Otolemur_garnettii Locus CNOT1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii CNOT1
Otolemur_garnettii
CNOT1
GeneScaffold_4692
SNORA46
42325..42460
72564
ATATTTCTGTGTTCTGTGCAAGTTATGAAGGACAGTAAACCAAAACTATCAGGTAATGT
TTAGTGCTATGGAGAAAAGTAAATAATGCCAGAGTAAGGGGTCATGGTGGGGCAGGTCAC
ATTGCTTTTTTAGGAATGGTACTTACAAAAGCCTCACTGATAAAGTAACTTTAGAGAAAC
CTTAAGTGAGAGAACAGACCACGTGTAGATTGCTGTAGCTTTCCATTTAGATGGGGATAG
TAAGTAGAAATACTGATAAATTTGAGAAATAGCAAGAAAGTAATGGAGTTCAGGAATACC
ATTTAAATCACTGAAATCATGTAGCAAATGGCAGCTTCATGTGGGTTGTAAAAGAATTAC
AGAGAATTCGGGTTACATTTTGTATTTAAAATTTATTTAAATCTTAAATTTTTTTTTATT
TTTTCCCTCATTTTGCAGAACAGGTTGAAGAACTTTTTTTTTTTTTTAAATGGGTTTTCA
CTATATTGCCCTGGCTGGTCTTGGGTTCCTAGACTCAGGTGATAGTCATGCCTCAGCTTC
CCCACTTGAAAAGTAATAGGACTCAGGTGATAGTCATGCCTCAGCTTCCCCAGATGAGAG
TACAGGCATGTACTACTGTACCCAGCATTTTTTTATTACTGTTTTTTTAAGCTGAAAGTA
AAAAAAATCTTTATTTTACACATTGTCTGACACTACTTGGTGTTTTTGGTGTCGATATTG
AACAAAATGCAGTTATATGGGATAATTACTGGTAGTTTTTTTCCCCCTCTTTCTGCCAGT
GACTATATAGGAATCATATTTAAAACATTGAATTGTAAAATGTAAGCCCTTCATATCAGT
AATTCCTCTATTTCAAAACGTACACTTAATGTAACTTGGAATTTTTCTTTGATGACTGTT
TTTCTTTTTTTCCCCCTCTCCCTCTTTTAACCTTTCTTCACTTTTTTTTTTCTTCCTCCC
TTTAAAACCTTTTCTTAAACTTACACTTTTTGTCTTTTTAGATTGTGAATCGGCACGGTC
CTGAGGCAGACAGGCATTTATTACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATG
GTAAAAGCAGTGGCAAAGATTTCCATCAGGTATTTGGGGCTTACAGAGTTTATGTCCACT
TAGCTCTATTTGTTCAATGAATTGCATTTTAGGCATAGTGTATGTAATAAATGACACATC
CAAAATAACATGCAGAGGTAACCCTTACCTGGATGGGTAAAAGGTGTTAGACTTTTCCTT
CCCTTGTCCTACCTGGCTACTCACCATTACAGCTACCTAGTTCAGGCATAGAGAGCTGGG
GATTAGGCTTGCTTGAAGGAAGAAGGAATGTGAAAATGCCTGGCTTGACAAGTAAGGCAG
AGAGGTAAATCTCATGTCCAGGGGGAATCTCTATGGCTTTATTCTGAATCTGACCACAGT
TCATCATAATATTATTTCTTACAGTAATCTTGTCAGAGCCTGGATTCTGTTTTTTTGGAA
GTTTTGGTTTAACACTTGTTGCTAATAGACTTTAAGTAGTTTAATGAGATTTTTTAAGAA
CTGATTTTGGTAATACATAAACAATATACAATATTAGTTAGTACTTTAATGTTCTGAGAA
CCTCTGTTTCTATTTGTGCAAGATAGGCTAGTGCTAATGAAAATTCATTTTTTATTTTTG
AAGACCCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCG
ACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGGTTGGTATTACTTTTCTC
TTTAGTAGTTCTAAGATTGTTAGGCTCTCTAAAAGCCCTAAGGCCCCCTCCCCTTTTGTC
TAAATTAAGAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTT
TTAAAATAGAATTTGGTTTGTTTCAGAGTTTAAAGCCTGCACCTCATTTATTTGCCCAGC
TGAGTAAAGTGCTCAAGTTAAGCAAAGTACAAGAGGTGAGTGATGTAAGAAAAGAGATAT
ATACAGGTTTTTGGGAACTTAAAAAAAATGATGTAGATAAAATTAAAAATAGACATTTGG
TCAATCTACGCCTTCTTATTTCAGGTAATTTTTGGCCTTGCCCTGTTGAATTCTTCTAGT
TCAGATCTCAGAGGTTTTGGTAAGCATTTTTCTTTTAAAAATACAGCAAATGAGACTTTA
GAAATTCATGGGATTTTAAATGATAAGTATTCATAGTTTGGATTTAGGGAGTAAGATAAT
GTAAGATTAATTTCTCTTAATATCTGTGGTAAAACACATAAAATTTACCTTGATAACCAT
CTTTAAGTATACAGTTCTGTAGTGTTAACTATATTCACATTGTTGTGTAATAAATGTCTA
AGACTTGTTCATCTTGCAAACTTGAAACTATACCCCTTGAAAAACTTTTTCATTTTTCCC
TTCCCCAAGCCAACCCCTGGCCATTGTTCTGTTTATTCCTATCAACTAGAGCTATGAATA
CATTAGGTTGAAGGGGTGAATTTATGAACGAGAAGAGCAAACATCTATATTTTGAAGATC
CATGATTTTTTACTCTTTGTGGTCCAAAAAATAACTTGTGATTTTTGGTTTACTTATAGC
TGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTACATTGACGCAGACGT
CAGTGGAAATCAAGAAGGTGGCTTCCAGGATATAGCAATAGAGGTCCTACACCTCCTCCT
CTCCCATCTCCTCTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAACAGATAGACGC
TTTTCTCAAGACACTGCGCAGAGGTAAGGGAGTCGGTGTCTGTAGCTTTCAATAGGTAAT
TTTCTTGGATGATCACATGTGATGAAACTATTTGGGAATCTAAGGGATATCAGTTATTTA
CTTTCTTTTTCTTATGATTATAATCTTTTAAGGAAGAGACTGTTTCATAATTTAAAATAG
GAAAGTAAAAGAACCTCATTATAAAAAGGTATAAAATGAATATAACTTCACCAATAATCT
TCACATATAAATATGTATAATTACAGATAAGATTTGGTATATATCCTGTACTTCCCCCCC
CAAGGGAAACTACATTATACTGAATGTTTATTTTTTATTTATTTATTTGTTTTTTGCTTT
TCCCCCAAGGCAGAGTCTTACTCTTGTCTCCTGGGCTAGAGGCAGTGGCATCATCAGAGC
TCACTGCATTCTCCAACTCCTGGGCTCAAATAGTACTCCTATGTAAGCCCCAAGTAGCTG
GGACTAGTTTTTGTAGAACTGGCTTGAAGCGATCCTCTCTCCTTGACCTCCCAAAGTACT
AGGATTACAGATGTGAGCCACTTTACCCAGTCGTAACATACTATCTTTAGCTCCAAAAAT
TTGGTACTTTTAATAGACTCACTTTGCTTCCTTGGCTGTTGGCATAATGCTAAAATAAAT
CCTAGTTCTATTGTCACCTCTGATCTTTGTTTTAGAGAGACAAGTAGTCTCTTAAAAACA
AATCTAATAGTTATTTTTGTTTATTTCTCTTAATGTTTACATAGTTCAAGGTTAAACTGC
ATTAACTTTCTTTGTGACAGGAAGCTGTCCTTTTGTCAGTGAAATAAATTGACTCTGATA
TTCAAATTGGTGCTTTCTGATGCGTTTCTTATATGGTTGGTAGCCTTGTGAAAATTTAAA
GTAATATTTAGGGTGTAAACTGGGCAAATCATTATTGTAAATCTTAATATGAAAAAGTTA
CAAAAGTGCTCCCTATGAGGCTAATGTGATATAAAAGGATTCAATTTTAGAATTGGTATT
AAAATTGTAAATTGAGCTAACAAGTTTGAAAACATGAAATAATCTTTGCTTTGATTATGA
GCTTGAGGAAGAAGTTTGGAGAGAATAAAAGAGGATTGTGTTGTTTTTAATTAGTATAGC
AGTTCTAACCTTTTTCCTCCCTCAGATTTTCCCCAAGAACGCTGTCCTGTGGTGCTTGCA
CCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGA
GGGGTAGCTAAAACCATGATGGAGAGCTCTTTGGCTGATTTCATGCAAGAAGTAGGCTAT
GGCTTTTGTGCAAGGTTGGTAGTAAGACATTATTCAATTTCTGATTATTCTTGTGCCAAA
CATGGTATAATGCCTATAAGAAGTTCTTAAGATTGCTTAAAATTAACTTTGCCTCTTGGT
ATTCTGCTTCTAAATGTGAACCTTCCACATACTAGTGTTGATGTCAACTGTATACATCCT
GGGTGTTAAATTTCTATGTCCTTGTCCCCACTAGTTCCTCAGATTTAAGAACCAGTTTCC
TAGCCTAGTTTCTAGAATATTTGGGGGAGGTACATAGAGTGTTGGGGCAAGTGTTTATGG
AACTTTCACCTGCCTAGGGTACTAAAGGAAATTGTTTCACCCTGTTGGTAGCACTTAAGA
TTGAGACATAGTAGATTTATCATTATTTTTCTGGGAGTAAGTTATTAACGGCAACAATGT
GCTTTTCCTTTTTCTTTTCTTTCTTTTTTTTTTTTTTTAAGACAATCTCACTTTGTTGCT
CCAGGCTTGAATGCCACTGTGTCATACCTCATATCAACCTCAAACTTCTGGGTCCAAGTG
ATCCTCCTGTCTCAGCTTCCCAAGTAGCGGGAACTACAGGCACCCACCACAACACCACCT
GGGTAATTGTTTCTATTTTTAATAGAGACCAGGTCTTACTATGGTGTTCAGGCTGGTCTT
GAACTCCTGAGCTCAAGTGATCCTCTGGCCTTTGCCTCCCAGAGTGATAGTATTATAGGC
ATGAGCCACCTCGCTTGACCATTAGGATGTATCAGAATAACGAAACTTACCTTGAGTGTT
AGAATCTTAAAGAATAAGTTTATTCATACTGAGGATTGAGGATGATTGTATATATCATTG
TGAAAGATTCTTACTCTTGGCTCTTCTCTTCTTCCACTGATCTTTTAAACTTTTGCCTCT
TTCTATCTTTTTTTTTTTTTTTTTAAAGAGACAGAATCTCACTTTGTCACGTTCGGTGGA
GAGCTGTGGCATCACAGCTCTTAGCAACTTCCAGCTCTTGGGTTTGGGTGATTCCCTTGC
TTCAGCCTCCCGAGTAGCTGGGACTACAGGAGCCTGCCACAATGCCCGGCTTTTTTTTGT
TGTTGTTGTTATTGTTGTTGCAGTTTGGCCAGGGCCAGGTTCGAACCCGCCACCCTCCGT
ATATGGGGCCTGCACCCTACTCACTAAGCCACAGGCACTGTCCCCATTTTCTTATTTAAG
TAGGTGATTTTTTTATATGCCTCGCAAATAAAAGTAACAGGAAATGAAGTTTATTCTACT
TGTATTAGTAAAACAGGATTTCACACAAGTGTTCATGTAATACTAGCATTTCTTGATCTT
GGTTTTGAGGATGGTAGCATTTTTCTGAAGTTACATTTCTGTTTCAGTATTGAAGAATGT
CGCAATATAATCATGCAGTTTGGTGTTCGGGAGGTCACAGCTGCCCAGGTTGCAAGGGTT
TTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGTATTCCATTACAGGTGTGT
TGAATTCAGCTATTTTACCAAGTGAGTTAATATCTTGTCCTCTTTGTTTTATTTATTAAA
TTACAGTATGATTGATCTGCCAGCCAGAACTAAACATATTAAGTAGTTGGATTTGTTTAA
TTCAAGTTTTACTTCTACAGAGTATCTCTGCTCCTGGCAGTGGTATCTGGAGTGACGGAA
AAGATAAAAGTGATGGAGCACAGGCACACACGTGGAATGTTGAAGTTTTGATTGATGTTC
TTAAAGAACTGGTGAGTACCTCTACTCATGGCTTTTGATTCATGATACTAGTAAGATATA
GTTCAAAGAAAGAAGATTTAATAAATAGCTGGGCTGTTGGCTCACACCTATAATCCTAGC
ACTCTGGGAGGCTGAGGCAGGTGGATTGCTTGAATTCAGAAGTTTGAGACCACCTTGAGC
CAGAGCGAGACTCTGATCTCTACTAAAAATAGAAAAACTAGCTGGACATAGTCATGCACA
CCTATAGTCTCAGCTACTAGAAAGGCTGAGGCAGGAAGATTGATTGAACCCAGGAGCCTG
AGGTTGCTGTGAGCTATGTGATTCCATTGCACTCTAGCTGGGGCGATGGATTGAGACTCT
GTCCCTCCCCGCCTCCTCCCCAGAAGAAAATCTCATAGGCTCAGTGCCCATAGCACAGTG
GTTCCGGCACCAGCCCTGTACACCGAGGCTGGCAGATTTGAACCCAGCCTGGGCCAGCTA
AACAATAGCAATGACAACTGCAACAAAAAATAGCTGGGCATTGTGGTGGGTGCCTGTAGT
CCCAGCTACTTGAGATGCTGAGGCAGGAGAATCTCTTAAGCCCAAGGGTTTGAAGTTGCT
GTGAGCTGTGATGTGATGGCACTCTACCAAGGGTGACATAGTGAGGCTTTTGTCTCAAAA
AAAAAAAAAAAGAAAGAAAGAGAAAATCTAATAAATAAAATGCCCAGGTGAATAAGAACA
GCAGTGTTTTGCACTTCTCCAGTTTTGGCTCAAGAAATAATGAAGCTGGTACAATAGTAG
TAAGTTATCTGAATTGATCATTAGGTTATAGATTGAACTCCCTTTTTCTGCTCTTTACTG
TTTCTTGCTACTGCATTTGATTAGTCTTTAAAAAAAAGGTAATGAAGTATTTGAGTTAAT
TATGCACTAGAGATAGTACATAATTAGATTTTAGTTTTTACATTGGGATTATTGCCTTAC
CATTCTGAAGTGGTGATTTTGTGAGGAGGAGAGAGGACTCTGATTTATTGCAAAATAATG
ACTGAAGAATTACTGAGAGGGGAGGCCTTCTGGATGTTTTCTGGTAGGTACAACAAAGAT
TTTGCTGACTCGTACTGGTGGATAAGGATAATAAAAATTCATACTTATCTTACTAGTTCT
ACTTTTGGGTTATCTACAGACTATAAACAGATAAAGTATAATACCGCTACTAAAATATTG
AAAGGCTTAACCAAACATAAATGAGTGAAACTTAGATATTCAAAGGAAGTGATAAAATTT
AGTGGGGAATAGTAGTAAAGGTATAGTATCTTCAGTCTTGTTTATAAACTGTAACAGTAT
AACAGAAGACTACACATACATAATCATACCATTTAAAATCAGGGATCTTGAAATCGATCA
TCTGTTTTTCATTTTCACCTTCCCGTATTTAGAACTTTAAGATAAAATTCAGTTATGGAG
AAGTAGGCTATTCTTTGGATAAGCAGTATCAGTGTGTTTTCCTTTTGTTATTTTTCTCAA
TAGTAGATTTATTCAGAATATTTTTCATAAATAGAAGGCAAAAATAATATACAATCATAG
CAGGAAACTTGGAGAAAGAAAACCAGAGTTTTATCACTTATCATTGACCACTTAGGGGTT
TGATGTTTATTGTGGTTGTCACGTAAAAGTAAAGACATGCCCTTTTAACTCAGCAGTTCT
GTCTTTGTACTTTATTGCCCAATTAAAAAAATTTTTTTTAAGGGCCGGGCGTGGTGGCTC
ATGCCTATAATCCTAACACTGTGGGAGGCTGAGGTGGATAGACTGACTGAGCTCAGGAGT
TTGAGACCATCCTAAGCCAGTGCTAGACCTTGTCTCTAAAAATAGCCAGCCGTTGTGGTG
AGCACCTATAGTCCCCCTACTTGGGAGGCTGAGGCCAGAGAACCTCTTAAACCCAAGAGT
TGGAGATTACTGTGAGTTGTGATGGCACAGCACTCTGCCAAGGGCAAACAAAATGAACTT
TTGTCTCAAAAATAAGTAAATAAGTACATAAATAAAATAAAATAACTTCCTTTTTAAAAT
TGCAGGTAAGTATAATATTCCATGATATCTGAGGCTATTTTCTTATTCCTGTTTATAGCA
AGTGAGAAAATTAAGTGACTGCTTAATGGATGTTGAACGATTGAATCAGTAGCTTAGTTT
CTTCTTTTTTTTCTCCTCTATCAGAATTTTCTATACAATTTTTGTAGGCAAAGATAAGAG
GACAATTTCCCAATACACGTTGGATCCATAATTTGGTTTTTTGATTATCAAGGATGGGCA
TAACTATAGATTTATCAAGCTTAATCTCTAGGATAATGATATTTAACAGTAAATTTGTAG
TCCTGTTCTGTTACAAGGAGTCTTTGAAATAAATTTAAAGAAGAAAAAATTATTTTCTGA
CAGTTATTATTTCCTTAGAGGAAAACCCCATATGAAGATTATTTTGTACCATATTATGAG
CAAATTTTAAAGTCTTTTTTTTTTTGGTTGCAGTTTGGTCGGGGCTGGGTTTGAACCCAC
CACCCTCGGTATATGGGGCCGGCGCCCTACTCGCTGAGCCACGGGCGTTGTCCCAAAATT
TTAAAGTCTTAATGGCTCAAAAGAAACTAAGCTGGTTGTGACACTTTGGTTGGAACTCTC
CTCTCCTTTTTCTTTCAGAACACCTTGACAAAGAATGTTCAGACCTTTAAATACAAATTG
TGCATAGCCAACATGTGTCATTTTCTTATTTTCCTTTTTCCTTTTGAGCATAAGACATAC
TTATTACTTTTTGTAGGCTGTTTGGTAAATTACTTTCTATAAAATTGTTTTACTTGCTTT
TCTTTAAGGAGTCTCAGACTGCTTTTTTTGAGTACCTTTTCCAGAGAACATCTTTTGAAT
GGAATTTTTAGTCATTTTGACATAAAGAATTTAGATCACTAATGCATACATTGGCATGCT
TTTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCACCCTGGGTAGAGTCCTGT
GGCAGGCATCACAGCTCACAGCAACCTCCAACTCCTGGGCTTAAGCAATTCTCTTACTTT
GGCCTCCCAAGTAGCTGGGACTACAGGTGCCCGCCACAATGCCCAGCTATTTTTTGTTTG
TAGTTTTCATTGTTGTTTGGCCGGCCTGGGCTGGATTCGAACCCACCAGCTCTGGTGTAT
GTAGCTGGTGCCCCTTATTCACTTGAGCTACAGGCACCTAGCCCANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCA
GTAGACCTCATATATAGACCTTGGAAACATGCAGAAGGCCAGGTAAGTTGGTGGTATTCA
GCTATACAAGGGGAACAAAATAATGACTTAATTCCTTATAGAGTGCTATCCATTGATTGA
AGCAATCTTTAAGGTAGAATTTATTTTATGCAGCTCAGGAAAGAATAGAGTGTTGTAAAT
ATTGAAGAAATATTAGCGTAGTTCTAGTACCAGACTCCATTTAAGTATAACAATCAAGCT
GTTTTACTAATAATGTAATGATATTCATCTCTAAGGCCATCTCATCATGCACCTTTCATT
TGTCTAAATTGTCTGTGGTTTTCAAAGGACAAACTGTTAAGATTTTTAAAGGGAAATCGT
CATTCTAATAACCTTAAGCTTAGCCTAATGATAATGTTTCAAATTTTTATACCATTCACA
GTCATTTATGGTGGTAAGGACTTTATTCTTTTGTTCCAGCTCTCCTTCATTCAGCATTCC
CTTATAAATCCAGAAATCTTCTGTTTTGCGGATTATCCCTGTCATACTGTTGCCACTGAT
ATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGTAAACACTCTCG
TGTAGCTTTTCTTTCAAGAGTCACGTCTTCTTTTTTAAAATATAAAATTAATAGTGAACC
ATTTAACAGGTTTAAATGAAACAGTAGTTTTAGTGATCATACTTACTGAAGTTTTCACAG
AGGGCACTGGTAGATAAAATTCTCTTTTAGTCACTTATCACTAGTTACATCTTTGCTCTT
TTAGGTGTACCATTAGGTATTTTCTAAAATACGAAAAGATTGCAACCATCAAATGTTGGA
GGAGGATTTTTACTTCTTCTTAAGATCTTTTCTCTCTAGATTTGCTTGCTTTTTTTCTTT
TGGAAAGTACCCATCAAATCCGATATTTTGAGTTAAATTATCTAGTCTTTTGGAGTTATA
GTTCCAAATTTCTGAGGGAGAATCTGACTCCAGTGTCTAGGTTAGGATTTTCCTGGGACT
CTTTGTCCAGTCATTCCTTTCTGGTGACGTAAGGATGATAAAAGTATTTTCTTTATTGTT
GAAGTATACACTGGGCTATAGGAGGGGACGTGGCTTATAATGTTTGCTGGAGGCATCTAC
TTTACAATCTTTTTAGGTTTTTTTAAAACTATACTCTTTCCCTGGATACTTTTTCATCAC
TGAACAGATTATCCTTATTTTTTGGTGGTAGTGTATGTTCTTTTCCCAAGTGCTAGCCAA
CATTGGATTTGCAAGCTTAACTGATTTTTTTACTGTTGTGTCTAGTATGTATAGAATTAT
TTCCTTTAGATTTTATTTTAACAAATAAGGACCTCTTTATATTAAAAACATGCCATTATC
ACAAATAACAGTTCCTTAAGGTAGCAAGTTGTCTACGTTTAAATTTTCTTAATTAGCTTA
ACAAAGTCTTTTAACAATTTCTACAATTGAGAATTCAGACAAGGTCCACTTAGTTTCTTT
TATTCTGAAAGTTTCTCTCCTATCTTTTTTAAACTTTCTTTTTTGCTATCGATTTAATGG
AGAAATACATCATTTGTCCTCTAGTCTACCCCATGTTATGGTCTTGTTTCCTCGCGGTGT
TTCATTTGTTTTCTATCCTTGTATTTTTTATGGAGTAAGGCTAGAGTTAGATTTTGATAC
TCAGTTAAAGTCAATCAAATTCAACTTCTTGGGGCAAGAGTAATTCATACCGGATATTGT
GGATTTCAAACTTGTATCACACCAGGAGGCACTTAAGTTACACTTTTACATTACTAAAAT
GAATGTTAAGGCTGTATTTTGGGTAGAATTTGTATTATATGTAGGTTAGGACTACTAATT
GTGTAGCTGGGCTCTTGATTATTCTTAAACTGTGCTTTTTTTTTTTTTCACCCTGATCAC
AAATATTTTGATAGGTTTTGGTAAGGAGAGTCCATGATTATGTAGATGTTCAGTAATTTG
TCCTTTTCATCAGTTATTCTTTGTTGATTTGGAATTCCTTTGTCCAAATCTGGAAGCATA
GCAGCACATGTTGTAGAGAGAAACAGCCATTTAAATAATTTCAGATATTAAGACATGGCA
ACAACTTGGTTTTGTACTGATAGTTGGTATCGCTTATTTTGAAAATGAATTTTGTGTACT
TGGATTTTCATTGATAGAGCATTTTTCTTCCATTCTTGTTAGGAAGAGCTTGGATTTGAT
TGAATCTCTGCTGAGGCTTGCAGAGGTTGGGCAGTATGAACAGGTCAAACAGCTCTTCAG
CTTCCCTATCAAACACTGTCCAGACATGCTGGTATTGGCCTTACTACAAATCAACACCTC
CTGGCATACCTTGCGCCATGAACTCATCTCCACTCTGATGCCAATTTTCCTTGGAAACCA
TCCTAACTCAGCTATTATTTTGCACTATGCATGGCATGGGCAGGTAAGACACAAATGTAT
GCTTGTCATGTCTTCATCTAAATAATTGAAATTCTTTGGAATGTTGAGGATGTTCAAGTA
GAGAAATTTAATGTCAGTCTTTGAATTGCTGTGACTTTTGGAGAAGTCATACTGTCATAA
ATCTTGTTATTTTTAGCATCATGGAAGCATTAAAATATATANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNATTAACATAATGAGACTGTCTCAAAAAAAGAAAAAAATTATTTGGGTG
CTGGATGTGGTGGTCAATTCTGTAATTCTGTGCTTTAGGAGGCCAAGATAGCAGGATTGA
TTGAGGCCAGAAGTTAAAGACCATGCTGAGCAAAATAGCAAGACCCCATCTCTACAAAAA
GTAAAGTTTGTTGAGTGTGGGGGCTCAGGTCTGTAGGTTCAGCTATTCAGGAGGCTGAGG
GAGGAGGATCACTTCAGCCCAGGAGTTTGGGGTTATAGTGAGCCATGATTGGGCCATTGC
ACTCTAGCTTAGGCAACAAAACACTGTCTTAAAATTAACTAAGGACTCTACTTATAAATG
AAAAATGGTCATCTTAGTTCCAGTCATCATCTCCTTTCTTAGGGAGTCACTAAACTTGAT
AAACTTAAAGTTTACAAAAGGCCTAACAGAGGGGTCCTCAAACTTTTTAAACAGGGGGCC
AGTTCACTGTCCCTTAGACCGTGGGAGAACCAGACTGCAGGCCCCGGGACGAATTGGCTG
CTAAGAAGGACAGGCAGTGGCAGCAGAAACACCAGTGGGCCAGATAAATGTCCTAGGCGG
GCTGCATGTGGCCCGCGGGCCGTACTTTGAGGACGCCTGGGCCCTAACACATTTAATCGA
GTATTTACAGCTCAGATGTTCTTTATTCCTTCCTTACCACAGCTTTAGAGTTAGAAAGGG
CAGACTGAAAGAAACTGCATCTCCCCATTTGGGGTTAAATACTGTATTTGGACCATCTGT
GTCTCTAGGGCCACAGCTCTAGTAATTGCCTTGGTGTTGCTTCTGTGACAAATGTTCACT
GAGTTCCAGCTGTGTATTTATATCATGCAAGATTAATACTGAAAGCCAGGCTACCTGTTG
GTAGAAAAGAAATTGAATAATTATCCCTCAAAATTTGAACATTTTTGTTTGTGGAAATAG
CCAGATTTAGAATATGTATACAAACACCACTCTGAGAAATAGTGATACAGCTCTATACTA
TGTAACATGTGAAATGGTCACTTTTAACTGTCTTGTCTTTATTTATATGTCAGTAATTTC
TAATTTTAAGTAATTATAACAATGTTCATATCATTTTACATTATATTCTGTTTCTGGTTT
TCTGTTTGTAAATGTATATAAAGCAAATAAGTTTGTTAAATTTTAACTACGACCCAGGCT
TAGGAGCAGGATTCACGTGGAAGATATAGACGTAACATGGATTTCCCATGAAGGCTCGTT
GTGATTTGCATAGTCTTTGAAGCCTGGACTTAATGTCATAAGCACAATAAGAAAAATTAG
CTGGGCATTTGTAATAGAACTGTCACAAGTGTTTAGCATTATTGTTATTTAAGTTTTGTT
TTTCTACTTTTCTAGGACAGTCTCCCTCAATTCGCCAACTTATCATGCATGCCATGGCAG
ATGGTACATGAGAGGGGAGCAGTATGATCAGGCCAAATTATCTCGATACTTGATTGTGGC
CAGACTTGGAGGTGAGTCAGAGGACTGGATGAACTTGACTGATTTATTAGTGGTAAAAAA
TAAATTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCACATAAAGGAGTGATGAGTGCTTTCCTTTTTGTACGGGTTGATGTGACAAAGAAT
GAAGTCAATCCTTTAAATATTTGGTCTAGTTCAGCAGTAAAATCACCTGGTACTGGGTTT
TTCCTTGTTGGCAGATTTTTGAACTTTGAGATTTAATAACTAATTGTTAAGAGTCTATTC
ACATTTTCTATTTCTTCTTCATTCAGTTTCTATAGTTTGTGTCTTTCTAGGAATTTGTTG
ATTACACCTAGGTCATCTGATTTGTTGTTTATATATCAAATAATCTTTCTACTTTCTGTA
AGTTTGGTGGTAACTTAGTCTTTTTCAATTGTTGATTTTGTATTTTTTGTTGGTCAGTTT
AGCTTGTCAATTTTGTTAACATTTTCAAATAACCATCTCTTGGTTTTGTTGGCCTTTATT
TTTCTCCTTTCCGTTTTATGTATTTAAGCTATAAACTTTTTTCATTCTACTTACTTTGGA
TTTCATTTCTTTTCCAACCACAACACCTGCTTATTTTGCTATGCCTTTTTTTTTTTCTTT
TTTTGTGGAGGGATAGGATCTTGCTCTTGCTCAGTATGGTGTTGAAATCCTGAGGATAAT
AAGAATTTACTTTTTTTAGGTAGTCTTACTTTGTAACCCTAAGTGGAATGCTGTGGCATC
ATCATAATTTACAGCAACCTTGAACCCCTGGGTTCCGGCTATTTTCTTGCCTCAGCCTGT
ACCTCCCAAGTAGCTCACATGATGCCTAGCTGGTTTTTTTTTTTTTTTTTAAGTAGAGAT
TGGGGTTCACTCTTGCTCAGGCTGGTCTCAAACTCCTGAGCTCAGGCGATCCTCCGGCCT
TGGCCTCCCCGAATGCTAGGATTATAAGTGTGAGCCATTGTGTCTGGCCTGTTATTTTGT
TTTTTAAAGATCTACTACTGAGCACTATCCAACTATTACTTTTGGACTGTATTTCTCTTT
TTTTTTTTTTTTGAGACAGAGTCTTACTTTGTTGCCCCTAGTAGAGTTCTGTGGCATCAC
AGCTCTCAGCAACCTTAAATTCTTGGGCTTAAGCAATTCTCTTGTCTCAGCTTCCCAAGT
AGCTGGGACTACAGGCACCCTCCACAACCTTCAGCTATTTTTAGAGACTAGATCTCAAGG
TTTTTCACTGTGGCTTAGGCTGGTCTCGAATTTGTGAGCTCAGGCAGGCCACCTGCCTGG
GCCTCCCAGAGTGTGAGGATTACAGGTGTGAGCCACTGCACCTGGCCTATATTTCTCCAT
TCTTGTTAAATTTTCCTTCATGTGTTTTGGGGCTCAGTTTTTAAGTGTGTGTGTTTTTAT
ATTTGTTACATATTCCTGATAGTTTGATTCCTTTATTACTATAAAATGTCTTTATTTCTG
CCAATACTTTTTTTTTTAAATTCAATTCATTTGATATTGTGGTTTCTTCTGGTTAGTGTT
TACATAATATATCTTTTTCTTTTAAGCCCACACAGTGGCTTGATCTAAAGTGTGTCTCTT
AGAGAACATGTGGTTGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCCGGCGACCCGCCGCCCGCGGGAAGCTTGCCGCTCTAGCAATCAGT
TCTGGACCCGCCCAGAGCCCTGGGACGGGGTTCTTCTCTGCCGCCCGTGGGGTGCGCGGT
TCTAGCAAGCAGTTCCAGGCCCTCCCGGAGTGGGGGAGTCGTCCGCCGCCACCGGCGGGG
GTGCGCTAAACTCTAGCGAGTACTTCTGTGGCTGCCCGGCACTGGGGGCTTCTCTGCGGC
CACCCGCCACCCTCGGGAGGGGGGCGGGCCTATTAAGCAGTTCTGGGGCCCGCTTTGTAC
CTGTATTTTATGTTCTTAAATGATCTTCCTTGAATTTATAGCTTGCCGAATTTCTTTCTG
GGCTCAGCTCCCCGTCTTTGATTTCATAGATTCTGATTCCAACCAGTTTTTCTTCCTTTG
TTCAGGAGCCTCTGACCAGGGTTGCTACCAGTCGGCCATCTTCCCAGAATCCCCCCCTAG
GCTAATATTCTAATAAAAATATTTCTTTTTAGAGATGGGGGTCTAACTGTGTTGCCCAGG
ATGGTCTTGGACTCCTGGTCTCAAGCAGTCTTCCCTCCCTGGCTTCCCACAGTGCTGAAA
TTACAGGTGTAAGCCACTGTTCCCAGCCATACTTTTACAGTTTAGTGGCAGTAGTAAAAT
TCTGAATTCAGGAGGGATTATTTAAAATAGTAGGTTCATGTAGAGCTTCTGAGTGTAAGG
GGTCTCATAATTTTATGAAGCATAGAGTTTGAGTGTCTTACTTGAAATGCTTGGGGCCAG
AAGTATTTCAGATTTTGGATTTTTGGATTATTTTACACTACTTATTTGCTAGTTATGCAT
TCCAAATTCAAAGATCTAAAATCTGAAATACTTATTGGAGCATCATGTCACCACTCAAAA
AGTTCCAGATTTTAGAGCATTCTGAATTTGGAATGCTCAACCTGTGCTAAGAACCTAAGG
TAGGAAAGTGAGTTTTTACGTCAAAATTTATCCTACTTTACATTTGTTTTAGAGGTCAAT
AACTTCTTACAGCATGTAGTTACTGGCTAGGTATGGTATTTTTATCTTTATTTAGTATCT
TTGTTTTATCTTTGACTATGACGTAACTAGTGTAAAAATTGCTTGCCAGTTTGCTTTGAT
GTGTCTAGATTTGGACATAAGTTTTGACAGAGTGGTTGAAGATATGGAATGTTTCTTGGA
GAATTTAAAGTATATGCTTGTATTATACTCAGGCAAAAATTTAGCCATGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGTAGCTTCACGGGCCAA
GCAACAGTGCTAGAGCCTATCGACTTGTTATAACTGGGGCTCTTCAGCTCTCAACTGAAC
TGCTCTTTTAAAAACAAGGTACATTTAAGTTACTCCCTGACATCGACCACCCCCTTCTTT
CTGGGAGCAACATACTGCGCTTCTATTTTCAGCTGCATTGAATGGCAGTTTGGGGTTTAA
GGAAAGAAAGAGACATTTTGTGATTCTTCAGTGGCTACTTTATAATAGACATTAGCTTGT
CATTTTCTATAATCATGAAGGTGTATAGTAGTACCACACACTGTGAGAAGCTTGGATGTG
TAGTTATTATTTTAAAAAATATTCATTTTGATGAATAGCATACCTTGTTTTTGTTTTCAA
AATCAGAGCTGATCTTCCCCATCTCCCATAGTTCTCAAGTTTTAACTACATTTAATTTCT
AAGTTTTAATGTTTTCATTTGTGTTAAAAGTTAAATAACTTAGCTTAAGATATTTGTTTT
AAAGTGGGCTTATTTGAAATTGCAAGGACTTAATGCAATAACTCTCCCATGTCATTACTA
AATGTTTAGTAGTACAGCTATAGAGTAATTTATCTTAAGTATTTACTCTTGAGGTTTTGT
AGCTCTCTTCTTATGACTCTGGTATAGCTCGAGCATCCCTAATCTGGAAATCTAAAATGC
TCTAAAATCTGAAACTTTTGATCACTGACATTGACTCTACATGTGAAAAATTCCACACCT
TACCTTATGTTATGTGTCCAGCCAAAAGACAATCCTCTCTTTAATATAAAAAAAGAATTA
TTAGCAATATTAGTATATAAAATTATCTTCAATTTAGATGTATAAAGGTATATATGAACC
ACAAATGAATTTTGTGTTTAGACTTAGACCCTACTCCCAAGATATCTCATTGCATTTGCA
CAAAATTCAAAAATATGGAAAAAAAAAGAAAAGAAATTCGAAACACTTCTAGTACCAAGT
ATTTTCCATGAGGGATACTCAACCTGTACTTTGGCAAAGGCTAACTCTTTAAACCCTATT
CCACATACGACATTATAAGAAAAATAACTGGCACATTTGACTTAACATTGGGACATAAGT
ATTGTTATGATTGTGTGGGTGTTGTAGTTTGCTTATTAAAAAGTAAAAGCTGTTGCTAAA
GGTTGCTTTACCTGTGTGATGTCCTTGACATATGTGTAATACATTTTTATAATGTTTTTC
TTTAGATTGACCCACTTGCTGGAATGGCATCTCTTAGTATAGGTGGTTCAGCAGCCCCTC
ACACTCAGAATATGCAGGGTTTTCCTCCAAATTTGGGTTCTGCATTCAGTACCCCTCAGT
CACCAGCAAAGCATTTCCACCCCTTTCAACCCCAATCAGACAACAGCTTTCAGTGGTATT
GGAGGACTTCTCATCACAGCTTTCCAGGTAAAGGAGGTTGTGACTGGGAACCATGGAATC
ATCTTGTAACCTTCCATAGGGCCTTAATGTATGGTAGGAGTGTGGAGTCACTGCCTGTAG
CTCAGTGGGTAGGGCGCCAGCCACATTACACCCACCCTGGGCCCTGGCAAACAACAGTGA
CAATTGCACCAACATAAAAATAGCCGGGTGTTGTGGTGGGCGCCTATAATTCCAGCTACT
TGGGAGGCTGAGGCAAGAGAATTGCTTAAGCCCAAGAGTTTGAGGTTGCTGTGACACCAC
AGCACTATATTGAGGGCAACATAGTGAGACTCTGTCTCCAAAATAAAAAAAGCTGTTTAA
ATGAAGTTGTATAGCTGCTTCACCCTTCAAAGTTGGGAAAGAGAAACATACTAGTATATT
CAGTTCAGTGTAATTGGAACAAAGAATTAGGATATTTGAGTTGTAAAGTTGGTCAAATTA
TTCATCAATAATTCTGCATTACCAAGTGGTAGTATAACAGTAACTCATGTGTTAATTATG
TATTCTAAAGAGCTTAGGTTATGAAATCACAGCTTTATGAATTATTTAGGTTGGTATAAC
AAAGGTAGAAAGATCTACCTGTACATCTCAGATTCAGACATAAATTACGCCTGCTTTGTA
CTTCACAAACCTCAAAAATGATAATAAATCCCTAAATCTTTGCAATTTTTTTCAAGTATT
CAAGTTTCATAACTTGACATTGAAATAAAGGCTGTTGTTTTTTCCACTTGTGCCTACTTT
GAGCTTTCTATATTTTTTATGATTATAAGTTACGGTACTAAACCTAAGGACTGAAATGTT
GTCATGATTCTGTAATCTAGTTAATACTGCTGGTTTTTGGTCCAAGCCTTGATGAATCAC
TTAAACCAAAGTTACTGTACTTATTAAGACCTTCCTAGTGAAGCTCTATTATTAGTATTC
TGTTTGTTGAGAGTTGAGAGGAATGAAGAAGTTCTGACTCATCATGAAATTCTCCAGTTT
TAATCTCTGAGAAAGACAAGGTAGCCCCTTATTTTGTCTACTTTAGGTAGGCTGGTATGT
GCCTTGAGAGTGTATGCATTGACATTTTTGCATATTATTGATTAATAAAATAATTTTAAG
TGCTGAAGAAATTTTGGCATTATTCATTTTTGCATACTCTTGCTAGTTTTCATTCTCTAT
AAAATTGAATAGATGTATAGTAAGGGAATTAAGAAAGACCCTGACTTTCAAACAATAACT
TATATCTGAGATGTGAATGAAGTCAGGTATATGAATAATGATAGGGCTTTTGGCTGGCTT
CATTCTCTCTAGTAGGTGGTCTTGGCACAAGCAGCCTGGCTGGTATAGGAACTGGGACTC
TTGGACTCCCTGCTGTGAATAACGACCCTTTTGTACAGAGGAAACTGGGCACCTCTGGAC
TGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTGTAAGTGGTAGTGTTGTCTGT
GATTGTGAAGTGTGACTGAAGCACATAATTTTTTTTCAATTGTCTTATTTGTTGTCCCTA
GAGTTACTATGAACAAAATACTGATTTATCTTAATATATTGTTAGTAGGGCCATATGTTG
ATGTGCCTCCTAGACCAGTGGGAATAAATTCATGAATTTCAAGTGTTAAAAATTAGAGGT
GTATTTCAGCTTTTGCTCTGGATTCTCAGAAAAAAGTAGTGGTTAGTAGGAGGCAGCAAC
CTGACAATGTTATTCTGAAAGTAAGAAGTAGGTATGGTAAAGAGAAAAGATTTAAATATA
TAAGTATAAATCTTGTACTTCATGTTAAAATTTGTTGGGTTTGTTGGGTTTATTTTTAAC
AAGTCAGGACCAGACATGAGAATTCTGATTTTTGTTTTCAGCTTGGTAGGTTATAAAGTA
AATAATTGTTTTAAGGTTATAGCTTTATAATATATATACTCTTATGTCATAAATATTGCC
ATATAACATTTATATATATGTATATATATGATACAGTATGAAACCAGTTTTTAAAGCTTC
ACCTCCTTGGTAATTTCACTGTCCTAACTAAAGAGAGAGAAGTTAATACATAGGTGTATT
GACTTACAAGCCTTTGTCATTGTGTCTTGATGCTGTTAGTGTGAAAGACTTGTCTGAATG
TTATGTTTTGTAGCATGCTTTGTGTTTATATCAGTCTGCTATGCACAATACATTGATAAT
TCTTATATGTTAAATGCAATTTTTATTACAAAGCAAGTAAAGACTTGTTAACCTCTGCTG
AGGTTGTATTAAGGGTAAGTGCATTATGAGTTTGATATTAGTTAACTTTTGTACTATAGT
AAGTCTCAATGAAGAAAATGTTAAAGTGAAACTAAGGCAGTCTTGTTAAAGTTATATTAT
ATCTTTACCTAGAACACGTCACTTGGCTATTTAATACTGAACTTATATAATTTCTTATTT
TTTTTTTTAAAGTTAGACTTACACTGGTGTCTCTGGCTCTGTAATTTTATGAGAGAGTAG
AGGAAGGGCTTAAGTGATTACTTTTCTTTTTCCAACAGCGGACTTGTCTCAGGTGTGGCC
AGAGGCAAACCAGCACTTTAGTAAAGAGATAGATGATGAAGCAAACAGCTATTTCCAGCG
AATATATAATCACCCACCACATCCAACCATGTCTGTTGATGAGGTGAGTGTCTAGGATGA
TCTAATTATTTATTGTTTTAGGCCAGTCTTATGCACCCTTTCAGGGTTTATAGAATCTAG
CTCTCAAAGTGTTTTGATGTATTTATGTATCTTTTGAAACTGTAATATTTTTTCTGAGTT
AACAGTCTTCTATTAAGAGTATTTGAGGTAAGTTCTTAGTAATGGATTCCTTTTCTGTGT
GTTGTTTTTGTCTTTTCTAGGTATTAGAAATGCTGCAGAGATTTAAAGACTCTACTATAA
AGAGGGAACGAGAAGTATTTAACTGTATGCTAAGGAATTTGTTTGAAGAATATCGGTTTT
TTCCTCAGTACCCCGATAAAGAATTACATATAACAGCCTGCCTATTTGGTGGGATAATTG
AAAAAGGACTGGTCACTTACATGGCACTGGGTCTGGCCCTGCGATATGTTCTTGAAGCCT
TACGCAAGCCTTTTGGGTCCAAAATGTATTACTTTGGGATTGCTGCACTAGATAGATTTA
AAAATAGGTAAGTGGCTAATTTACCTACAAAACTTACTTTCTTGATAGAAGGAACAGTAA
TAACATTTATCAATTACTGCGTGTCAGGCCTCATTATTATACATATACTAACATCTTACA
ATGACAAATAAAAGAGGAAGAATAGAAAACGTTGCAGGTCACTATAATTATCAATTAAAT
TGTAGGAAAACTAAAATGAGATAGTAGGGTTTTTTTTGTTGTTGTTGTTGTTGCTGTTTG
TTTATTGAGGTATACTATACTATATGTACAATACCAGTCACCCTTTTTTGGTATACACAG
TTTTGACAAACTTATACAGTTGTGTAACAAATACCACAATCATGAAAGTGAATATTTTCA
CACTCTTTCCACCACTTCTAGTCTGGTAATTGCTGATTTCTATAGTTTTCTCTCTAAAGT
TTTGCCAGAGTCTCTCAAAAAGAATCAAACAACAAGTATATGGACATATAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTAATGCACTTCTGGGGTAC
AGTGTGTGTTTTCACAAACAGTCCAAAACACTTCCATCAAACTGGTCAACATAGCCTTCA
CGTAATTTTCTTAGTTATTGTGTTAAAACGTTCATATTCTACTCATAGAAAGATTCACTT
GTACCCTTGTATGATGAACCACAGAAGTGAACCCTCAAATCTCCCTCCTTCCACCCATTC
CCCCTCCCTCCCCCCTCCCCATATCCTTAGGTTGTTATTAGGTTATAGCTTTCATATAAA
AGGTATAATTAGTTTCATAATAGGGGTGTGTACATTGGATACTTTTCCCTCCATTCTTGT
GATACTTTGCTCAGAAGAACATTCTCCAGCTCCATCCATGTGAACATGAAGGATGTAAAG
TCTCCATCTTTCTTAATGGCTGCATAGTATTCCATGGTGTACATATACCACAGTTTGTTG
ATCCATTCGTGGATCGATGGGCACTTGGGCGTTTTCTGTGACCTGGCAATTATGAATTGG
GCTGCAATAAACATTCTGATACAAATATCTTTGTTGTAATGTTAATACAATTCAAAACTG
TTATACTTAAGACTCAGACCAATGTTTCTTTAAAATAGAACCTTTCTTACCACTTGCTTA
GATTCCTTTGAAGTGCTTATTTTATAGGATGCATTCCATGGAATACATCCATGTGCTCCC
AGGGAATACACATTTTAAGCCATTTTGAGTGATTATCATTGTTCTTGAAATTAAGAACCA
TTGTGTTAAGAGACTGATTTTTGGCTTGATGATGAACCTTTGTCTTTAGCTTTTGGTCAA
TGCTGGCTTAGGTAGAACAGGAAAGTTGGTTAATCTTTGTTAACTTGTAATATTTTGGCA
TTTTTTCCTATAAAGTAGATAAATGACTTTAAGATCATACTTTAAGGAATCAGAAAGATT
GGAATTTGAACCTACTTGAATTCTATATTTTATTTTAGTCCAGCATTTTCTCCCTCATCC
TTCTGTATTTATTAGGCAGGCAGGAGTATTGCAATGACTTTATCTAGGGGACCATGGAGC
AGGAGGCAGGAGTGAATTCATTCAAGTGAATGAGTGGGTTGAGAGGAATTCAGAACCAGG
AATATGGAGATTAAAAGACTAGCAAGCAAGGGGCGGCGCCTGTGGCTTAAAGGAGTAGGG
CGCCAGCCCCATATGCGAGAGGTGGCGGGTTCAAACCCAGCCCCGGCCAAAAACTGCAAA
AAAAAAGAATAACAGCCTAAGAATATGGGGGGGGGGGAGGATGGGGGAATGGGTGGAGGG
ATCACTTCTATGATTTATCTTAACAAGGGTACAAGTGAATCTTTCTAAGAGTAGAATGTG
AACGTCTTAACACAATAACTAAGAAAATGACATGAAGGCTATGTTAACCAGTTTGATGAA
AATATTTCAAATTGTATGTGAAAACACCACACTGTAGCCCAGAATTGCATTAATGTACAT
AGTTATCATTTAATTAAAAAAAAAAAAAAGAAAGAAAGATTAGCAAGCAGACGGGAGTGG
TCAGTCATGCAAAACTGGGCCCCAGACCAGTAAGCAAACTAGAGAGGTTATCGTTTATTT
TTGTATACTTTGTCAATTTCAAAGGGGTAGCCTTCAGAGATTTTCTTTCTTAGTTTAATA
TATTCTTTAAAAGATAAATATTATATATGTAGATGGTAATTTTAGTTTTGCTATGCAAGG
ACCATTGAAATAGTCTCAGGAATCCTTTGCCAGCCTTCTAATTTGTGTGTGTGGGAGGGG
ATGGGGGGTTATTATGGGTCTCTAAAGAGAGGGGAAAGAATCCTGCCCTATAACACCCAT
TATTGTTGTTGCTTACCCTTAAGTTGGCTGGACTATGTATAGTACTTTTTGTTTTATTTT
TTGTAGTAACAGTTTCATTGAGATTTAGCTTACTGCAATGTGTTTTTTAGGATTTAGCTT
TCTTATTAGTGTCCAGTGGGTTTTAAAAATAAGTTTACTATATAAATTTTTAACAGTTTT
AAAGTTTGCATTTATTAAAGGACTTAAAGACATTTATATGCATATATTTGATGCTGCTTT
TGGGAGAGTTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCAATCAAATATGACTCAAAGGTAAGCATGATGTTATAGTGCATAAACGCCCTT
TCTTCTTTTTTCTAATGAGTTGAGGGATATATTTTTGACCCTTTGCAATAATCACTTTAA
AGGCAAGGGGCACTTGGACATCCAGCTAGTGGTTGTGGTTTTAATAAACATTAATGTTGT
GTTTTGCAGTGAGTTACAGGCTTTTTGAAATAAATTTAATGTTCTCATGGTGATGGAAGG
TTACATTTGTACTTTTGGTAATAACTCATTTCCTTTCAGAGATTATCCATAGTAGTTATC
AAATCTTATCAACTGAGGTAGACATTGTGAAAAGCCTCAAGAATGATACTTGCCTCCTAA
GATTATATGCTACACATTAGTTGACCACTGAACAATGTGGATGTTAGGGATGCCATTCCC
CTACATGGTCTAAAATTCAGATACAATTTTTGACTCACTAAAAGCTTTGCTATTAATAGC
TTACTATTGACAAGAAGCCCTACTGATAACATAAACAGTCAATTAAAACATTTTGTATGT
TATGTGTATGATATGATGTATCTTATAATAAAGTAAGCTAGAGAAAATAAAATGTTATTA
AGAAAATAATAAGGAAGAGAAGATACATTTACTTTTAAGAGGGTAGGGTCATCATAAAGG
AGTTCATCATCGTTTTCACATTGAGTAATCTAAGAGTAGGAGGAAGAGAGTGGTTCTCTT
AAGGATGGCAGAGGTGAAAGAAAAATCTATGTAAGTGGACTCAAAGTTTAAATTGATGTT
TTTCAAGGGTTAGCTGACCTTAGAAATGTCAGTGTTAACCAATAAGATTGGGCCAAACAA
GTGGATTTTAAGATGTAACACAAGTACCATCTTTCAAAATTTCAGCATAATTGGCTGGGG
AAAAATTGAGGTCTTCTGTATCCCTTTTGGAAAATTCCAACTTATAGATGATTTCGGGAG
ATGAAATTTTTGGGAAACGTTTCTGTTGTTAGATCTGCTTGATTGGCAGGGTTGTAGATT
TAGTGATTTAAAGTGAGGGGGCGGGCATTGCATATTTGGGTTTTGTTTGTGTATTAAGAC
GAAGTCTCCTCATTCTGTTACATACACTAGTGTACTGTCATAGAGCTAAAATGCAAACTC
CTGAGCTCAAATGATTCTTCTGTTTCAGTATCCCGAGTAGCTGGGACTATGGGGCGTGTA
CCACCACACCTGGCTATTTGTTAAATTTTGTATAGACGGCTCTCACTTGGTTGCATAGGC
TGGTCTCAAACTCTTGGCATCAAGTGATCCTCCTGCCTCAGACTTCCAACATGCAGGGAT
TACAGGCATGAGCCACCTGTACTTGACTATATGTATAATTTTAAAGCTAAAAATGACCAT
ATATGTTTCAGTCCTAAGCACCCACAGTTTGAAGTATGATTATGAATTTGAACGTACTTT
TCTTTACAGTATCTATCTGATGGGGAAAGCAGCTGTTTTAGCATCTAGTTAATTTAGCAG
TGAATCACATGCAGTAGTCTGTTTCACAGCAACTAAAACCTCATTTTATCATTGTGTAAT
TTTGTGCTTCTAATGTCGTACTGATTGGCTAGGTTGAAGAGTTAAAGGAGACTGTGAAAG
AAGAATTTATGCCTTGGGTCTCACAGTATCTGGTTATGAAGAGAGTCAGTATTGAGCCAA
ACTTTCACAGCCTGTATTCAAACTTCCTTGATACACTAAAGAATCCTGAATTTAACAAGA
TGGTTCTGAATGAGACCTACAGAAACATCAAAGTAAGAATTGGTTCTTGTGCTTTCTTCT
TTAATTATTGCTTTGAATTTGTAAATACTTGATTGTAGAAGTAGAATTTTTGCGTTCTTC
CGTATTAGGTATCTATGGAAATTGGCTGTAGGTTTTGTTTCAAATAGAGAAATAGGAAGA
ATTTAATCTTGCAAGTATACCCTATTTTGGTGGTGTTTTTGAGGCAGAGCCTCACTCGTC
CCCCTGGTGTCATCATAGCTCTCAGCAACCTTGAACTCAAGTGATACTCCTGCTTCAGTT
TTTCTAATCTCCCCCCCCCCGCCCCCCACACACGTAGAGAGAGGGTCTTGCTCTTACTCA
AGCTGGTCTTGAACTCCTGAGCTCAAGCAGTCTACCCTCTTCAGCCTCCCAGAGTGCTAG
GATTATAGGCATGAGCCACTATGCCTGGCCTATAGTCCCTCTTTTTAAAATAGAAAAATT
ACTGTATGGATGTATATTGCTTTTGGACATTTAGGTGGTTAATCATGTTAACTAATATAA
ACAATACTACAGTGAATGTTTTCGTTTGTATCAGTAGTCAAGTGCTTGATATGTATAGCT
ATTTGTGGAATAGCTGTTGTCTTGGATTCTTTGTTACTTATTTTAAAGTCATAATCTTTA
ATGAGGTCATACGTACATTCAATACAATTTATTTTAATTTCTAAACTGTCACTTATTTCT
CAGGAGGAAAATCTTCTATTAGAAAACAGTGTGAACCAACATATAGCTGTGATTATTCTT
TGCTTGGGATGTTGGTTTAGGAACCAGCACTATATTTAAAACTGTGGGTGGGAATTTTCC
TCATTGTTGGTTATGCTGTAGTGTGAAAGAATTCCTGGCCTTTTTTCTCCACAACTGACT
TACACCATTCTGCTGTTCCTATATGGAATTAAGGAGCATGGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
TACTTGAGGCTTATTTTTAGAAATGTGCTTTTTTCGAGCTCATTCTTTTATTGTGTAAAA
AACATGTAACATAAACTTTATCATCTTAACTATTTTTAAGTGTATAGTTTAGTAGTGTTA
AGTATATTCATACTGTTGTGAAAAAGATCTCCTGAACTTTTTCATTAAGCAACACTGAAT
CTCTGTACCCATTAAACAATAATTCTCTTTCCTCAATCCCTCTGGCCTCTGATAACCACT
GTGTTACTGTTTCTATGAATTTGACTTTAGACACCTCAGATAAGTGGAACTGTACAGTAT
CTGCCTTTTTAAAAGATTTATTTTTTAGGGGCAGTCTTATTCTGTCACCAAGGGTAGAGT
GCAATGGTGTTATCACAGTTCACTGAAGCCTCAAACTTTGGGGCTCAAGTGATCCTCCTC
CCTTAGCCTCCTGAGGAGGTGGGACTATAAGTGTGCCACTGTGCCTGGCTAATTTTTTAT
TTTTTGTAGGTGGAGTTGGGTGTGCATGCGTGTGTGTGTGTATGTGTCTGTCTCAAATTG
AGGCTAGTCTCAAATTCCTGGCCTCAGGTAATCTACTTGCTTCAGCTTCTCAAAGTTCTG
GGATTAGAGGCATGAGCCACTACACCTGTACTTGTGTTCTATTTCACTTAACATAATGTC
CTCAAAGTTCATCCATGTTGTAGTATGTTACAGCATTTTCTTTTATAAGGCTGAATAGTA
TTCCATTGTATGTATGCACCACATTTTGTTTGTCTGTTCTTCTGTCAATGGGCATTTGGG
TTGCTTCCACCTCTTGGCTATTGTAAATAGTACTGCTGTGAACATGGCTGTGCAAATATC
TCTTCCAGATCCTACTTCCAGTTTTGGGTACATGTGGGACTGTCATATCATAGTTCTGTT
TTTAACTTTTTGAGAAACTACCACACTCTTTTCCATAGTGATTACACCATTTTACAATTT
CACCAGCAGCATGTAGGAGTTCCAATTTCAAAGTGGTGTGTCTTTATCTTGCATTTGTTT
GATGACTAAGGACGTTGAGTACTTGTTCATGTTTCTTGTTCATTTAGATCTTCATTTTTA
TAAGGTATCTGTTCTGGTCTTTTGTCAATTTTCCTAATAGCTTATCTGGATGAAGTCTTT
ATACATTCTAGATATGAGCTCTTCATTGGTTATATTTGTTCCAAATATCTTCTACTATAT
GGTTTCCTGACTTGGGATCACCAGGCTTTCCATTGGCCAAGCGGGGAGGGCCCAGAAAGC
TGGGTTGTACCAAGGAGACTCCCATCCTCCTCATCTCCCGCTTGGGTAATGGGGACTGCT
GCTGTGGCAATAAAGGGTGCTGATCTGCTCTCTCGTGTGGCTGTGGCAATGGCTGCAGTG
GGATGGAGGCAGAAGAGCAGCTCGTTCTTTTTTTTTTTTTTTTTTTCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATTTCAGGTGCTCCTGACCTCTGATAAAG
CTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGACCTTGGGACATTGGTTAGGAATGA
TCACATTAGCTAAAAATAAACCCATCTTACACACTGTAAGTTTTAACTAAAGGGTTATGT
AAAGTTTGGGAATATTTATGCAGTGTATTGTGACAAATTCTTGACTTTGGAACTATTTTA
ATGATTATTGAGTTTTTGTAAGATTTTGGCCCATGTTTTGAATTCCTGATTATACCTTTG
GGGCCCTACATCTTTTAGGATTAAGAACATGCCCCCAAGATATACTTTTCATGCCCCACT
TACTGTTTGATAAGGCAAAACTTGGCTGTTAGGTTTGATCCTGCATTCCTGATTTTGGGG
GATGAGCTTAGCAAAATACCTTTGTTTGTAAGGGCTTTTGGAGCCCCTTTTTTTCTTAGC
TTTTGAAAATATTTTTTTCAATTCTAGGACTTGGATGTGAAATCTTTGCTGCTAGAGGCT
TATGTTAAAGGACAACAAGAATTGCTCTATGTAGTGCCCTTTGTTGCCAAAGTCTTAGAG
TCTAGCATTCGTAGTGTGGTGAGTAGATTTTAATACTTTGTTCGTGGCTAATTTTACGGG
TCAAGAGATAGTAGTCTTAGTTCTTAAGAATTTAAAACTGGTGAGTTCTGTTTTCCTCTG
TGAAACTTGATATTTCTAATTTGAGAGACTAGGTGAAATTTTAGGAAACATTGTAATTAA
TGGTTTTGGGTTTTGGTGCTTTTCTGAAATATGATATAGGTGGGATGGCTAGGGGTCCAC
ATTGGTATAAATGTTAACTGTGTCAGATGATGCAAATTAATGCTTTGGGCCAGCTTAACA
TAATATCTCCCCCCCCCCCCCAGGTTTTTAGGCCACCAAACCCTTGGACAATGGCAATTA
TGAATGTATTAGCTGAGCTACATCAGGAACATGACTTGAAGGTAATTTGTTGTTTATCTT
TTGGAATATTCTCTGCCTTCACATCATTAAAATTTCTAGTAAAGGCAGACAATATTTTAG
CAGAAGTACTATAACAACTGAGTTGGGAGTAGAGTATATTATGAATAAAACTGAATTTTT
CTTTTTAAAATTCTGATCAAAATACTGGAATTATGCAGTTAAATTTAAAGTTTGAGATTG
AGGTCCTCTGCAAGAACCTTGCGTTAGACATCAATGAGCTAAAACCTGGAAACCTCCTCA
AGGATAAAGATCGCCTAAAGAATTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCA
AGCAGCCAGAAGAACTCCCCCCAATTACAACCACAAGTAAGTGTGCTAATTATTCTAGAC
ATTTGTTAACCAAACTGTTCTCTTAAATGGTGCATTTCCATAAATATAGGGAACTATAAT
TTTCTTACCTAGTATGGTGCTAAAACTTTGTATACTTTCTATTATAAGCCTTCCACATTA
TCAAGTAAAGTTAGTGTTGAGTAGGCCTTTTGTCAACTTACTAGATTTCATCCTAGCAAT
TCATAAGACATTCTTAACTAAATATGAATCAATCAGTTCCTCATACCCATTGTCAGGTTT
GGAAATCAGATGTCAGGTTCATGTTCCCTGGTTTTGGTTCCTGGTACTGAAGAATGGTTA
GTGGTACCAAGTTCAGGAAACAAATGAGCGAGTCAAACAGATGTAAACAAGTAAAAGTGC
CAACGTCTATTAAAGCATCGTACCTCCCAGAGAAAGGATGGATCAATCTCCATAAGAGGA
CAAACCCTGAATTTAAAGACAGAGTATAGAAAGTACAGTACACTCTTAAGTTAGTAGAGA
GCAGACTACTCTAATAAGGAACAGCAACTCCTGAAGGTTAGAGTCTGTACTTTTGTGCTA
ATCCCTAACAATATTTTAAACTGGGGGGTGGAACATTTATGTATTTTCTGTGAAAGGGCT
AAAATATTCCCAGAACTGGGGATCCCTCCCCTTTCCTGACCTTATAAGGAAACTTCCTAG
GATTGCTATGGCATTTGTAAACTGTGACTTTTACTGTATGAATGAGGGTAGGTCACTTGA
GGACACTGTCACCTTGTTAAAAGCATGCTCCAAAAATCCCCTTTTGTATCCTTGATCAAA
TTGGTTCTCTGCCTCTCTGCTTGGTCAGTCCTGAAGACCTCTGTAGTAGACCAACATCTA
TCAGTCCTTGGATATACTCCTCGACTAGGCATCTATTTCATCTGGTTAATTTGTTCTTTT
TGGTAGACAAAACCTCTCCTAGTGCCATGTGCTCCTCCTCTTTTCTCTTTTCTCTACCTA
ACAGCATTTAGGCCAGATTATCTCTTATGTTATTTGAAGTCTTAGGAATAATTGCATGGC
ATAGTGGCCTTTGGTATTCCTCAATTTGGGGGGATGGTCAGACAGGTAGAAAATTATTTT
ACCTATATCAAGAGGATTGGAGGTGTGGTGGTGATGACAGTATGTGTAGAGGTTTTAAGT
GACAGAGCAGTGTGATTAGAATAAATTTGCTTTTCTTTCTCTCAGTCCCTAGCAGCCAAG
AATCGCAAGGTAAACCAGGGAGAAGGTGACCTTGAAAATAGACTTATCATATATAGAACA
TCTAAGCCTATAAGACTTGGGCCTGCTAATGTGGCATAACCACATAATTGATTTCTATGC
TATGGGGCACTGTCAGGGCATCGTTTTAATGCTTTGTTTACATCTCTGTTAAAATAACAG
AATATCCCTTTCAGGGTGGGAAAGATAAGACCTATGAGATCTCTTCCCCACTCCCAACCC
TATTAGTGTAACTAGTTGATGACCACTCACTGTCCAGCTAATTTTATAGTAAAGTCAACA
AATTTGCTCTTTTTATCTCTTATTACTTTTAGCAACTTCTACTACACCAGCTACCAGTAC
CACCTGTACAGCCACAGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTGTA
TTCCCTTGCAGGCCTGGCACCACACATTACTCTAAACCCAACAGTAAGTAAATAGTGCTC
CATTCCCCTAAGTCCTAGTTTGTGACAAAGTGAACTGTTTGGTTACCTTCTCTCCCCTTT
CCCCATGCCCTCTAGATTCCTAGGTTGTAGACTTTGACGAGAGTAGGGGTCTGAAACTGT
TATATAGTATAACTGGAATTTTGTTTTACTTCTCTTAAAAAATAGTCAAAGTGACAAGAC
ATTGTTTATATTGGTTTCCCATATCCAGTAAGTTAAAAGGACTAAGGTTAGTATTAGAGT
ATAAATTAAACCCAAGATAAAAGATCAGAAATGGCTTTTCAGATGAGCAAAGAGGCACTG
TAGGAGGCACTGTTGCTTGCTATGTAAGGATTATTTGCAGCATAATAAATCATCGCACTG
TCTTTGAGTCACAGAGTCTCACTATGTCACCCTTGGTATAGAATGCTGTGGCTATCACAG
TTCACAGCAACCTCAAACTTGTGGGCTTAAGCAATTCTCTTGCCTCAGCCTCCCAAGTAG
CTGGGACTACAGGCACCTGCCATAATTCCCCCGGCTATTTTTTGTTGAAGTTGCCATTGT
TGTTTAGCTGGCCTGTGCTGCTGTGTAGGTGCATGTGGCTGACGCCATAACCACTGTGAT
ATAGGCACCAAGTCAGCAATAATAGTTTTTGTAGGAAGTCTTTTTTCTGTAAACTTGATT
TCTCTTCACATTTTTGCAACCTAATAAAGGGGTTGCTATTTTTTTAGAGTATTTGAGCCA
TAAATCTTATGGAAACAAGTAGGTGTCTTTAAGCAGCTAATACATCTTAATATTATTATG
AATAGTTTGCCCATTAAACTTAAGTTTTTAAAAATCACATATACCTGTCACCACAGGACA
TGTTGAATGCCTTCCCCTCTGTTTACCCCAGCTTCTGTTTCCTGAGTTTTCATTGGTTGA
TTTTAAGTAGAAATTCATAGTTTTTGGTAACCTTGAAGTGATTGCCAACATTGTAAATAT
AATGTGATTATCAGTAGAAATTGGGTTGTTTCGTTGAAATAAGCTATCAAACTATTGATT
TATTTTGCTTCTTTCTCTGCCTAGATTCCCTTGTTTCAGGCCCACCCACAGTTGAAACAG
TGCGTGCGTCAAGCAATTGAACGGGCCGTCCAAGAGCTAGTTCATCCTGTAGTGGATCGA
TCAATTAAGATTGCCATGACTACTTGTGAACAAATAGTCAGGAAGGATTTTGCCCTGGAT
TCTGAGGAATCTCGAATGCGAATAGCAGCTCATCATATGATGCGTAACTTGACAGCTGGA
ATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGTATATCTACAAACCTGAAAAAT
AGTTTTGCCTCAGCCCTTCGCGTAAGTTGGTTATTCCTTGGTGTAGTACAGAAATTCTTA
ATAGTTGCTGTATTTGGCTAATGTTTTTCTTCCTTTTAGATTATAAATTTTTTGAGGCCA
AGCATCACGGTTTATCCTCACCCCTGTTTGCTGTTGTATTCCGCGGCACAGTGTTTGGCA
AATAGTATAGATACCCAAATATTTGTTGGTTTACATGAAGATTTAGGGCTGGATGCTATG
ACTCAGACCTGTAATCCCAACACTTTGGGAGGCTGAGATTGCTCGATGCTAGGAGTTAAG
CACCACCCTGGGCAACACAGTGAGACATTGTCTCTATAAAAAATTACATAATTAGCCTGG
TGTGTTGGTGTATACCTGTAGTCTTAGCTGCTTGGGAGGATATGGCAGGAGAATTATCTG
AGCCCAGGAGTTCAAGGTTGCAATAATTGTATTCTAGCTTGGCTGACAGACCACACCCTG
TCTCATAGATAGATAGATAGATAGATAGACAGACGGAACAGACATTGTCTCATAAATAGA
AAGAAAGAAAACAATTTAAAAAGAAAATACAATAAGTTAATGATTTCATTTCTGTTAACC
ATGAAGAATTTAAAGTAGTTTGAGTAGGATACTACAAAATAATTGAAAGTGACATTGCAT
GTACACACACAAGCACATAGTCTTTATTCAAATAACTTAGTTACTAGACTTGAGTCTCAG
GGTCATGGTTAATAATTCCTTTCATATTCATGATGAATTTCATATTCATCATGTTCACAA
GAAACTGGTAGATATTCAGGGGATTTTCATCTTGCAGATGAGGAAGCTGATTTAACTATT
TTAAGGTCACAGCTTTTCATGGATTTCCTTCTATTTTATCTTTCTACATCAACTTCTAAA
TGTTTTTCCTCTCCCTACCTCCCCAGACTGCTTCCCCACAACAAAGAGAAATGATGGATC
AGGCAGCAGCCCAGTTAGCTCAGGACAATTGTGAATTAGCTTGCTGTTTTATTCAGAAGA
CTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGTAAGTGTTTAGC
TTATGCTTTTTAAGTTTTGTTTTCTTTTAAATTTAAGAAAGTGCCTTATAACAAGAACCT
CAGTGACTTTTTTTGTTTGCAGGAATTTGAACTGAGAAAACACGCCAGGCAAGAAGGGCG
CAGATACTGTGATCCTGTTGTATTAACCTATCAAGCTGAGCGGATGCCAGAACAAATCAG
GCTGAAAGTGAGAATTAGGGCTCTGTCTCTCCCTTCCTTAACTTGGTGTTTTTTATATTC
TTGTTGCTACTGGGACTAGGATAGTAGGCAGGGTTAAATGTGGTTTTTGAGAAAGCTGCT
TACCTTAGTAGCATTTCACTTAAAGGCTGCCTGTTTTTAAGGTATAGAAATAGCTTAGAT
TCTCTCACCCCTCAGTTTGTTGAAGTGGTACTATAAAGTTCTTGTGTCTGTTAATGTTAA
TATATATGTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTCAGGTTCTATTGGTTCCGGTGCCAGCCATATACACCGAGGGTGGTATGTTCAA
ACCCACCCAGGCCAGCTAGATAACAGTGACAGCTGCAACAAAAAATAGCCAGGGATTGTG
GCAGGTGCCTGTATGTAATCCCAGCTGCTTGGGAGGCTGAGGCAAGAGAATTACTTAAAC
CCAAGAGTTGGAGATTGCTGTGAGCTTGACGCCAAAGCACTCTACCAAGGGCGACATAGT
GAGTCTCTGTCTCAAAAAAAAAAGTTTCTATTGATTATGTAGTGAATCCCATCAAAATAC
GTTTTCTTCTTTCAAGGTTGGCGGTGTGGACCCAAAGCAGCTAGCTGTTTATGAAGAGTT
TGCACGCAATGTACCTGGCTTTTTGCCTACGAATGACTTAAGTCAGCCTACAGGATTTTT
AGCTCAGCCCATGAAGGTAAATACTTATTTTGGTTTTAACTGAGAGTTTAAATGTTTTGG
ACATTTAATAAATGACTTGCTTCCTGGGAGCTTTTGTTACAGAAAAATAGCCACAACTGT
TGAGTTTTAAGTACTAGATCGACATGGCATATAGGGGGTTTACTTATTTTTTAATCCATG
ACGTTGATTTAATTGTAATATTTGGCTCAGAAAAATCTATATGGTAACACCATGATGTGC
CTTTTAAAAATAATAGGAATTTCTAAAGTTTTGGAAGTCATTTACAGAAAAATTGGAAAT
ACAAGGAAAAACATTTTCCTCCTGATATTTGAGAGTAAGTTGCTGACTTGATGGCTCCTT
CACTCCTGAACCTTTTAGCTTTTCCTTTTTATAAAACATATATCTGTGTGACCACAGTAC
ACCTGTTAAAATCAGAAGTTAACACTAATCCCTTGCTACTCTCTAATTCTTAGACCTCGT
TTGTGTTTCACCAAGTGTCCCAATAATGTATCGCAAAAGGCCTATTTTAGAATCATTTCT
CTTAGTTGTCATGTATTTAAAATCTCCCTTATTTTGTCCTGGTGTAGATCTTTGGTTTTC
TTAATCTTTCATCACTATGGCACTTTTGAAAATCATAGGTTAGCCATTTTCTAAAATGGC
CTGATTTGGAATTTTGTCCAGTGTATTCTCATGACTAGATTCAGGTAATGCATTTGGACT
GTATTTTCGTGGTTTATAACACTCACTTACTTAGGCTATAGAAAGCTTATTAGATGCCAC
AAATGATGCTGCCATCAGTCTGTCCCATTTTTGCTGGTACTTGCTGTGATCACTTGATTA
TGCTAATAGCCAGGTTTTCCACTCTGAAGTGAAGCATACTTTCCACTATGTTTGCCTTGC
ACTGCCCCACATAGTAATACCATTAAGACTGAGTGGTCTAAGAAGGGGGAATGGAAGTGA
CCTTTCATGTTTTGAAGAAAAAAGAAAAACAGAGAGTAAACATAACTATTTACATCTATT
TGGTACCTGTCCCGTTGAAAAACCTTAAAATTTTTTATCTCTTTTTGGTTATTTCCTTCT
CTGGAACAGCAAGCTTGGGCAACAGATGATGTAGCACAGATTTATGATAAGTGCATTACA
GAACTGGAGCAGCACCTACATGCCATCCCACCAGCTTTAGCCATGAACCCTCAAGCTCAG
GCTCTTCGAAGTCTTTTGGAGGTTGTAGTATTATCTCGAAACTCTCGGGATGCCATAGCT
GCTCTTGGATTGCTCCAGAAGGTTGGTTCTTAAGCTGTTACTTTTTTTTTTTTTTTTTTT
TTTGAGACAGGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCCGTGGCATCTCAACTCACA
GCAACCTCCCACTTCTGGGCTCAAGCGAGTCTCCTGCCTTAGCCTCCCAAGTAGCTGGGA
CCACAGGCGTCCACCACAACGCCTGGCTATTTTTTGGTTGCAGCTGTCATTGTTGTTTGG
CGGGCCCGGGCTGGATTCGAACCCACCACCTTGGGTCTACGTGGCTGGCGCCTTAGCCAC
TTGAGCCACAGGCACCGAGCCAAGCTGTTACTTTTAGGAGATGCTAGGCTTATAAATATT
TAGTGACCCGTATCATTGTTTACATACTTAAAAGCAGTTATGCCAAAGATTTAAAACATT
AATATAAATCAAGTTAAGATTTTCTGGAAATAGGATTATAAAAGAAACTTTAAAAGATAG
CCCTTTGCGTGGCGCCTGTGGCTCAAAGGGGTAGGGCCCTAGCTCCATATGCCAGAGGTG
GTGGGTTCAAACCCAGCTCCAGCAAAAAACTGCAAAAAAATAAGATAGCCCTTTATATTT
TGAGTAACAGATTGATCCAAGAATTTGGGTAATCATGCAGGGTAGTGGGAAGTCCTGGAT
TTTGACTATATAGAGTCAGCAGAGCATTTTATGATAGTGAAGAACACAGAATGATCTTAA
ACTAAATAAAACGTATAGTTGTATGTATGCTAGGTGACTGAAAAGGATATTTGGAGAGTG
AAGAGAAGATCATTTAGGCTTTATAATAAGGCAGATTGTAGTTTGCATTGAGGTTTGGTT
TTTGGCTCTAATATTTGGGCTGAGTACTATGTTTTCTGTGGTTTTAAACACTTTCTCCCA
TAGGCTGTAGAGGGCTTGCTAGATGCCACAAGTGGTGCTGATGCTGACCTACTGCTGCGC
TACAGGGAATGCCACCTCTTGGTCCTAAAAGCTCTGCAGGATGGCCGGGCATATGGGTCT
CCATGGTGCAACAAACAGATCACAAGGTTAATAGCCATTATTGGACTGCCCTTTGATATA
TGTGGCCCTGCTTAAGTCCAGAGGTTTCCCTTTTATCTGGAAAGTAAATAGACTATTTGG
ACTTCCTAATTCTAAGAACTAAAAATTGTCAAATAGTTGTTTTTTTCTGTCTGGTCTCCA
TTTTCTTCTCATAGGGATAAAGAACTTCAGTACCTTGTTGGGGGAATAAATTATAAGTCA
TTGTTTTAAAGGCTTCAGTGATGTTCATATGTAAATATTTAATGCCTTAAATGGAATCTG
GTTTCCTAGAATTTAAAGCAAAAGCATGGGCTGTCTGTACTTCAATTACTGGCTGTTTGA
AACTTAGATACTAATTTGCGGCAGACTCTCTAGGGTTCCCTTAATTTTGGAACAGTTTCC
ATCGAATAAACTGGACTCTTTGTGTTACCTGATACAGTATGGTAAGTCCATATGAATAAA
GAAATACTGAATTTTTCTAGGTGCCTAATTGAATGTCGAGATGAATATAAGTATAATGTG
GAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCAC
CTAGCTCAGGTATGGAAGGAATTTATTTGAACTGACCAAATAACACAGGAAGTGTGTTTA
CTCTAAGTCCTTTTTTTCTTACATTATCTTCTCTGTGTTGCCAGTCAATGGAGAATGGTT
TAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAA
GGAGTGTTGCCCATGTTACCGAGGCAGATCTCTTTCATACTATTGAAACCCTCATGAGGA
TTAATGCTCATTCCAGAGGCAATGCTCCAGAAGGGTGAGGATGAAATGCTTTGGGATCCT
TGTGCATTTATAGTCTCTTGTGAGCTTTAGAAATGAATGTGCATGCAGATTTACACTAAC
ATTACTTGTTAGAACTGCTGTACCTACAATATGTAGGAAGCTTTGATGAGGTCTAATATT
GTCCTTTGAAGTAGGAATGCTTGACTAACTGCTAAGCCTTCACGACCTAGAGCAGTATAT
ACAGTACTAGGCTTGATGTCAGACTCCTGAGTTTAAGCCTTGGTTATGCTACTTTAGAGC
TTTCTGATTTAAGGATCATTACCTTCCCTAAGCCTATTTCTTACATAAAATAGAAATAAT
TTCTCAAAGAACTATTGAGAATCACCAGACATAACATAAAGCCTGTCCCACAATGTGTAA
GTAGTGAATATTTGTTGACTCTGAAAATTAGGTCTATTTCATATATTTTTTGGGTAAAAA
GTAGCATAACTGTATATTATGTCCTCATAAGCCAGCAGATATGAAAAGACCAAAGATAGT
TTTGTTTTAAATATGGAGATGGGGTGGTACCTGTAGCTCAAAGGAGCAGGGTGCTGGCCC
TGTATGCCAGAGGTGGCGGGTTCAAACCCAGCCCCGGCCAAAAACTGCAAACAAACCAAA
ATAAAAATATGGAAATGATAAAGTGATTGTCATTCTTGTGGTTTCTATTAAACAAGCAAA
TTGTCCAACTGTATGTCTGTGAAATCACAGTCATGAATAGACTGATTTTCACTCTGGATT
TATTGTACTAGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATT
GATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATCTCTCAAGCCTCAGAG
TACGATGACCCTCCAGGCCTGAGGGAGAAGGCAGAGTATCTTCTGAGGGAATGGGTGAAT
CTCTACCATTCAGCAGCTGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGA
CAGGTAGAGCTTTTGGAAAGAAAGGTGCTTTTTATTCAACATAAGTAGGGTGTGATGCCT
CCAATATTAAAAGTTCAGTATTATGTACCTGTCGTCACTTACCTCTATACTTATGCTAAA
CAGCCATCATACTGTTTATAAATAGCCTGTTTTCCTCCTCATTGATAACTGAGCAGTAAA
GCCAGCATTTTCTGCCCACCTTTAGTTCTCTTTATCCCATTTCATTTGTCATAAGCTTCA
AAGTATGATGGGTCAGATAATGAATAATGAGACTGCCAAATGTAATTTTACTAGCTTGAT
TGTCAACAATGATGGGATTATGGGCTAGTAAATATATAAAATTCTCATAATACAGCCCAT
TTTAAAAAAATATGGCAAAACAAAAAGCTTCGATATTTAAAGGGTAGAACATTTCAGTGT
ACTTGCTAATTTAAGAAGCTTATCTACGGGCGGCGTCTTTAGCTCAAGGAGTAGGGCACC
AGCCCCATGTAGTGGAGGTGGCAGGTTCAAACCCAGCCTCAGCCAAAAACTGCAAAAAAA
AAAAAAAAAAAAAAGCTTATCTACTTAAGTGTAGTAACATGTTCCTTTGGAAGAACTTGA
GTTCCTTTTTATTAAATTTGATGCAAATGGACTTTGAGTTACAGTGTTAGGAACCAAGCT
GCTACCTAAAAATCAGGTTTGACAGGAATATTTGTGAATAGTATGAATAGGAAAAAAAGA
AAGAGCCATAGTACCATTTAGTATTCTGCTTTTGATTCACTGGCTGCTCTAAGTTACTGA
GGGAATAAGACACAGTAAGTCAATGTGTTGTAATTATAATGTAACTTGACAAGAGAGGTA
CTTTTCCAGAACTGGCCTAAGAATTTCTTTTAGTGGAACTGTTATAATATTTGGTCAGGG
TGAACTGTTTGCTAATGTCTCCATATTTATTGACTATTATATTTATTCAAACTGAAACTA
AAACTAAGAATAATATATAAATTTGATCTGTTTTCAAATAACAATTGAATATGGAAGAGA
TGATTTGAATTCTAGAAGTTGTTAGAAATCGGGTTTATTTTTTAAGATAAATGTTACTGA
ATACATCATACTAAGTTAATTTCCTCTCTAAAAGAATCCAGGGACTTACAAAACATACCC
TGTTGTAAAGCTTTTACTGCATGTTTATAGTTTGATTTCTGATTTTGAAGAAAGAAATTG
TTCTTGGTGATCATTGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNACCCCACCAGTTTTAGCTCCTTTATAGCCTATTGGGGAAAGATTAATTATTTT
AAAATTTTCAAGATAACCTTCAAGTTTTCTTTCTGGGCCTGGTTTCTTTGTTTAGTAAAT
AGCTTCTCCTTCCTCTGTAGCCTTAATGCTTATTTTACTATTATTGTAGTCGTCATCATT
TGGGGGTGGGGATGGGGGCTAGCCAACTAACTTTTCTGCTCTATTTTCATTTCAAATTCA
TGATATAATTGTAGTTTTTCCTTTCTTTAAATAAACTTACCTTTCCACTTTATTTTAACT
AAGTTTACTACATTACACTGTAAGAGATCCTTTTAAAGGATCATAATGTATTTTTTAGGA
TGTTAATGGTTGATAGTTGATAATATAAGTTTATTACATTAAAAATAGCCAGACATGATC
TGTAGGTATTTTCATTTCATTATTACACAACTTACTGATTTTTTTTTTCCCCTTTTTTGA
AACAGTCTCACTGTGTCGCCCTGGGTAGAGTGCTGTGGTGTCAACAGCTCATAGCAATCT
CAAACTCTTGGGCTTGATTCTCCTGTCTCAACCTCCCAAGTAGCTGAGACTACAGGCACC
TGCCACAGTGCTTGGCTATTTTTTGGTTGTGATTGTCATTGTTATTTGGCAGGCCTGGGC
TAGATTCATACCTGCCAGCTCCGGTGTATGTGGCTGAGCTACAGGCGCTGAGCCAATTTA
CTGATTTGGGGGGTGGGGGTGGGGGGCAAAGAAGGTTTGCTAGTTTAGACTTTCCATAGC
TCTGTTATTGGTTAAGTGAACTGGAGGAAGTTATCTCCCAATTCTTTGAGAAGTAAATTG
TCTTAAATTCTATGAGAAAGTGAAAATTACATAATGTATTCTCTTCCTTGCAGGGAAAGA
TACATTGTCCACAAGGACTTTTTTTTTTTTTTTTTTTTGAGACAGAGTCTTACCATGTCA
CCCTCTGTAGAGTGCTATGGCGTTACAGTTCACAGCAACCTCAAACTCTTGGGCTCAAGC
GATTCCCTTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGCACCCACCACAATGCCTGG
CTATTTTTTGTTGCAGTTGTCATTGTTGGTTAGCTGGCCCGGGCTGAGTTCGAATCTGTC
ACCTTCGGTGTATGTGGCTGGCGCTGTAACTACTGTGCTACGGGCGCTGAGTCTGGCCTC
AATGTCTTAATATGACCTAGAGAGTACTTATTGTGCAAATTATTTGCATAATTTCCCAAA
TTATTTGGCAGTAGCCTGCTGTTCAGAATTGCTTATTATCTCTGTTACTTTCCGTTAAAC
TTAGAACTGGAAGAATTCTATTATGGTTCCTTAATCAGGAAGTAATTCTTCTAGTGACAT
TTTTTATGATGTAAGAAATAGAATTGTGATAATAGGAACAAATGAAAGAGCATTAAGTGT
GAAAATTAAAGTATGAAGTTCATTTATGTGTATTATCTAAATGTGTGTATTTTTTTATTT
CCATGGTAGATGCACCAGCAAGGAATACTGAAGACTGACGATCTCATAACAAGGTTCTTT
CGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCTGAACAGCAGCAT
AATCCTGCTGCTAATCCTACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTT
GTTCGACTCATTGCATTGCTAGTGAAACACTCAGGGGAGGCCACCAACACTGTCACAAAG
ATAAATCTGCTGAACAAGGTCTGAAATCCTTTCTTGCCTTAGTCTTGGTACACTTGAAGT
CTCCATAAGTGGTTCTCAACCTTATTAGGCCCAGCCCTCCCTCAAAACATTTTGTAAGAT
CCTTTTTCTGTCCTAAAGGATCATAATGTATTTTTTAGGATGTTAGTTGATAATGACTAA
AATAGAAAAGATATTTAGGTAATATGAGATTTGCCCCTACAGACAGAATTACTGTGAATG
GGTGGCTAAAAGTATCTACTGCTTAATTAAATAATTTAGTAGTTAATCGCATTAAAATAG
CCATGCTCTGTGGATATTTTGATTTGGCACTTACTGTGCAAATTACTGACTTTTCTGGGA
GTTTAAAGGCTTTATTATTAGTTGAGTCACTTGAAAGAAGTTATCTTCACTTTTCTGGTA
ACAGATTGGCAACACAGATACCGTGAGTGATGGTTACCGACTTTGATTTACACAGGAGAG
TTTTTAGAAATTTGAAATACTAAAATAATACAAAGATATGTGTGAAAATGGATTTAGGTT
TTGGATTTGGGAAATTACAAATGGGTTCTTCATGTCCCTCACTGTGCAGCAGGCAGATCA
AGTGGAGTGCAGGACAGTTCTTCAAGAGACATCTCTGCTTGTCTAACAGCTTCCCTGGCT
CCCACCTACTAAATGCCAAGTGTAAACCATTTGCCACATGTCAACTTCAGGTCAGACCAG
AAGAATTAGATTGTTAGATTGTGTTAACATGGTGAAATGTGAGGACTATGCTGATTTTTA
TTGCTTTAGAAAAAACATTCGATGTTTGTGGAGAATGTATATACAGATCTGGTCCAAAGA
TGGTAAAATTCAAAGAAAATTCATAAAGCAGTGTAGGCCAAACCAAACCAATGTATGGCC
CCTTTTAGGCCAGCATATAATGTTATATTAAAATGGACTATATCCTCTACTTTAATGTGG
GGTTAAAAATGCAAGGTTAAAAGAAAACATGACTTAAAGTGGTAAGTGAATTATCTGTAT
GATTTACAAGCTCTACTCTATGGATTCCGTGTAGGTCCTTGGTATAGTAGTAGGAGTTCT
CCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATTTT
TATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTGTTAGAAACCATTAACTTCCA
GACACTTACAGCTTTCTGGTGAGCATTGTTGTATTTAATAGAGATTTCCTGTTTAAGATT
GCTGGTTTAGTGTAGTAAAATTTTAGGAGAATTATTTATGAATCTTGAGGTATGTTGATT
TGCAAGATAACTTGCATGTTGCCTGCACTCTTGTGTTGCTTACCATATTTAAGTGACACT
ATGATTCTGACTAAGCCTTTTCTTCTTTCAGCAATACATTCCACATCTTGAGGCCTACCA
AAGCTCCTGGCTTTGTATATGCCTGGCTTGAACTGATCTCTCATCGGATATTTATTGCAA
GAATGCTGGCACATACGCCACAGCAGAAGGTGTGGCTGCAGTTTATCTCCTACAGATGAA
GACAATAACTATCTGGGGCTTTCAGCACTGCTTATAGATTTCTGTTGGTCATTTAGTAGT
AATTTTACTTCTTCCAACTCTTAGTTGGAAATTATTCTTTTTAGTGTTTACTCAAGTAAT
GGAGAGAAGTTTAAACAAGTACTTGACTGCTTCTACCTAAAAGGGAATGATTAGAGTGTT
GCTTCTTCCATTCTGTTGTGGGCCACCTCTGTGTCATTTTCTCAAGGTTTATTGTTTTTT
TTAATAAATGTGATTTTTTTTCATTCATAAGAATGATTTCTTTTATATACTAGAAAAGGT
TTTCTGGGTTTTTTGATGCCACTTGAGCAGATACTTGAATAAATCTATAAATGGGTCTCT
GGAGCTTGCTAGTTTTACATATTCTCAGTCTAAATAAATGCTGAAGGCCTCACATTAAGG
TTGAGAACCCCTGGGATACTTTATTTTGAAGGATTATGATAAAGTTTTATTAAAGAGTTC
TTACTCTAATTGGGAATACTTTATAGTTAACACTGGAAGTTTTTCTCCCATCTTTCAGTT
AAATGGCAGATTTCTACTACAGAGAGCATGTGTTCTGTTTGGTCCATCAAATTGTAAAAA
GTGTGACTAGGGCTGAAGTGAACTTGGCAAAAAAGAAGGCAAAATAACTCGTAAATTAAG
TTGATTTTGTTTGTTGGGTAAGGACACTCCAGAAACAAGGAACACAACATAGTGAATAAA
ATTATACAAGAATGAAATGAACATAATTGATATGGTGGTTAGCACATTGAGCAGGGCCAA
CTTTGGCTAACAATAGAGGACTCATGTTATAAACTTGACAAGGTTATTTGGCAGGAGTTA
GAAGTGGGAAAAGAAATTAAGTACTGCAGTACTTAATCAAAAGAAGGAATTAAGAAAATG
GATTTCTAGTTGTTATTTTTTCAGCTGGCTGAGTGTTTTGTGTTCTATCTGAAATTTCCT
GAGGGTTTTCTCCTTTCCCTTTCTTAATTTTGCTATAGGCATGAATACCAACATGTCCTA
AAATCTCTGATGCCAGTTTGATTGAAATATTATTTCCCACTATCTCCATAATTACTTGGT
CCCTTTTCATACCATTGAGAGGTACTTACATTAATATTCTACACTTAATATTAGTATGAA
GAACATAGTGAGTCCCACTGTAGCTGCCTGGGCAACTCTTGGTGGTAGGGTAACAGTTGA
GTGTAATATGACTCATGTATATTTCTTTGTTCTAGGGATGGCCTATGTATGCACAGCTAC
TGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAACGTGGAGCTCACTAAACCTA
TGCAAATCCTCTATAAGGTAATTCATTTGGATTTATAAGTTAAAATAACTTCTAGGACTA
AAAAGAAAAATACTTTTGGCTAGGTCTATGAGCCCTTTTTCTTTCTTTCTTTTCTTTCTT
TCTTTTCTTTCTTTTCTTTCTTTCTTGACAGAGCCTCAAGCTATCCCCCTGGGTAGAGTG
CTGTGGCTTCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGTCTC
AGCCTTCCAAGTAGCTGGGACCACAGGTGCCTGCCACAACGCCCAGCTATTTTTTGGTTG
CAGCTATCATTGTTGTTTGGCGGGTCTGGGCTGGATTTGAACCCACCACCTTAAGTGTAT
GTGGCTGGCGCCCTAGCCACTTGAGCCACAGATGCCGAGCCTATGAGCCCTTTTTCAATA
AATAAACCTTTCAAGTGAGTACATTCACTAAAGAGTGAAAATAAAGCACTTGCATAACCA
GGACCCAGATCATAGGATGTGTATGTTCAACTTTTGTGGGTACTTCAGTCTTACAAAGTG
TACCAGTTTATACTGTCCAGCAGCATGTCAAGAGTCACCGTTCCCCCCCACATCTTTCCA
TACCTGATACTGTCTTTCATTTTGGCAGTTGTGCAGTAAGATTTTGTTCTGTACTTAATG
TACATTTCCTTGATGTCTTTTTTTTTTTAATGGGGAGGGGATAGAATCTTGCTCTGTGGC
CTAGATGCTGCAGGGGCATCATCATCATAGCTCACTGCAACCTCAGTCTTCCTGTCTCAC
CTCCCAGTGTGCTGTGATAGATAAGGGCTTGAGTCTGCTTAATTCTCTTGATGACTTCTT
AGTGAGGTTTTCATGTGTGGATCAGCCATGTGGATATCTCTCATTTGTGATGTCCCTCTT
CCATTCTTTTGCTATTTCTATTGGATTGTTGACTTTTTTCTTTTCATTGTCTAAAAATGA
GAGTTCTTCGTATATTCCAGATACATGCCCTTTGTTAATTTATATTCAAATCACTCTCAC
AGTTTTCATTTTTACTTAAAATGAATGGGTGTCTTTTGAGGAGCAGAGGCTTTAAAATTT
ATTGTAGTCAAAATTACCAGTTTTTAAAAACTGTATTAAAAATTGCCTTTTCTGACTTAA
ATCTGTACCTATCGCAGGTTGCCAAAGGTTTTCTGTGTACTACTTATGTACCTGAATTGT
CATATTAGCATAAGAATTGTTGAACATTCTATTATCAATTCTCTTACTCTTTTCCTAGAA
ACTACTTTCTAGCTTTTCCTCCCTACTCACCTTTGAAAGTTTAAAGACTTTTTAAAATTT
TAATATATATATGTATGTGGTTTTTTGTCTTTTTAAGTTCTTGAAGATAGACTTTACACT
ATTGCTTGCCCCCGCCCTCCTTTTCTGGCATATTCATTTAACGCTATAAATTCTGGACAG
TCTCAAGCTGTCGCCCTGGGTAGAGTGCCATGGTGTTACTGCTTATAGCAACCTCAAACT
CTTGGGCTTATGCGATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGTGCCTG
CCATAATGCCCAGCTATTTTTTTGTTGTAGTTGTCATTGTTTTAGCTGGCCTGAGCTAGG
TTCAAACCTGCCAGCCTCGGTGTATGTGGCCCGTGCCCTACCCACAGAGCTTTGGGTGCC
ACCAAATTCATAATTTTTAGATAGAAATATTAGATAAATCACCTGTGGTATTACTAATGT
TAATTGAAGCCTGTAACTTTTTAAAAAATGTTATCAAATGTTTTTGCTTTAAAAAAATAC
TAGAGTTAAATTTATAATGGGAAAAATGTTATTTCCTTTTCCTTAGTATGGAAATGTTTT
TCTTGTTTTTAAACAATAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCC
AGAGTTCCTTTGTGATTACCATTATGGGTTCTGTGATGTGATCCCACCTAATTGTATCCA
GTTAAGAAATTTGATCCTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTCAC
TCCTAATCTGAAGGTAAAGTTCCAAACAGTTTAAGAAAAAGTTGTACTTCAGTATTTTAG
TCCTTTCTCTGATAAGCAGACTGTTTACCAGCCTCCATCCTTTCCCCAATATACACAGTT
ATTTGTTAGTTAAGGGTACTGTTCCAGGGAAACAATCTTGTTATTAAGCCTGATAGGATA
TAATTGTTGCTATTGGTGCTGCTGAATATTATTAGTTCACAGTATTGTTCTAGTTGCCAT
TTTTCATCTTAATATTGATATTAGATACAGCTGTATTTACAGAACTTCACCCTACTTATG
AGGTCAGTCATTTGCTGGGTGGACCCTCACATGGTGAAGAATTGCAAAAATGTAATTCAA
TGCCCATATTTCACAGGTATTCTGTGTGTGTGTGTGCACACATGTACATGTGCTTTTGTA
CAGCCATACCTTGATGTTCTCAAGGAATCGGTTCCAAGACTCCTTTGATACTAAAATTCT
AGGACATTCAAGTCCCTTATGTAAAATGGCATAGTATTTGCATATGACCTACATACACCT
TCTCAGAAACTTTATATTATCTCCACATTACTTAGGGTACCTCATATAATGCTATGTAAA
TAGTTCTTAACATTATAATTAAAAAATTTTTTTTAATTGGATTCTTCCCCACCCCAAATA
TGTTTGACCTTTTGGTTGGATATGAATCCCAAGGACACATAGGGCTGACTATATTTTGTT
TAAATTGTTGAAATGTAATGAAGAGACGGACCTCTTGTAATCACACTATCCTGACATGGC
TACTATAGTTTTTTGATTTGTTTGGTTTTTAAAGAGTCGAGGTCTTGCTGTGTTGCTCTG
GCTGGAGTGCAGTTGCTATTCACAGGTGTGATCCTAGTGCACTACAGTTTTGAACTCTTA
TGTTCAAGCTATCCTTCTGCCTCTCAGCCTTCTGATTATTTGAGCCTGTAGGCATACACT
ACTACCCTTGCCTATTTTTTTGTGTTCTTTGATATTTTCTTCACATGCGTTTTTTAAAAA
GTAGTAAGTATGATGTCATCTTGTTCTTATTACAAAGACTGTTGGTGATTGAGGAAGCTT
GTTTTGGACACTCATTTTGAAATCCAAGTACAGGAAAAGTCTGTTAGTGATGCAAACTAG
ACCTCTCTACAAAAGGTACCTTGCCCTTAGAATGAGAAATTCTTTTTTATAAAGTTCTTT
TGATTAAAGTAAGACTGATTAAACTAATGGAAAGTGGCAACTCTACTGTTGAAGACATTG
TAATACAAATAGTTTTAGAAAAGCAATCCTACCACTTTTTAGCATGGGTTATAATTTGCT
CTTAACTTCTTCTACATATTGTGATTCTTGAATTTGTGGCAGGTGGAACATGTTGAGTGA
AATTAACATTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATATTTAAACTTTATAAACTTTACTTTAGAGCTGTGCTTTGGTTGG
ATAGTGATGACAGCTTTGGCTTACTAAGGGAAATCATGTTTCTCTTGTTGATAGAACCAC
TTTTGGGGCAGCTGTGTATTTATTAAATAACTTCACAAACTCAAGCAGTGCCTGCCATTT
AAATCATAACGTTGAGAACAGTTCAGCATTTCTATGAAAGTACAAGAAGAAATAATGCTG
GTGTGAGACACAGTCCTCTGTGGATTAAGTATAAGTTTTCTGTTTTATTCATTTAAGGTA
TCTAACGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTA
GGAACTCAGGCCATTGCGCACATCCACAATAAGGGCAGCACACCTTCAATGAGCACTATC
ACCCACTCAGCACACATGGATATCTTCCAGAACCTGGCTGTGGATTTGGACACTGAGGGT
GAGTGAAACCTGCTAGTTCACCAGAGTTCACTTTGGCTTTTTTAAAAAACCACAGTCTCA
TCACAAAAATACAGAAGTGCTTTAGTCACAATAAAGAATGTCAGTAAGGTCTTCTATTAT
TTTTTTTTGAGACAGAGCCTCAAGCTGTTGCCCTGGGTAGTAGAGTACTGTGGCATCACA
GCTCATAGCAACCTCAAACTCCTGTGCCCAAGTGATTCTCTTGCCTCAGCCTCCAAAGTA
GCTGGGACTACAGGTGCCCACCACGCCTGGCCATTTTTTGGTTGTAGTTGTCATTGCTGT
TTGGCAGGCCTGGGCTAGATTCAAACCTGCCAGCTCTGGCATATGTGCTCCGAGCCTCAC
TAAGGTCTTTAATTGGACATTATCTGCTCAGTGCAGATAGCTCAGGGTCTTGGCTTCATA
GGGGCTTTCATATTTCATAGAAAATACAAAAAAGCATCAATTAAACAGAATCCTACATCA
GTTAATATTTTGGTGTGTATGACTACAGTATTTTAGTGTGAAAAAAAGTCTCTTTAAACA
TAGGCTCATGTTACATTGTTTCATTAGCTTTCTTTTTACCAGGTTGTTTGCCAGGCAACT
TGGTAAGTGTATAAAGAGTGATGACTAGGACTCTTCCTATCTGTCCTGTAAAATGTTTAA
GTTATATTTCCCACAGCAGGTTGCAGATGTCCTGGGTGAGCTACATTTCTTTTTGCTTTT
TATAGTCATTCTTATCATAGAGACCCCAGTTAGGTCCTAGTTAGTGATATGGTCCTGCTT
ATTTTAGCATGCATGCATGTAATTTAGAAGGGGAACTACTGCTTTTTGCTATGGATTCTT
CAGAGGCTACCTAATCTGGAGTATAAACTGCATGCATATATGTAGAAGGGATTTGAGTTA
GCTTGAAGGCAAGATTTAACAGAATGAAATACCAGTACATCCAGAGCTCAGCAACAAAAG
GACAGCCTTGGCTCGGCGCCTATAGCTCAACCGGCTAAGGCGCCAGCTTTATACACCTAA
GGTGGCGGGTTCGAATCCCCAGCCCGGACCCGCCAAACAACAATGACGGCTGCAACCAAA
AAATAGCCGGGGGTTGTGGCGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGG
AGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGCCACGGCACTCTGC
CCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAACAAAACAAAACAAAAGGACA
GCCTTAGGGAAATGTTAAGGGTCACTATGACAGTTTTACAAACATGGGTAACACCAAGCA
GAGGCAGACACTCCAACCCAATTAAGATAATAGATATTTATTCCAAGATAGTATAGTTGT
CAAAGTGTGGTCTGGGAACCCTGAAAGATGTCCTGAAATACTTGCTTTTTTTCTCTCCTT
ATTCCATGAGGTGTATGGTAGAATTTTCCAGAGGCTACATGTAATATAAGACTGTAATAG
ATTGAATGTAGAAACAGACGATTAAAAAGACCTGCAAAATGTAAAATAACTTAGTAACAC
TCCTTCACTAATTTTTTTTGGAAAATAGTTTTAAGTAACGTTATTTATATTATTAGCATA
TAATGGGTCCATTTTCAAAAATGAATTAATGGGCCAGGCATAGTGGCTTTCTCCTGTAAT
ACTAGTGCTTTGGAAGGCCTAGGCTGGAAGAGCACTTAGGGTCAGAAATTGGACACCAGC
CTGAGTAAGAGTGAGCCCTGTGAAAAATTAGCCAGATTTGGTAATCCATGCCTACAGTCC
CAAATATTCTGAGGCAGAGGCAGGAGAAGCATTTTAGCTTAGGAGTTTGAGGTTGTAGTG
CGCTACAAAGGACCATGAACTAGAATCTGCCTCAAGAAGTATTTTAAAATCTTAGTTTTT
TTTTTTTTTTTTTTGAGACAGAGTTGCCCTCACTTTGTTGCCCTCTACAGAGCCCTGTGG
CATCATAGCTCACAGCAACCTCAAATTCTTAGGCTCAAGGGATTCACTTGCCTCACCCTC
CCTAGTAGCTGGAACTACAAGTGCCTGCCACAACATCCAGCTTTTTGTTGTTGTTTACTT
AGCAGGCCCAGTCTGGGTTTGAACCCACCAGCCCTTATGTGGTATCCACTGAGCTATGGA
TGCTGAGCCTTAGTTTTAATTTCTAATGTGAAAATGTTGAAATAAAACCCACAGAGATGA
AAGCTTTTTGGAGTTTTGAGGACTGTTTGGTTTAATTTGGAAGCCTCCATCAAAAACCCA
AACCTTAGGCTTGGCACATATAGCCCAGTGGCCAGGGCGCCAGTCACATACAGCAGAGCT
GGCAGGTTTGAATCCAGCCCAGGCCTGCCAAACAATGACAACTGCGACCAAAAAAATAGC
CAGACATTGTGCAGGCACCTGTAGTCCCAGCTACTTGGAAGGCTGAGGCAAGAGAATCAC
TTAAGCCCAAGAGTTTGAGGTTGCTGTGAGCTGACACTACGACAGGGTGTCAGCTTGAAA
AACACCACCAAACCCTTCAGAACTATGTCTTCCCACATTAGCTTTTAAGAACAAGTCCTA
ACTAGAGGTTTCTTAATATTTAGGTCGGTACCTCTTCTTGAATGCAATTGCAAACCAGCT
GCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTACCTTTTTGCAGA
GGCCAACACTGAAGCTATCCAGGAACAGATCACAAGGTAACCCTTTGAATTCTTGGGGGA
TTTTCTATGCATTTCAGAGAACATCTTGTACATGTCAGTAATGTATTAAATGTGGGATAT
AGTTATGAACAAAACAGATGGTCCTAGTAGTCTAATGGACGTGGACACAGACACAGATCA
CAAGTAGAGAATTAGACATGAATCATTGTTAAAATGAAAAGTAGTTTTCATCAAAAGGCA
AATTTTTCATCCAAGGTCAAGAACTTCTCTGAGGTGGTGGCATTTTAACCATGCAAGCTC
ATTGGAAATTATGCTAAGGACCTTAATTTCCTAACCTACCTCTGGGTTAAAAGGTTTTAA
GCAGGAGTAACAGAATCCTATGTGCATCCTAACAATAGGAATCTGTTGTGGGTTGCTTAG
GCTGTATATATTATCTATAAAGCATTAAGGGAGACTGGGAAATATGAATATGCCAGTGAT
ATATATACACACGCGCGCGCTTTAAATCTTTGGCAGAGGGTGGCACCTATGGCTCAAAGA
GAGTAGAGAGCCAGCTCCATATACCAGAAGTGGCAGGTTCAAACCCACACCTGGCCAAAA
CCGGTAAAAAAAAAAATAAATAAAAATAAATCCTTGTATCATAGGGACATTGACACCAGA
CTGTTTACTGCAGCTCAACTTACAATCACCCAAACGTGGAAATAGCCTAAATGCCCACCA
ACCCAGGAATGGAGATATATATATATCTATATATATATATATGAATATATATAGATGTAT
ATATATTCAGTCACTGAAAAAGAGGGAGGTTTTACATCTTTTGTATTAACCAGGATTGAG
TGGAACACATTTTTCTTAGGAAAGCATCACAAGAATCCAATGTCCTCGATTCTAATATGA
AGCCAGTAGATAATCGAATACCCACATAAGAGAAAAACTCAGATCAATTTAAGGTGGGGG
GCAGGGGAATGAGAGAGTGGGGAAAAGGGAGGGGAATAGGAGTGCTCCCACTTAATGCCC
CCCTACGGTAGTTAGGGTATATGGCACACCTCTTGGGAGAGGACACAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
GAGTTTAGATTTCCTCATTTTCACTGGCCATTCTTAGAAGTGATAACTTTTTGAGTGCTA
TGTATTTACTCCATAGGTGGCTACCCCACCCACCCCATCCAATTCTGTTTTTTTTTTTTT
TTTTGAGACAGAGCCTCAAGCTATCCCCCTGGGTAGAGTACTGTGGCATCACAGCTCACA
GCAACCTCCAACTCCTGGGCTCAAGCAAGTCTCCTGCCTCAGCCTCCCAAGCAGCTGGGA
CCACAGGTGCCCACCACAACGCCTGGCTATTTTTTGGTTGCAGCCGTTATTGTTTTGTGG
GCCCGGGCTGAATCGAACTCGGCACCTTAGGTGTACGTGGCTGGCACCTCAGCCACTTGA
GCCACAGGCACTGAGTCCCCCATCCAATTCTGAACAGCTCTGAGATACCTCACTTGTACT
TAGTCTTCCACAGCACTGAGTCCCCCATCCAATTCTGAACAGCTCTGAGATACCTCACTT
GTACTTAGTCTTCCACAGCACAATAAGTAGATAGCAAGGACCCAAACCCAGGTATTTCAG
CCAGAATCCGTCTCCACCTTGTCTTTACTAAAAGGTGTAAAAACTTGTGCATGAGGTTTA
ATAATCAGAAGAGTTAGGGAAAAAAAAAAGTAATGGAGGAGAGGTCATGAATTTCTATTT
TATCTTGTATTCTAACACTTCCTTCCTTCTTCTAGGGTTCTCTTAGAACGGTTGATTGTA
AATAGGCCACATCCTTGGGGCCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCG
TTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCCCAAGTCGAAAAGTGAGTTACA
AGCATTGTTTAATTATCTAGAAATGAGAAACCAGAATAAAACCATGTTTTGAGCTTGGGT
TGGTGATTAGTAGCTAAACAAAAGAGATGCAAGATACTAAAAGTCTAAACTTTCTCACAA
GTAAATTTGTAACTATTTCATTTCAGGTTATTCCAGTCAGTTGCACAATGCTGCATGGGA
CAGAAGCAGGCTCAGCAAGTAATGGAAGGGACGGGTGCCAGTTAGATGGACCCATCTGTT
GTAAACATGCCAGCGTGGAGGTCCCACTGCACCAAGTTTTATGAACTGACTGAAGAATCC
TTTCAGCTCTTCCTGACTTTCCTAGTCCTTTGGTTCTCGGGTATCTGCCCCAACTACTGT
TGGGGTCAGCCTCCTATCTATGTGGGCACGTTCCAAAGTTTAAATGCATTTTTTTTGACT
ATTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAACTTGTGTAAATATATGAAA
GAGAAAACCTTTGTCTGGAACTTCTTGGGTTTGTGCAAACTGTTTCCAAGGCAAGTACAT
AAACTGGTATCTTGTAACAGAAAGGCAGCTGATGGCTATGCACTTGTCTGAGGGCACATA
GCTCCATGTCTTCTGACATTCCTGGTGTCCCAAACAACAGCAGAAAGCCAGTTTAAAATT
ATTTTTTAATGTGGACAGAGAAGTTTGAAAATCCCTAAGTTATTAAAAAATGGGGATGTG
CTAGAATTAGATGTCAGGAAACATAGGAAGGGCTCAAAGTTGGGATCCTGTGGATTTTTG
TTTTGCTTCTCCTAAACTTACTGTAAAGCCAACTGCAGGGAGTTATACCAGCTTCTCATT
TCTGCTGGAGAATATATACCTTGACCTTGTGAGATAGGTCTGCTCATTTTCCATGGGGAA
AACACAACCAGGTCTAAAAATGCCTCTCTCCTGATACTTACAGATTGTGGGGAAAAAACG
GGGAACCAAATCTTAAATGAACTGCCCTTCCTCATTACCCCAGTGAATGCAGGCTAAGCT
GAATGACAACAGTGAAGTCAAAAGGACCAATACAGCCCCTTTTTGTAAGGATTTTGAATG
TTTTGTAGATGTATTGGTCCCTGTGTTGTATTTTGTAGCCTTTCTCAGGCTTTACTTCTT
GTATGTGTATGCATACTATAGTTAAACATTAAAGTCATGACATGCACCTGAGTCCACTGT
GCCTTTCTCAGTAGCAGCAGCCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1683..1781, 2006..2074, 2184..2238, 2699..2902, 4045..4213, 5567..5693, 5840..5950, 9351..9521, 9939..10066, 11682..11922, 14354..14398, 14401..14442, 14445..14452, 14454..14460, 14462..14470, 22719..22841, 22942..23093, 29909..30059, 31685..31807, 31810..31830, 31833..31868, 31870..31881, 31883..31886, 33192..33338, 34418..34542, 34760..35046, 35945..36023, 38985..39215, 39667..39804, 41372..41551, 45158..45274, 45627..45737, 46043..46120, 46298..46475, 48032..48162, 49224..49520, 50426..50566, 50662..50766, 51616..51735, 52809..53000, 53883..54025, 54500..54608, 54704..54873, 55631..55862, 58989..59237, 60274..60437, 60631..60748, 62015..62108, 62131..62138, 63979..64152, 65502..65505, 65507..65531, 65683..65803, 66237..66417, 69023..69155, 71195..71329, 71486..71564
1001..1108, 1683..1781, 2006..2074, 2184..2238, 2699..2902, 4045..4213, 5567..5693, 5840..5950, 9351..9521, 9939..10066, 11682..11922, 14354..14398, 14401..14442, 14445..14452, 14454..14460, 14462..14470, 22719..22841, 22942..23093, 29909..30059, 31685..31807, 31810..31830, 31833..31868, 31870..31881, 31883..31886, 33192..33338, 34418..34542, 34760..35046, 35945..36023, 38985..39215, 39667..39804, 41372..41551, 45158..45274, 45627..45737, 46043..46120, 46298..46475, 48032..48162, 49224..49520, 50426..50566, 50662..50766, 51616..51735, 52809..53000, 53883..54025, 54500..54608, 54704..54873, 55631..55862, 58989..59237, 60274..60437, 60631..60748, 62015..62108, 62131..62138, 63979..64152, 65502..65505, 65507..65531, 65683..65803, 66237..66417, 69023..69155, 71195..71329, 71486..71561
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved