Otolemur_garnettii Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii EIF4A1
Otolemur_garnettii
EIF4A1
GeneScaffold_3486
SNORA48
2944..3078
7928
CAGATCTTCAAACTTTTTTTTATATATATATAAAAATGCCACGGTCCTGCTCCAGTCAA
TAAAGGATCCTTTGGAGATACATAAGTGGTGGTCTTCCTTAAAGGGCTGCAAACTAGTAG
ATACGCTTATCTCACTCAGGCTTTCTTTCAGCAGTGCTGTTAGCAAACCTGTTTTGGGTC
TTGAGACTTCAGGAGCCAGCTTTCCAATACCTGGCTCAGGTAATGGCAACATGATGTTTC
CATTACCTGAACAAATCTCCCAGCCAGGGGAGCATAGGGCAGGAAGGAGGGAAGTAAGGC
TTAAAATTAAGAGCCTGAGAGAGAAGCCAGGGGACAGGACACTGAAGAGACTGGGTAAAG
GAACAGCTAGGATTCATGACAGCTACCCCGAATGCTCCTTAGGCCCATAAATAGGTTTTT
TCCATTCTTCCTCCTAGCCAGGGGAATCCTCCCAGCGTTATGGTATCGCCACTTGGTCCA
TCATCCCTGGTATACGTAGAACACGTCCAGGCGGTGTCCAATCCATCGCTCCTGCAGGAC
AGAACGTTAGAGGCCAGTGGAGACCCGGAGCAAAAGTAAAGGGAAGTGGTAATCTCAGGA
GCCCGGAAGTCCCTGATGGCTCAAACCTCGCCCCCCCCCCTTGCGTGATTGGGTCTACCA
AGCCACATGACTAAGGCACTCTCGCCTCCGCACGTGTAAGGGTGCAGGACCCCAAGATGG
CTGCCAGACCTCGAGGCCCCACTCCAGTATGTCACTTCCGTACCGGCCAGAAAGGTGGGC
CTTCTAGCCAATGAGGCTGCGAGGCGGGCTTTCACCTTGACAGGCGCTCACATTATCCAA
TGGTGGCCTAGTGTTTAAGTGCCTCCGAACTAACGTCACGCGAAGTTGCCGAGCGCCGGC
AGGCGGGGCCGAGGCGGACAAGCCAATGCGATGGCTGGGGCGGGGTCGGGCGCTTTATAA
GTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATT
CCCGGTAAGAAAGGCATTTGCAAGAGGTTTGCCTACTTACCCTGCCGTTCCCTTCCGAGA
GGAAGCTGAGAGGCCCACGACCCTAAGCCCACCAGGGTTGCGGGGGAAACCAAGTTGGGA
GGAGTCATTCTGGGGGAGTGTGGGGAGATGTCCACGGTCGATAGTGCTGCCAGGGCCGAA
GCAGAGGGCGAGGACAGTTCGGCTAGCGCCGAGCCTGAGAGGTTCGTTACGCGGACTCGA
CCCGAGTTGGTGTCGTGCGCGAAGTCCCGGCTTTGAGTGGTGAGATGAGGTCGCGACTTA
AAATGATAAAGAAAAGCAGAGGCGGCCGAAACTGCGTGGCCCAGAGCCGGCAGGTCCTGT
TGCCTCACTGTGCCGGGGGGGAGGGTTCGCGCGCTGGGGACTCAGGAGGATTCTGACGGT
ACCACTCGGGAGAGGCGGGGGTGGCTGGGTCTTCAGATCCAGTCGGTTCGTCGCGGTTGA
AATACGGGTCGGGGTAAAAGAAGCCGGCCGTTTAGTGTGCTGGTTTTCTTGACGGCCAGG
ATTGAGCCTAACCCCGAGGAGCAGCCGCGTGAGGCACCAGGAGCCCACCCGGCGCCGGGC
GGGCGGGTCCATTTTGCCGCACAAGCCGGGCAATTGGCAAACTGCGGATGGGCAGGTCCA
CTTTGCTTCAGGGGTGAGCGGCCTGAGGTATGGGAGGGCGACGCCATTTCGCGACGGGGG
CGGGCGGGCTGTGGATTGTTCCATGGAGGTGGGGGGGTACGCCGCCGGGTGGTCGAGGGA
GTGAGCACATGGCGGCCTGAGGTGTTCCCCTCCCCCAATCTGCTTAGCTTTTAAGTGTTG
TGCAATGTCCCCTTTAGCTAGCTCTGCTACGGCTCATTGTGCGCGAGGCCGCCACCGCCC
GCGGCCTCCCACATCCGGGTACCGTGAGGGGGGGTTAGTTCGGGTGGGGGAGGCCGCGGG
CGGGATGACGTGGGGGGAAGGGGGATGTCCTACTCGCGATCTGGGAGGTGAAGGGCGGGA
CTTCCGGCGCTGTGGTGCCGCTCTGGGAGGTGCACGCGCTCTGGTTTTGAACACCCAGTA
CTTAGAGGCGTGGGCCCGGCGGCGAGCACCACTTCCAGGCATTAGGAGCATGGTGGCACG
CTTTCCATTCTCCGGGTCTCCAGGGAGGGTTACCCCCATCATTTCCACGGCAGCCTGGCT
TAAGTTACTCCAGGGACGGAGCAAAGACTTGGTTCAGTTTCAAATTAACTCGCCTGAGTA
TTTTCTGAGAACTTGGGGGAGTTTGGATTTGGAAGTGAAAGTTGATGGTATCATGCATGG
TCAGTTACTTGAAAGAGCCTGGCTGTCTGGATTTGTGAGTGCTTCATGCGGGCAGGAGAC
AAACCTTCGTTCTTTAAACCAACAGATCCAGAGACAATGGACCTGATGGGATGGAGCCCG
AAGGCGTCATCGAGGTGAGACTGGACCCCTACTACTACTGTACTTTAAATCTGACAAAGG
TAGAGACACTGTGTCTGCAAGTGTCTAGAGGTTGTGTTCCATGATGGAAGTATAAATTCA
AGAACAGAAGGTTCGTCTTAAATGCATACTAACTCAAAATTAGTGAAGCCCCTTCCATGA
GGATCTAACATTTTTACAGTGAAAAGCAGCTTCTCCCCCAGAGAGGACTATTGGGCACTG
CTTTGGTATAGGCAATAGATCTGTTTGCTCTAGAGCCCAGCCCACTGCTCAAGCTTTGAT
TTCATTGCATCCTACAGAGTAACTGGAACGAGATTGTTGACAGCTTTGATGACATGAACC
TCTCGGAGTCCCTCCTCCGTGGTATCTATGCCTATGGTTTTGAGAAGCCTTCTGCCATCC
AGCAGCGAGCCATTCTTCCTTGTATCAAGGGTGAGACCTTTCATCCCCAGAACATAGACA
GGACTGTCCCAGACCTGGGTGGAGTGGCATCTGGTTGGTAGTGCCCATCTCATATCAGCC
AGGGACAAAGAAACCTCTTGTTTATCCCAGCTTGGCTTTTGATCTGTGCTTATGCCTGGT
TCATGCTTAGGGCACATGGGCACATGGATAGCTGGTTTTCCTTTAATGGGTAGTATTGTA
GCCACTTGGTTGGTTTTCTAAGTGAGTTAATAACATGTCTTTATTTCCTGATCTGTTCCC
ATTGTGTAACTATGGTGATTGGTGAGGTAAAGTTTCTGAAGCATGCTAGATGTGTAATGC
TGGTTGCTAAGGGATGTCATTAAGCCTTGAAAGTTCCATGAGCCCAAAAGTACATAATCC
TTTACCACATTTAATGCCTCCTATTTTGTTTAGGTTATGATGTGATCGCTCAAGCCCAAT
CTGGGACTGGGAAAACAGCCACATTTGCTATCTCGATTTTGCAGCAGATTGAATTGGATC
TAAAGGCCACTCAGGCCTTGGTCTTGGCACCCACTCGAGAACTGGCTCAGCAGGTAAGAA
AAAACATAGCTTCTTTTCCCTCTTGAAGGGCCAATTTAGGGATGACCACTGCAATCTAAA
AGTCAGGGCCGTCAACTCATACCTTGAGGGAAGAAGTGGATGCTTCATAGTAAGAGAAAC
AGGTTGGGCTCAGCGCCTGTGGCTCAAGCAGCTAAGGCGCCAGCCACATACACCTGAGCT
GGCAGGTTCGAATTCAGCCTGGGCCCGCCAAACAACAATGATGCCTGCAACCAAAACAAA
AAAAAAATAGCCAGGCGTTGTGGTGGCAGGCGCCTATAGTCCCAGCTACTTGGGAGGCAG
AGGCAGGAGACTCACTTGAGCCCAGGAGTTGGAAGTTGCTATGAGCTGTAATGCCATGGC
ACTCTACCCAGGGCAACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAGAGAGAGAGAG
AGAAAGAGAAACAGGTTGATTTATAACTCAACACTTGTTGGATTAATTATAAATTATAAA
CTATTTCTTACCTAAACATAGCCACCACTTCACCCAGAATGCACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAGCTGTTTTCAGTAGTAGGGCAC
AGAATATTGAAGGACTAGATTATCAGTTTCAATTTGGGTCTTTTCTATTTTTCTTTTGCT
CAAGACAGAGTCTCAAGCTGTCATCCTGGGTAGAGTGCCATGGTGTCACAGCTCACAGCA
ACCTGAGACTCTTGGGCTTAAGTGATTCTCATGCCTCAGCCTCCCAAGTAGCTGGGACTA
CAGGTGCCTGCCGTAACACCCAGCTATTTTTGTGTTGCAGCCCTGGCTGGGTTCAAACCC
ACCAGCCTTTGGTGTGTGGCTTGTACCCTACCCACTGAGCTATGGGCACCGCCCATACTT
TCTGGGCCTTCAAGGGGAAAAAATCAGAAACAGTCTTAAACTTACTGAGCCTCAGGGAAT
ATTTATAAATATGGGCAGATGTAGTGATATATTCTGGATACAGGTAACGTTAAGTTACAG
CAGAACCAATGCATGCTTTTTAAGTTTGAACATTGCTGTCTAGCTTGAGTTTCTGTGACG
GGTACAGTAGGGCATGGATATATATCATCCATTTCATAAACCTGGTTGTAGTGAAAAGTG
ATAAGCAGGTCACAATTAGCTTTCAGAAACGTTATAGGTTTCTGTCTAGATTAGGAAACT
GGTGGTGCCTGTGGTTCAGTGGGAAAGGGCCACTGGCCCCACAAACTGTGGATGGTGGGT
TCGAACCCACCCCCAGCCAAATTGCAACAAAAAAATAGCCAGGCATTATGGCAGGTGCCT
GTGGTCCCAGCTATGGGGGAGGCTGAGGCAACAGAATCGCCTAAGCCCCAGGAATTGGAA
GTTGCTGTGAGCTGTGACACTACAGCACTCTACTGAGGGCAATAAAGTAAGACTCTGTCT
CTTTTAAAAAAGAAAAACAGGAAACTATTACAATTATTCTGTGGTGCATTATCATAAATC
AGTTGTATCGTTGTGTGTGGGTTATTTGATCTCTGCCTGTTTCTCACCTGAAAAGTGAGT
TCAATAGTAATGTATATCTGAAGGTTGTTGAAAATAGCAAATATATAGGGAACATTAAAA
ATGGGGGCTGGCTGGGCCCAGTGGCTCATGCTATAATCCTAGCTCTCTGGGAGGCCAAGG
CAGGATTACTTAAGCTCAGGATTTCAAAATCTGACTGAGCAAGACTCTCTACAAACAATA
GAAAAATGAGACAAGCAATATGACATGTGCCTATAGTCCTCACTAGTTAGGGAAGTTGAG
CCTGGGAGTGATGTTATTGCTCTTTACCCAGGGCAATAGAGTGAGACACCTATTTCAGAA
GGTGGGGGTGGGACAGGGCTGGTATAGTTACATAGTTGATATGTGGATACCTGTCTTCTC
TGGCCTCAGATACAGAAGGTGGTTATGGCATTAGGAGACTACATGGGTGCCTCCTGTCAT
GCCTGCATTGGAGGCACCAACGTTCGTGCTGAAGTGCAAAAACTGCAAATGGAAGCTCCC
CATATCATCGTGGGTACCCCTGGCCGAGTATTTGATATGCTTAACCGGAGATACCTGTGT
AAGTAACTCAATTTTCCAGCCCCTTGGGTCACTTCACTCTTGTGCATGCTTTCCTAGTCT
TACAGTTTAAGCCAAAGCCATTCCCAAGGATGGTAGTTTTCCCTTCAGTAAAGAGTTGCT
CTGTGATGAACCTCATGCGTGTCATCTGAGCCTGGCTTCCCTGTCATCTCAGCCCAGGTA
GTGTTCTACTTCCCGGGGCTTGTTTGGCTTGGCAGGGAGGTCCTGGGCAAAGGATCAGTT
TCTGTCTTCTGAGAGCAGACCACCTCTCCCCTCCATATTCTTTATCAGGAAAGAATACAT
TTCACATTTTCCTAATTACTACATATGGATGTTGGTATTTTTCTTCCTAATCTAGCTCCC
AAATACATCAAGATGTTTGTACTAGATGAAGCTGATGAAATGCTAAGCCGTGGATTTAAG
GACCAGATATATGACATATTCCAGAAGCTCAACAGCAACACCCAGGTGAGAAAGACTATT
TTTTGTCTTACATAGCAATGGTTTTAGATTACAGTGTAGTTAGGGTAAAGAACAGTATCA
AGTACCAGAGGAACCAACCATACAGATTTCTGGACGCGAACCGTGCAACCGTACTCTGCC
ATTTACTGTAGTTTTAGGCTTGTTGGGGGACAGCAACAAGTGTCAAATGAAGTATCCATC
ACCCTAAGGTTGATTGTTTTTTGCATTAGGTGGTTTTGCTGTCAGCTACAATGCCTTCTG
ATGTGCTTGAGGTGACCAAGAAGTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGG
AAGAGTTGACCCTGGAGGGTATCCGCCAATTCTACATCAATGTGGAACGAGAGGTGGGGC
CCAGTGCAGGAGGCGGGCCTGGTAGTAAGTTGTTGGGTATAGCCCCTGACTGGTTTCTCC
CCCCCCCCACCTCCAGGAGTGGAAGCTGGATACACTGTGTGACTTGTATGAAACCCTGAC
CATCACCCAGGCAGTCATCTTCATCAACACCCGAAGGAAGGTTGATTGGCTCACTGAGAA
GATGCATGCCCGAGATTTCACTGTGTCTGCCATGGTGAATTTTTCTCTTATTACTAGTCT
ACTATGGGTCTATCAGCCCAAGCCAGTCTTCCTGGTGCTTGTGTGACTACTTGATATATG
TTTCTCTTTTCTAGCATGGAGATATGGACCAAAAGGAACGAGATGTGATCATGAGGGAGT
TCCGTTCTGGCTCTAGCCGAGTACTGATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2425..2473, 2777..2909, 3333..3472, 5529..5697, 6055..6164, 6389..6532, 6616..6753, 6854..6928
1001..1023, 2425..2473, 2777..2909, 3333..3472, 5529..5697, 6055..6164, 6389..6532, 6616..6753, 6854..6928
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved