAGTTAATAGAAATTTGAACTAGAGTGATTTCAGTTAAAAATGAAATTTAG
GTTATTAGATTTTATTTCTCCAGTCACTTCCCTATTCAGCCTGAGACCAAGATCCATATG
GTATCTTCTAAAACAAAACTTGTTCAGCACTCTGGGAGGGCAAGGCAAGTAGATTGTCTG
AGCTCTAGGGTTTGAGACCACACTGAGCAAGAGAGAGACTCCTGTCTCTAAAAATAGCTG
GGCATTGTGGTAGACACCTGTAGTCCCAGGTACTTGGGAGGCTGAGACAAGAGAATCACT
TGAGCCCAATAGTTTGAGGTTGCTGTGAGCTATAACGCCACAGCGCTCTACTGAGGGTGA
CAATGTGAGAGTCTGTCTCAAAAAAAAAAAAAAAAACTTGCTCAGTATTTAAAGCATTAT
TACTTTTTAATATATTTTATATAGCCCTCTGTTATACCAGTATCTATTGCTGCCTAACAC
ATTACCCTGAACTTAACAGTTTAAAATAAAAAACATTTATTACCTCATCATTTTCTGTGA
TCAGAAATCCCAGTACAATTTACCTAAGCATCTCTGGCTTAGGCTCTCACAAAGCTGCAA
TGAAGGCATCATTCAGGGCTGCAGTTATCTCAGGGTTCAACCTGGGGAGAATCTGCCTCC
ACATGCACTAACATGGCCATTCATAGACCTCAGGTTCTTATTTGTTGGCTGGACACATCC
CCACAACACACCCCTCTGTAGGGACAGCTTACACTATGGCAATTGGCTTCCTTCAGAGCC
TAGTAAACAGAAGAGTCCAAAGTAGAAGCTGAAGTTTCTTTGTAACCAAATCTCAGAAAT
GACATCTCGTCACTTTTGCTGTATTTTATTCATTAGAATTGTGGCACTACATTCACCCAG
ACTCAAGGGAAAGGGGACTGAGCAAGAGCATTAGTACCAGGTGGTGGGGTCCGTCTTAGT
GGCTGCATGCCGTATCTACTATGAGTGCTGTACAACTTTACTACTTTTTACTGTGCCATC
TTCACAGGATTACGCTGATAAAATTCCCTGTTTAGATAAAGCTCCCTGTGCTTAGCTTGC
TGTTGTCTCACAATCTTGAATTAATCACTTTATATAGAATTAGACTCCTGTAAAGGGAGG
AAACCAGGACAGAGATAAAGGAATGTTCATTTGCAATTTTACTTGTATAGCTTTTTCTAG
TTATTTAGATAAGAAGCTTTGTTAAAACTCTAAGGTACTATCAAGAAAGTGTACAATTGG
GAATATTTTATGCTCTGTTCATTATATAAATTCTAAAGTTTGTTTTGTTCAGGATTGGTA
AAGGTTTTCAAGGCGTCATGAAAAGATGGGGATTTAAAGGCCAGCCTGCTACGCATGGTC
AAACAAAAACCCACAGGAGGCCTGGAGCTATTGCAACTGGTGTGAGTATAATTAGTGATG
TTCTTTTTAATGCTAAATATTCATCTTCTGCACATGAAGTGCTTAGGTCCTTGAGATCAA
GTCACATAAATTTAATCTGATTCCAGGTGGATCCAAGTACTTGTCACCCTTTTTGTAGGT
TCTGGCCTCACTCATTTTCCAAAGCCAGACTTTTATATCTCACATACTTAACCACTAGTC
CTCAATACCTTTTGACCTACTTTCCTGTTCCCTTCTGTTTCCTGACGTGTACTCTGAAGT
TGACTGCAGAAATCAGGGGTTACAGTGCTATTCCACCTGCCCTACTTGCTCCTTCCCAGA
TTTCTTTTTGCCTTAAAGGATCCAAGAAGATTGTCAAGGACAATATCATAGTACAGGGAG
AAAGAAGGAAAGAGGAACAGTAAGAGCGAAAGAAATAGAGGGGATTCTTTGTATTGCTAA
TTCAGTCCTATTCTTCCAAAGGCATAGCATAAGGAGGCTAGAGGAATTTTATTCTGATTT
GGTGCATCAGTGTAATACAAGATCTTTCTCTAAAGGTTGATAATATATTCTGTTTTTCTC
ATAATAGGAGAAACACAGATTAAAGTTGTTCTAAGATAATTTCTCACCTAGCAGATTGTG
TCATAAAGCTGTTTAATTTTTGTCACTCTCTTGGCAAGAAATAGCAACAGGCACTCAACA
CGTATATCACTGATGGGAATACAAAATATGAAGGGGAATGTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACAGTAATGTGGTCCTTACTTAATGATGTTTCAACTTAAAACGACT
TTACATTGATATGAAAGTGACAGGCATTTATCACAGAAACTACTTTCCCAGTCACCCATG
CAACCATTTTGTTTTTCACTCACAATGCAGTATTTAATAAATTACATGAGATAACCCAAC
ACTTTGTTATAAAATAGGCAATGTTAAGTGATTTTGCTCAATTATAGCTAGTGTTAAGTT
TTTAGAACACATACAAGGTAGCTAGGCTAAGGATATTTGGCAAGTTAGGTCTGTTAAATG
CATTTTCATATGATATTTTCAACAGAGGGCTTATCAGGCCTCCATTGTTAGTTGAGAAGC
ATCTAGACTAAATTTAAAATGTACTTTGTACAAAAGTTGAGTTCTAATTTAGTTTTTGCA
GTAGTATCAGAATTCTAAACTAATTTTCTATAAGTTGTAGTATTGAGCAGGGAAGCATAT
ATATTGACAACAGCAGACAGGCTTCACGCTATTGGAAAAGAGCATTAAAATATGAAGAGG
GTACAGTTGTGTTCTAGCTTTCATAAGAAAGTGTGAGTAAATATAAGTTGGTTTCATAGA
AGTACTGAGTACATTGGAGTACATTTTTCCTCCATTCCTGAGATACTTTACTCAGGAAAA
TATGTTCCAGTTCCTTCCATGTAAACATAAAAGAGGTAAAGTCTCTGTCCTTTTTAAAGG
CTGCATAGTATTCCATAGTAGACATATACCGCAATTTATTAATCCATTCATGGAAAGAGA
GAAATGGAGTGGGGTGGGGTGGTAGAGGGAGGGTAAATGGTGGGACCACACTATGGACAT
GTGCAAGGGTACAAGACAATCTATCAAGTGTAGAACATAAAAGTCTAACACAATAACCAA
GTAAATGAGGCTAAAGCTATATTAATTAGTTTGATATAAGCAGTACGTCAAATTGTATTA
AAAAATTCAACACATTGTACCCCACATATACATAAATGTACTCATGATCTGTGTGTATAT
GACTTAATTAAAAAAAATAAAGAGCTAAAAAAAATATGAAGGGGGGAAATTAGAATGAAC
CCATATAGTGTTACATTTGAGTTTAAGTATGTATTTACTTGGGCATACGCATGCATGCAG
AAAACAAATGTAAGGCACAAAGGAAAAGAAATACTCAGGATTGTCTTTTAAGCTATATTG
GATACATATTAAACAACTCTTAATGCTGTGATGAGCCACTTCCACTGGGAGGTTCACTTA
CTAATGTGAGAGCAGATGATTGAAAAGTGTTTATATTCTAAGGCAGTGGTTCTCAACCTT
CCTAATGCCACGGCCCTTTAATACAGTTCCTGTGGGTCGCAACCCACAGGTTGAGAAAGG
CTGTTCTAAGGATTCATGTGTTGTGAGAAGCTTTTCTATTTTAGATATAATTTGGATTTT
CTGCTTTAGATGTAGAAGTATTATCTATTGTCAGAGCCAAAATCAGAGACTTTGTGAAGG
TATTTGATTTACGTGAATCAAAGAAAATTTGGACTAGCCAAACTCAAAATTCTGATAACT
AACTCTTTAATCATTTTGTTCAAGCAAATCAAAACATCAAGAAACGAGGGGTAGGGCCAT
TCTAGCATCAGCAGTGTGGGGCATCTTTTACATCAGTGAATAAAGATTAGTTGAAAACAG
GCCAAGTCATTCCATGTTTTTCTCTGAATGATGCTGTGATGTGTGTATATGTTTTTTTCT
CTTTCCTATCTCAGCTAGTATTTTGTCAGTTACTACTTTGTTGTTACTGAGTTTTTCTCT
TCAATCTATTTTCTAGTCATTATTTTTTGACTAGGCTCAGTCTAGTCGAATTTGGAAAGG
AAATCCTCTAGAAGTAAATGTGTCCAAATTGACATTTAGATCTTTCCTGGGGCCCAGCAG
AACAGGAAGAAATTACAAAACATTTTAATAATTTCTCTGAGTTCACATTGTGGTTTGATC
AGTACTGTTTGAATTTGAGAGTACTTAAAAGTGTTAACTTTGGTTATCTCATTTAGGATA
TTGCCAGAGTCTGGCCTGGAACTAAAATGCCTGGGAAAATGGGGAACGTAGACAGGACAG
CATATGGACTGAAGGTAAGTTTCTAAAGTGGTTATTTTTAGGAACAGTTAAATTAGCTAC
ATGCAGAGGCACCAGCACGTGTATTCAATCTGTTTCTGATTACTCTAATAGACTTTATAG
TTACTAGGAGCAGAGGATGCTTGAATTCTGTGTATGTTTATATGGTTGTACGTTACAGTG
GCAGTAGTAGAGTAGAAATCTATAAGGAAAATGCAGTTGCTAAAAAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGAAAAAAATTAG
GTCTCTTAACGTGGAAGATTTCCACAATGATTTTTTTTTTTTTTCTTGGCATGAAAGATA
AGATTCAGAGCATCAGGTATAGTATAGTTCTCTCTTTATAAAAGAATGAACAAAAGCTCC
CTGCTTCTGTATGTTGCTGTACTATTAGATGATCACAGAGAAAAGTAGAAGGTTATATAC
TAGCTCATCTTGAATGATATATCAAATGTGTAAGTAGACAGAGGTAGATTTGGGTAAGAA
GGAGAGAAGACAATTAAAATAGGGCAGAAAACAGCATTAAAAAAGGGTTGTAGTATACAT
CCATTTTTACAAATATATATTTAAAGGGGAAGAAATTAAGTTCCATTTCTACAAATTTGA
GAAATATATGTAATATGTAAGTGAAAATGAGTTGTACTATAATGGGTGCTGTATAATTAT
ATTATTTTATTAAAACAAACAACTTAATGTTTGTACAAAGAAGAAAATAAGCCGCTTAAA
GACATCTGGGCCAGGTGCAGTGGCTCATGCCTGAAATCCTAGCACTCTGGGAGGCTGAGG
CAGGTAGATTGGCTGAGCTCAGGCATTCGAGACCATCTGAGCAAGATTGAGACCTTGTCT
AGAAAAATAGCTGGGCATTGTGGCAGACTTCTGTAGTCCCAGCTACTCAGGAGGCTGACG
TAAGAGGATCACTTTGAGCCTAGGAGTTAGAGGTTGCTGTGAGCTGTGACATAGCACTCT
ACCCAGGGCGACAAGTGAGACTCTTGTCTCAAATATAAAAGAGCGAGACCAAATGTAATC
AAACATTTCGGGTTATGTCCCCCGGATATATATTAGAGGAATTTATTAATGGATTTTAAC
GGAGGAAGTGTGTCCACTTTTGTATAATTAAATCTAGGAAATTTTTCTTTTGTTCTTCCC
AGAGACCGTCTGTTCGTTCGCCGTAGTTTCTCTATGGGTATAAGATTCTTATAGTATGAA
CACCCATTTTGAGATATGATCCGGTGATTTGAACTCAATTTCTTGTCCCAATACTATTCT
CAGTCCCATTTCTTTACCGGTCAGTTCTCTCCCATTTGTGTAAGTTTTTTCTCCACATGC
AGATCTGTTTGAGGACAATCTGCTTAACTCATTTCTTTCAGAAATTAGAACCAGTGAAGT
TGTGGCTTCTCCAGTTTCTAGTTACAGCAAGCTAGTACTAACTAAAAATAAAGTTGAATT
TCAATTTATTATTCTTAAGAGGCCCAACATATCTAAGTGGTCTTGTTTATTCAGTCATGT
TTCCATTTAAAATGAACTTTCTACCATTTCCATTAAGATGTATCTGTGATAATCTTACAT
TACAAGTCACCATAGGATTTGAAGTTTTTCAATTTTTATTCATCATTTTGAAGTGCTAAT
ATGAGTATTACTTTACAGGCTGCTTACGTCCTCAGCTTTTAGTAACATTCTTTTAATACA
AGTATGTTCTCAAATGTTTAACTCTCAAAGTTTGGTTTTATTCTTTAGGTATGGAGAATA
AACACAAAGCACAATATAATCTATGTAAATGGCTCAGTACCTGGACATAAAAATTGTTTA
GTAAAGGTATGTATAGCTTTTTCACATTGTTCATATATATAGACATGTGCCACAAATTCT
CCTTTGACTCTTATATATAGCTTAAAAATAAATAACTGTTTTTCCACATGTTCTCTGCTG
ATTTTTTCTTGCACCTGAATGAAAAAAATACACAAGGTAAAGTATATCTTATGTCTATAA
AACCAAAAACTTGTAGTGACCATAAGGAGGATACTAGGCTAATTATTGCCAAAAATAGCT
GTCTTTTCAAAAAAGATCATTTTGGCTTTTTGAAGTACCCATCTTCAGATAAACAGGTAA
AGAAAATATGGGGTATGGGTGTGTACTGAGTACTATTCAGCCATGTACAGAATTAAATTC
TGTCATTTGTGGCACCATGGATGAACCTGGAGGACATTATCGTAGGTGAAATAAGCCAGC
CGTGGGAAGACAAGTACCACGTGATCCCACTAATGTGGAATCTCAAAAAGTTGATCTCAT
GGAAACAAAGAGCAGAACATTGGCCATCAGAAGCTAGAAAATGGTAGAGGGAAAGAGAGG
GTTGGTCAACAGGTACAAAGTTAGGGTTAGAATAAGTGCTGATGTTCTGTTACACAGTAG
GTGACTATAGCAAATTATATATTTCAGGATTCCTAGAAGAAAGGATTTTGAATGTTATCA
CCACAAAGAAATGGTCAATGTTTAGACTGATTGATGTGCTTATTACCCTAATTGGCTCAT
TATACAGTATACACCTGTATTGAACATTATATGGCACTCCATAATATGTACAGTTGAATC
TTAATTATAAAAGACAACATTTAGCTTTTCTAAGAGTCCTTTGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGGATTTTTT
CAAAACCTCAGTCTAGTTACTCAACCAGTGATGATTCACCTTTCACTAAAAATCTCCGAA
AGTACACTGAAGATTGTTCTGAAAGAGGGGTCTAAATGTATTTTGCCAACTAAGTCATCA
GAGCAATGTCTAGTCCACTTTGATCTGTTATCAAACTAGTAAATATACTTATAACAAACA
CATTTTGATTTAAAAAGAGAACTCTATACTAAAAGAAAAATCTTCAAAATATAGTACCTA
CATAACTAACCTTAAACAAATGTCTGTCTCTAACATTGACATGTGGCTCTGGGAAGTGAC
TTATGGGTTTGTCTTTTCACCCCCATTGTTTCATTTCTCCAGTGATCCCATAGCATGGAA
ATAAGGCCCTCTTTGCCCCTGGAGATTGAGCCACTCCTCAGAGGGCAGGTTGTTTCATTA
ACATCCACTTACCTCCGAGGAGGTCAGAGTACAGAGCTACCAAGATTTTATTTTATTTTT
TTTAGATTCCATAGTTAGTAAAGAGAGTCTTAGGAATGATCATCCTGCTTAATTAGCATA
AGATTTTTGCTAATTTGGATTCACTAAATATATTACGAGAGCCTAAAGAACTGTTGTTTA
CAGCATAATGTAGTCAATGTTATTAAATTCTATTCATTTGTGCTCATTCCTGTGTTCTCA
TACGTAAAATTTATTTTCAGTTTTGCTTGGATTTATTGCCTGTTCTTTCCCCATCTTTCC
TTAAAAGACTTAAACTGGTTTGCCAGTAGACATAATTATAAAAAGAATGAGATAGATAGT
TGAGTCTTGGTGAAGGCAGGAAGATAATAAAGGCTGGGGTAGGATTAAGTACACACCAAA
TCTTACGCATTTGTTAAAGATGGGCTACAGACTTCAGACCCTCAACTTTAGAGCCACCAA
GACAAAAAAGACTTAGATGTCATCATTTTTATTTCAAATTGAAGAATTCCACTACTGTAG
CATTTACAGTTGGATACATACTTTTGTTATGTAAAATATTCCTCAAGTGTAATGGATTTT
AGAAGTGTAGAAACAACTGAGAAGTAGTTCTTTGAGACATTAATGACTAATTTTTATTCA
TCAGATTAGCACAAGTTTGTTATGATTGGCTTTTTGCTTGGGTTATTTTCGGTGTAAATA
CAAAAAGTTTGATCGTAAAATATTTTTTTCCTAGTTGTGGCTCACCCTAAGATTAATGAA
TTAGGGGGAAAAAAACTAAACAAGTTTATTTTCTCCTGGGCAACTTACTAATAATTTCTT
GAAACAGTCATTAGAGATTAAAATAGATCTGTTTTTCTGTACTTAACTGTTCTTAGCAGC
TGTGTGCTTATTTCAACTAAATTATTCATTTCTTATTGCCAAACTGATTATGGCTTATTT
TACTCTGTGTATATAATTACATGTAATCATTTTTTAATTTCACTATGAATGAAGGCTGTA
GAATGAGTCAGAAGCTTTAAAGAACCCAATAATGTTTTCTAAAAATAAAATCTAACATTT
TAGATCACATTAATATCTATACTCAAATTCTTTGGTCTGTGAATTCACAGATATAATTTG
AATTCTTTTTTAGAGCACAAAGAGTTAATAAGGCTCCTACAAAGACTTACAGGTCTCTTA
CTGTTTTTGCCAAATATAATTCTGTCTTTATCTTCCAAATAAGAATGCTGTTTACTAAAT
GTAAGCTAATTTTCTTAATAAAAGATCATATTTTTGGTTAGGTACTTTTAGAGTCAAGAT
TAACAAAAATACTAATAAGGGTTTTTTATTAACCTCAGCTCAAAATATCTGTGCTATATT
GGCTCAGTGCCTGCAGCTCAGTAGTTATTGGTGCCCAGGCCAGCTAAACCAACAATGACA
ACTGCAATAAGAAAGTAACCAGATGTTATGGCGGGTGCCTGTAATCCCAGCTCCTTGGGA
GGCTGAAGCGAGAGGATCGCTTAAGCCCAAGAGTTTGAGGTTGCTGTGAGCTGTGATGCC
ATGGCACTGTAGCAAGGGCAACATAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAAATT
TTTGTGCTAAAGTAGAACATAAAGTAATCAAAATAGACACTAAAAAATAGATAATTATTT
ATCTATTAAAATAATAAAATTATTAAATAATAAGATAGATAATTATTAGGTATATAGTTT
ATGTCAGGTAAAAATGAATCGATATAAATGATGTTTGAGTAGTAATTTCAGAATATAACT
TACCCTTTTGGGCTGTTTAGGAGATTTATAAGTTATGATAAGATGTAAAGTAATAATTAG
TGACTTTTATTCTTATAAAATAGCTGATTAACTTGAGTTTTTGTCATTGATTTAATCAGA
TTTTTGGAATAAAAAGAATGCATTAACTGAGTTCTTTTTTATGCTCTATATATCACAGTT
GTGTTATTCACATTAGAAAGTGTAGGAGCAGGTATTCTTTGATTATGAATAATAGATAAA
ACAGACTACCTTTAAATAACTTAATTGGTAGTACTTATTAAAGTAAAATTTTTTGCCTTT
TCCCTCAGGTCAGAGACTCTAAACTGCCTGCATATAAGGATTTCTGTAAAAATCTACCAT
TCCCTACATATTTTCCTGATGGAGATGAAGAGGAACTACCAGAAGATTTGTATGAAGAAA
ACGTGTGTCAGCCTAGTGCACCTTCTATTACGTTTGCCTGACATCATTGGACTTGGCAGA
ACCTTACATATTCTGGGAGCACTGATGAGCCCGAATAATAATCTAACCAGAAATTATATT
CTTTCCTAGTCACAACAATACCACACTTGTCATCTCTGTCAAGGACAGATCCCTCATCAC
TGAGTTGGATTTGGTTAGAATAATTACTTTATTAAACATATATAAATTAAGTAGATTGGA
TTTGCTAAAATTGGCAGTTTGCATATTAGCAAAATATTTGTAATTCGTGGACTTCATTAT
TTTCTACACCTTTCTGGAGATAAATGTATATAAATTTAACTTTTATTAAAGATCTGTCAA
TCGTTTTTGAAAGAGTGTCATGATACAGTAGAAAACCGTAAGGGGACTTGTGGTGCAACT
TATTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCATTTGCTAA
AATTCACTTTTATTATTTTGCATTTCAAAGTTAGAAAGTAAGTGAGATTTTTATTTGAAT
TACAGAAATATATGTTGAAGGCCTGACAAAGGAAAGATAAAATCATTAATTATGGGTCCT
GTTTACACTTCTGTTGGAGCAGTAATTATTTTTTAGTTTGATTACTCAGATGTAAGATTG
GTATAATCATTTTTCTATGATGCCTTTCAAAAAGGAGTTGTACGTACATTCAACAAACTT
AATCAAGTGTTACTCAAAATGTTAATGGCTTCTGGGTTTCTTTTCATTGTAAGAAATTAA
GACATATTTATTAATGGCTACTCAAGACAAATAATTAAACTTAACAATGTAAGTATAAGC
AGATCTCATTTAACTACTCAATTTCCTCCAAACCAGATTCTTGATTTTTATCAGCCGAGA
AGCTTATTGATCATAGTGTTGTGTTAGGTCTCCACATGATTTATTTATGGCTAATAAATT
TGTATTAAAAGATGCAGTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 9783..9882, 11059..11102, 11105..11118, 25972..26080, 29096..29173, 34248..34325, 38708..38860
1001..1099, 9783..9882, 11059..11102, 11105..11118, 25972..26080, 29096..29173, 34248..34325, 38708..38857
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved