Otolemur_garnettii Locus FLI1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii FLI1
Otolemur_garnettii
FLI1
scaffold_13860
SNORA63
34506..34636
54196
AATTTGTCCAGCTTTTCTTTGAAAACGGCCACCTTTTCTGAAAAGCTGCACACTTAACT
TGGGGCAATTATGTGACTAAAGTGAAGAGTACACCCCAGTCCCTGACTGTGGGTCCCTGT
GATTTAATGCTTATCACCATGCTTTGATTGGTAGAAGATCTCAGGAAAGGACAAGCCTCC
CTTTCTTAATCCATGAGCTTCAAACATCAAACCTGAGTCAGGTGATGGAACAGATGAGTG
GGGGACACAGCATCCTCCCAGATGGCCCTCCACATACGTACCTGGGATTCCTTCCTCGGC
AGACCTGATCATCAAAACCATGACCTGTAAGATTGTCCAGCACACCAGGAAAGCCCCTCG
GCAAACTGCTGAGCATTCTTACAAGCCAGACCCCGGCATCAGATCCCCTTAGGGCCACCT
GGGAACTCTGTCAAAAAGCTATACCTATTCAGATTTGCCAGCATGGAAACAGAAACAGAA
ATTGACACAGCCACAGCCCTGGGCCCCGCCCTTTCTTTCTGTGACTTTGAACTGGACATT
TAACCTTTTTGGTGGGTCTCGCTGGCCTTGCCTGTAAAGGCTGGATCATGTGTCCCTCCT
TTGCTGGACTCTGCCACACAGCTTGTAATAAGATGCATTTCTGCCGGCACCTGAGAGAGC
CCATCGCTCGCCCCCCCACATAATATTCCACCTCAGTAGCTGCTTTCTTGGCCCCCCCCT
TTTCAGAGATTCCAATCTCTAAACCCAACAAATGAACCCACTTCTAGGGGTCTTCCACCT
CCACTCACCTGCCCAAACTCCTTCCCCATGCAAGTAAGCTGTGAAGGACCCATCGAGTTT
GCATGAGGGCACACCTGCCACCTGGATTGTGATTGGTCAGCTGGGGGCACAGTTGGGATT
TCCAGGCATCCCTGGCGCTACCCTACCAGCTCAAAGTGAGAGTGCCACTTACTTGAGTGA
GGAGTGACGCTGGGCTCTCTGTGTCTTCTCTGTCCCTGCAGGAGGCTCTGTCGGTGGTAA
GCGACGACCAGTCCCTCTTCGACTCGGCGTACGGAGCGGCCGCCCACCTCCCCAAGGCCG
ACATGACCGCCTCGGGGAGTCCTGACTATGGACAGACCCACAAAATCAACCCGCTCCCGC
CGCAGCAGGAGTGGATCAACCAGCCGGTGAGGGTGAACGTCAAGCGGGAGTATGACCACA
TGAACGGGTCCAGGTAAGCCTGGGTCTGGTGGGACAGGGATCCCGGAGGCCGGTCGGAGG
AGTTGTGCCAAGGGGCATCTGGTGCTGAGGGCCTCCACAGCAGATGACTCCCTAGCCCAG
ACCAGAACATTTGAGTCAGTCTCTAGACAGTTGAGGCAAGAGAAGGCCGGGGAACTGACG
GCTGGAATGGAGTAGGCCAGGAAGCCCACTTGCCTCTCTGGGGCCCATGTCACCTTCAGA
GACCAGGTGACAGGGCCCAACACCACAAGCAGACACGTGTGGAACATACTGTGGGTTTTG
TGTGGGCCCCTGGCCCTGGTACAGCCCCTCTTAGGGATAAGTCAGCTGTAAGATGCTCTT
CCCTGTCCTGCTGGAGATACTTAATCTCTCCGGGTGGGTCTCAGCAGAGCCATGATGGCC
AAACCATTCTTGAGTGAAAGTGGAGAAGTGGTGGGAAAGATGGAGACTTCTGAGGACTCC
CTGCACGGACAGAAGGCAGGCACCAGGAGAGAGAGCATGAACAAGGTGGGCTCCAGGGTG
GGTCAGGTCTTTTCTTATGGAAATGGGGGCCCAAGAGCCCAGGGAGAGGAAGTCACTGAG
TGAAGAGCAGGGCCTGGTGGACGGGGAGCCTGCGTTTCTGGTCCGGCCTCCTTTCCTTCC
CCTGGGGGAGTCCTTTATATCCCTCAGAGCACCAGCTTCCTTCTTCCTCATCCAAGGTGG
AGTAGTCAGTCCCCTCTTCACAGGCCGCCACTGTAGGGTCACCAACATTGCAGGAAAAGG
ACCCAGAAGAGTGCATGATGGTGACAGTCATCATTACGAGCGAAGATCAGTGTCATTCTC
CAAATATCAGGGAATCCACGGGGTCTAGGCACAAGGAGACAGAAACAAAAAGTGAGAGAA
GCCCCAGACAGCAGGCTGAGAGTGAGTGCCATTTTTACACAGGCAGAGGCCACCTTAAGC
ACAGGTGTTAACACCATCACAACTGTGATGCAAGACTAGAAGGTAACAGTCGTGCACAGA
GGGTGAGGACAGGACAGTCGGGAAGACAAACTAAAAGTTAGTAAAATGTCCCAGATAAGA
AATAGTGATGTTCTGAGCTAAGCTGACAGTAATGAATATGGAGATTTAGAAGGATCAGTA
CATGAGGGTCCCATTAAAGAGCTGACTAATGGGGCTCAGGGGAACAAATTTTGCTCAGGT
GAGAGGAAAGAATCAGGGTGCGTGAAGCCCAGACCTTTGAAAGATGGTGCCGTCAGCCCC
CCAGGAAGGTGGGAGAGGGATGCCCTGGAGGGCTGTCAGTGTTCCCCTCGAGGTTCCTTG
TGAACAATCAGTAGAACATCCAGAGAAAGTTGTCTACCTGGCTTTGGAGACAGAAGCTTG
GATAATGTGTTAGGGCTGGACATAATCTCTAAGGAATCCTAACTGCACAGTGCGTGAAGA
CACCAAGGGAACCCGCCCAGATGGAGGAGCGAGTAGGGAGGGAGGGCGTGGCTGGCAGGG
AAGGCCTGGAGCAGCTGTCGTCTCAGACCTGCCTGTGGGAACTCCCAGCCCAACCACATC
TCTATCCGCTGACCAAAACCAGCCACTGGTATCTCAGCCACCTTCCCAGATTCTAGGATT
TCAGAAAAGCTCAGAGGTTCTGAGCCATCAGCCATTCAAAGGAGCTTCTCACCAGAGACA
ATGCTAATGATGCCATAGTTCCTAACAGTTACAGGGCATGAATTATTGAACATTTTTTCA
TATTATCATTTGTTCCCCACCACTGTCCTGTGATGTAGATACTGGAACTCCATTGTTCCG
CAGGAGGGCAAGCTGGCCTTCACAGGGTGAGGGCCTTTGCTAAGGCTCAAAGGAGGTGAG
GCGTGGGGCTGGACACAGGCTTCCTGCCCAGGACTGTGTGCCCCTGGGAGGCAGCTTTCC
CAGGCCCCCTCTATGTGTGGTGCTTTTGCCTGGTGGTCTCATTTCTGCCAACACTCACCA
GGCGAAACACAACGAAATTAATTCCGTTGCTCCCACACTGGCCTGCCAGGAGCTCCTGAT
GCTTGTTGAAAATCCAAATTCACCTGTTGGAGATTCTCTGATCTGTTGTAGCCTGAATCC
TCCCCCACCCCAACCTCCACTGCCTGACCCCCACCCTGGGCCAGCAGCTTCTCTCCTAGG
CTTCTCCGGGGCATCCTTCTCTCCCTGATTCCTCTTCTCTTCCTAAAGTTTGTTCTCCAA
ACAGCAAAGATTCATCCTTCAAATACTTGTTATATTATTCAAAATCCTTTAATGGCTTAG
GGCAAAATTCAAAGTCTTTAGCGCCAGCCCTCCAGCTTCCTCTCTAAACCCTCTCTATCC
CACCTCCACCTTCCAGCCTCTGGAGATTCCAACTGCTCCTGGGTCCCACCTCAGAGTGTC
TTCCCTGGGTCTTCCTTCCGGAACATCCTACTCCATCTGATCCTGAGCATTGCCTTAACT
GCACCTGCTGGCTCCTGGCCCTGCCTGGATTATCCTTGGAGTTCTTGTCCCCTCCCCCAC
AGAAATGTGGGCGGGGCTTTTGTTTACTGAACCATGCTGGCCACATGATAGGTGCTCATT
ACCTAGTCGTTAAATGAATAACTGAAAGAAGGCACTGCTAAGAACGCTTGTAGGTGAAGC
TCTTTATCTGAAGTCACACAGGTGATCAGTGAATAACCAGGATAGAGACCCAGGCCTGCC
AGCTTAGCCCTCTCCTGTGTAGCAGGTGCTCCGTGAGGCTGCTCACACTCACTCACCAGC
TTCTGGAGAAGTTGTACTCTAGGATACTAATCCCAGGGCAGAGGGCACCCCAGGAAAATC
AGTTTTCAGAACTCACTTGCCAGCTTGTACTGGCTGTGGTTGCACCAGAAGCTGGCTGTG
GAAGGCCATGTGAGCACGTCAGTGAAAGGCAGAGTGGTAACTGGGGCTTCAGTTGCATCT
CAGCAGCAGCCTGTCTGCTTTTTGATTTACCTGTCCTGTCCCAGAGCATCAGCAGGAGAC
ACAGCAGGTTCAGAAAGACTGATGTAGGCCAGGCACCATGGCTCACGCCCATAATCCTAG
CACATTGGGAGGCTGAGGTGGGTGGATCACTTGAGCTTACGAGTTTGAGACCAGCCTGAG
CAAGAGTCAGACCCCCCCATCTCTACTAAAAAATGAAAAACTTAGGCAAGAGGATCGCTT
GAGCCCAAAAGTTTGAGGTTGCTGTGAGCTATGATGCCATGGCACTATACTAAGGGCGAC
AGCTTGAGGCTGTCTCAAAAAAAAAAAAAAAAGAAAGACTGATGTCTTCTCACCCACCCT
GGGGGAAACAAGATGATCCAGGGAACTCTCAGAACTAAGCAGGGTGGGCCCAGCCATCGC
CAGCACCTCATAAATATTCCCTAAGTGCTCGCATGCAAGCTGGACCAGTTGGCTAGCAGG
GAACAAAGAGGTTTAGAAAAATGTCTTTGCTTGGGGCGGCGCCTGTGGTTCAGTGGGTAG
GGCACCAGCCACATACACCCAGGCTGGCAGGTTTGAACCTGCCTGGAGCCTGCCAAACAA
TGACAACTGCAACAAAAAATTAGCCAGTCGTTGTGGCAGGTGCCTGTAGTTCCAGCTACT
TGGGAGGCTGAAGCAAGAGAATCACTTATGCCTAAGAGTTTGAGGTTGCTGTGAGGTGTG
ATGCCATGGCACTCTATCCAGGGTGACAGCCTGAGACTGTCTCAAAAAAAAAGAAAGTCT
TTGCTTAAGGTGGAAGGAACCATGTCAGATCCCATTATTTATGCAAAAAATAACGTAATT
ATATAGACCAGGCCAGGCCATTTGAGTCTCTCAGTCTGAATGCTGTGCTTCTTGTACCTC
CTAAGTGTTATTGATGATGGAACTTTATTAGGTGTATACAATTTAATCATTTGCAAAGGG
ATAATTCACCATAACAAAAGGTAGGTGAAGTCCCTGCCTAACTTTAGACAAGAAAAACAA
GGCAGCATGTCCAGTTTGGGACGCTGGGCCGTGCCGTTCAGTGCAATAGCCGCTAGCCAT
AGTGGCCACTGAGCACTTGAAAGGTGGTCAGACCAAAGTTGAGGTGTACTCAAGGTAAAC
GAAGACTGGATTTGGAAGACTTAATGTGGTGAAAAATGTAAAAAAATCTCATTGATTGTG
CTGAAATGATAATCTTTGGGCTATATCGAGGTAATATAGTAATATATTTGAAAATATTAA
AATCCATTTCATCCAGTTTTTTTATTTAAAAAAATGCAGTTGTTCAAAATTTATTTATAT
GTTTATTATTTTGTTTTATCTTTTTGAGACAAAGTCTCAATCTGTCACCCTGGGTATAGT
GCCATGGCGTCATAACTCACTGCAACCTCAAACTCCTGGGCTCTTGCCTCAGCCTCCCAA
GTAGCTGGGACTACAGGTCCCCACCACATCTGGCTAGTTTCTCTATATTTAGTAGAGATA
GGGTCTCGCTTTTGCTCAGGCTGGTCTCAAACTCCTGAGCTCAGGCAATCATCCCTCCTG
CCTCAGCCTCCCAGAGTGCTTGGATTACAGGCTTGAGCCACCGCACCCAGCCAGAAAATT
TGAAATTATTTATGTGGTCGCATGCATGGAATTATTTATGTGGCCAACATACTACTTCTT
TTGGACAGTGCTGGGCCAGAATGTTTTGCAATTCACAGGGCATTCCTTCCGAGTTCTTTG
ATAACAGGTTTCTGAATTACTTCTTCACACTCACTAGGGACCCCAGAGGTATTTGAGTCT
CTGCTGGGAAGGAGGTGTTTGGTGTGCCTGAAGCAGCAATGCTTTTCATCCCAGCAGCAA
GCAGCCTGGCCCAGGGGCAAAGGGTCAAACCCAGAGAGTGTGGTCTGGGAGCTCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTGAAACAGCATGGCCCATAGGT
TCCATCTTGGATGTGGACTTCAGCTACTTGATCCAAGCTGTGGTCTGCAAATAACTCTCA
GCTGCATCCTGTCTCAGCCACAGGGATTGGGGAAAACATCCCGTGAAGGAAAGAATATCA
ACTTATGAGCAGAAACAGGGCTTGCCTTGTGTGCCTGGCGTTGAGGACCTGAGTCCCGCG
CTATGCTGTCCCGATGCTCCCTGGACTGGTCCACAGGATCCAGAAGCACTGCACACCCAG
AGACTCACATGGAAAGAGCAGTCCCACAAGCCCTGTCTCCTGTGACTCCCTAACGCAAAG
CACCTTCCTAAATTCCCACGTTCTGACCCCTGCAGGGTCAGACATGCCCCCACATGACCT
GGACATTCTCAGGATTTTGCAAAAGCCCTCGGCATTACTATGTGCAGAGATGAAAACAGC
TGGTGGGTCAGGGGCCAGGTTTTTTTTTTTTTGGGGGGGGGACTTTTTTCTTCTTTTCTT
GAAATTTACTTTTAAATTATTCCATCTCCTTTTCAAATGCAAAAGTCACATGTCTGCATG
AATCCTACAGAAATCCTAAAGGTGACACAGACTGCTTGCCTTTTGTACAAAGTGTAAGCT
ACATGGAAGGCACACGGGATAGGTCCTAACGAGACTAACCGTGTGGACGTGGTGCACCTG
ACAGTGCGCTTGGGCTGCCCATGTGTGCATCTGACGATGGAGCCAGAGTTCAGTCACTGA
GTTGAACAAGAACGTGCAGAAGACGTTTGTAGAGTCTGAAGGCATGATCTTCAGGGAGAA
GGCTTTGAAATCTTCTTTCATCCAAACACCTAAGATTTTGCACCTTGTTTTAATTGCCTA
ACATATTGCAAGGCACTTTTGGAAGTTTTTTTTTTTAAGCAATGTTTACTGAACACACAG
AAGCAGAACCTGAAGAGCAAAGAGTCTGTGTCCCGTGGTGACAGTGAAGGACACGGGTCC
TCCACCCTTGGTAGCTTTGCTGTGGCCTCCTGGTGGTGGCTTTCTATTGTCCTTGCCTGA
GATCTCCATCCCAGAGCTGTGCTGAGGGATGCCCTCAAAGTGCCACCTTCACCCTGCTCC
ACAGTGTAGCCACAGGCCCTCCTGTCACCTGCTCCTTCCCTGTCCCAGTGCCATCAGCTG
CCTATCAGCACCAGCCCCATGCTAGCTGTAAGTGCCAGTCTCGATACAAATTAGCAGCAG
TGCGGGGAAACTGGCAGAACCTCGTCTGGATCCCGCCTTCCCTCCTGTTTGCATCCAGCC
CTCTTCACAGGCGCCAGCTGCCTCATTGAAGAGCAGCCTTTATGCTGCTTCACCTGTACC
CACCCTCGGCAGTAGCTGCGAGCCCTGTGGCCAAGGCTCGGTGCCCTAGAGCTGGGAGGA
TGGAGGGAAGTCTGGCAGGCGAGGGATGGCTTTCCTTCTTTCTCTCCCTGAGTCGCAGAA
GGAAGGCCGGCAGGCAAGTACAGTGGTCCAGGGTGGGGGCCAACGCACCATGCCAGGACA
CCCCTCTGCAAACCCTAGTGCAGAGGCCTGTGACTGAGGACAGAGGGAAATGCCCAGCCA
GGTGGGCAGCCAGACAGACCACCTGCCCAGCTGGAGAGCAGGTGTGCACAGGGCTGGGGG
AGGGAAGCAGAGCTAGATGAACTGCTGTGGGCAGCAATGAGGAAGCTGCAGGCCGCTCAG
TGCCCACTGTCCTCTGCCCGCCTCCCTCAGTGCCAATGTGCCTGAGGCACTTTCAGCTCC
TCTCTGTACCAGCTCATGCATCAGGCAGCTTTTGTGAAATGTTCCATCTTTTCAAATTTA
TGTTTCTCCACTCCTGGCACAAGGGACCAGCCCTGCCACCTGTCTGTGCCTACCATACAT
GGCCACAAACCGTACAGGGTCACTTAATTTCAGTGCCTGCTGAGGTGCTAACCTCCCTGC
ACGGCAAGAGGTCAGTTTTTAATTCAGAAATCCCCAGAGCCCCAGCCGATGGGGAAAAGA
ATCTTTCAAAAATCCCCCCACCCACCGTGTTCGTAAAGGGGAGAGGCCTGTGGAGCCAGG
GCCTCCTCCCTGCCGTCCCCTGCCCACCGACATCACCCTTCCTGAGAGACCTCTGGCCCC
TGCCCACGCCTTCTGGCACTGGACGTCCTCCAGCAGCCGCCCAGCCAGTGCAAACCTTGC
TGTCTTGGGCACGGGCCAGCCTAATCCTTGAGACTTCTGTGGTGCTCCGGCTGTTTCACA
ACTGAGAAGGGTGCTGGGAAAGGCCGCCAGACTGCGGTGGGCATGTGTGCGCTGGAATGT
GCGTGGCATGCCTGCGTGTGTCGCAGCACATGTGCACGTGTGCACGCGTGTTCCGTGTGC
TGGAGTGTGTGCACACGGGTGCAGGCGCGTAGTCAGTACAGGGTGGGTGTGGGGACCCGG
CGCTCCGGCCAGAGCCCAGCCCAGACGCCAGCTCCGGGGCTGACTGGGACCTTCATCGCA
GGCCAAGTCCTTCACAGCAGAAGCCAAAGGGCCAAGCGCTGGTGAAAAGCCCCGATGTGC
TACTGCCTCCCCTCTGACTGCCATGGGGACATTAAACCTTCAACAATCTGGGACTCTGAC
GGCTGGTTCTTGGTTCTCTGCCTGGAAAAACAGTAGGCGAATAGTAAAACCTTAAATTCT
AACATGTGTAAGTTATACATCTTATTTTCATTTCAGCCCATGTTCCCTTCTGTAAGACAT
CAGGAAAAAATTACCGTCTGACTCTAATATCTCAGTGGAGCATTTATCTCCCAGCTATGA
TAAGTGATCTTCAATATTTTTTTCCTTTCAGATTAAGAAACAAATTCATTTAATTTTCTT
TATTGAATGTGCTCAGGCTCCCCGCCCTGCCTGAGTCTCCGGAAGCCCGAGGCTGCTGTC
CCTTCTCCTGGGTTAGTGACACTCCCTTTGCTTGTGGGGATGGGCGGGGCCCTCTCTGGC
AGAGCCCTGCTCCTCAAGGCCTTGCGTGGTCTGGTCCTGCCCACAGCAGGGGATGGAGGG
CAGCAGTCAGGCCCTCGGAACATCCGGAGAGGCTATGCGGCCGGAGTTGGAAGGCTGTGA
TCTGAACCTTATCTGAACTCCTGGGCCTTAAGGCCTGGTTTGGAGCTCTGGAGAGAACTG
GCTGTCTCCCCGGCAGCCAGACGATGCTTCCTGCTCGGCTTAACCACAGCTGCGGCCTCT
CCTTGGCCTTCCCAGTGTCTCCCTTTGGTCCGGTTGCTGCCAGAGTGGCTGAGCAGTAGC
TGGGCAGGGTGGGACAGCACCTCCCCTGAGCATGCTGGAGGTGCACCACTGGGTGAGGGT
ATGTGCACTGTGATGCCGGCCTGCTCCTAGGCACCCAGTGGCCGCAGGGAGGGTGTCTGT
CAGCCCAGCTCTCCGATGGCCGCTCACTCACCAATGCTGCAAAATCCCAGGGGCCACTGG
GCTGCGTAGTTCGGGGCTACGTTGGGTGATTTGCTTTCTCCCTGTGCATTCCCATATCCC
CACCCCCACCCCCACCATGAGCTTTCGGGCCAGGGCTGCAGAATGCCACAGGAGCCACAG
CCTCACAACCCGGGCTAAAGTTCCTGGATTCTATTGCTCATTCATGCACCACCCAGCTCG
TTTGCATGTGAGCTTTGACAGTGAAACTTAACACCGAAGAGCCGAGTCCTGCTTCCACCT
GTACTAGCCTTGTGACCCTAGTCCAGCCAGCCCATCTCTCTGTTTCCTTATCCAAAAAAA
GATGTACCCCTTGCCACGCCTATCCTGGAATGTCACTGGGAAATGTAACAGTGCCTGAGA
AACGCATTAAAATGATATATAAGCAGTAGAAATAACTCACTGGGGAAGAATCTGCTGCTC
ACCCCCCCATAAGGCACTAGGGAGGGTGCCGAATTAAACAAAGTGATGACCCATCACAAG
GAACCATAAGCCAGCAGGGGAGAGTGCATACCAAGCCAAGGTTCACAGAGGGTGTCAAGC
CCCATAACCAGTGTGGACACAAAGTGCTGGGGGACAGTGGGGAAGGTGTGTCCAGGAGCA
AGGACCGAGTTGCCTGGGCAATGAGGCGAAAAATGTAAGCTGCAGTCGGCCTGAGAGGGC
TCCAGGGCCACATGAAGAAGTTCAGACTCTGGTCTGAGGGCCCTGTGGAGCAGCAGACAT
TTCTACGTAGCATAATGACAGGATGGGGCTGGGATTTGAGAGAACGCTGGTGGCAGTGTG
GAGGAGAGAAAAAGAGCAGCAGCACCCCACTGTCACCATCATGACGCCAAGGGGGCTGAG
AGACCCCTCTGGGTCGTCCTCAGGGTGAGTGGCCGGACCTCTGGGGCTAGAGTGAGCTGC
CATGTCCGTAACTCCTCCGGGTGTGTCCTTCTATTCCAGGGAGTCTCCAGTGGACTGCAG
CGTCAGCAAGTGCAGCAAGCTCATTGGCGGGGGCGAGGCCAACCCCATGAACTACAACAG
CTACATGGACGAGAAGAACGGTCCCCCTCCCCCCAACATGACCACCAACGAGCGAAGGGT
CATCGTCCCCGCAGGTACTTTGGGAACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCT
TCAGTTTTAAAATAGAAATAACTATATTTAACAAACGGAGCGCCTTGACATGTGTGCACA
AGTTATGTCATTAGGTAAAAATAGCTTCTTTTTCCTAGGTATTGGTGCTGTGGGTTACAG
AAAATAAAATCATTGTTCAATCCCCCAGTCCATTGACCAGACTTTGCCTCAGCACCAGTA
AGCTCAGGAGAACTGGGGCCAGGTAGAAGGAACAAAGGGAATTACAGGGCAGGCAGTAAA
ACTGACCTTCCCGAAGTAACTTTACCAAAGAGGCAAAACTCCTATTGGTAAACGTGTGAA
TGCAGTCAGGTGTGAAGGTGAGAGCTTAGACTTTTTTCAGAGGGAGTCCTAAGGAATCTG
TGTGTGGAATATGGGCAGGATTTGGTACCGACCCCCTTGGCAGGCCCTCTGTGTGTGTTC
CATGGGGGGCAGCGTCTCATCCTGCCTGGGGTTCGGCCACCCCCACATATTCCAGGCCTG
CTTCAAGAAGCTATGAGAAAGTGTGAGACAGGAGAGAGGAGGGGCTGATAGGAATTTCTC
TGCCCCCTACAGGACTCAAAACCAACTCATAAAGCAATTCTAAGATCCTTCTTTCACAAG
CGTAAGCATATAATCCACAGAAAGGAAGAGGAAGCGTAGCTCGATTCACCAAGCGTTTTT
CAGGTGCCCAGCACCATGTAAACTGCTATGTCTCTGAGTCACTTACAGCATTTCATGTTT
GACCTCCCCCCTCCCTCAGGGGATCAGCTAGCCATCACCAGCCTTGGGGGGAGGGGGGGT
TTCCCTCCTCCCTCAAAGACGGCAGCCCAGGAAACCATGTTAGAACTGACAGAGTAGAAC
CTCTTTACCCTCCCCCAGGCAAAGCCCGGCAGCCCTGAGTCTTTGCTCAGATAGCATCAA
ACTCCCAGCTACCAGCATGGGCAGGAGATCTTCTGGGACTGAAGTGTTAGGGGATCAGAG
AATGGCTCTGTCGGCCCCATCTCATTTAACTGGTCATTTTGGGGAGGGGATGTGGAAATA
AGTCATAAGGGTCCAGATTGCTGAGTTGACCCTACAACCCTCAGCCAGGGTTTGGAATGC
TTTCAAAAGGAATAATAGCAAAACAGCCTTCAGTGGGCCAAGTTCACTACCGCACTAGTC
ATGAAAATAGCATAAATTAATACCAAACAATTTCCAAAGTACTGTGTTCAGTGAGTGCAT
GAGCTATGGATTTGCAGCATTATTTTACCTCTGGCTAATCTTTCAGATCCTCAGACATTG
TGGCTTCCTCCAGGTCAGCCTTCTGGACATGAGAGAAAGTCTCATTTGGGCAAGTCCACA
AATCAGGGCAATGAAATATTAGTGGAATAACCGGCTGAATTTATGATGGGATTTTAAGCC
AAGTATAAACATGGGCCCTACTTAATCAGCAGCTCTGTGTGCAGATGGTGAGAAACTAAG
ACTGAATCATCTAGGAAATGCATTGCAAGAGTTAGCGTGATCCAGACGGGAAGATTTATA
ATTCATTGTTCTGCAAAGGGAGGGAAATGATATTGTTCTGGGCCTAAAGCAGGGGAGGAA
ATATTAAAATAAAAAAAAATATGATGTTAGGTTGAATTTGAGGCCTTGGATACTAACAGT
GAGGAATTTGGAGAAGCAAAGGATGAAATTATATGTATGTAATCCAACTCCCCCCAGGAC
ATGTTTCTTTAGAATTCTGAAAAGGTGCAAAATTATCTCCATTTGCCAATGATCCATGCC
TAATTGCTTCTGGAGAGTTAAAGAGTATGGTGAAGTGAGGAATTTATCTGAGACAGAGAC
AAATACGTATTTGTACAGCGATCCCTTAGAGGCGCTCTGCTTTTGGCATTAAAACAGAGC
GACTCACAGGTGAGGCGAGGCAGGTGGGAAGAGGAGCGGGAACTCCTGGGGGGACCTACC
ACTTCACCCAAGAAGTCCCATGAAGACACAAGTCGCAACCCCAACTCAGACGCTTACCAG
CCACGTAACTTTGGGCGGGTGACTTAGCTTTTCTAGACACCACTTTCCATCTGTACAATG
AGGATATTGCAAGATTTCCTTGAGAAATAATCACAGAGCATGCAGGTCAGCAGGTACCTA
GTGAGCAGCCACCATCTGTGCCATCACGAGGTCTTGGGTTGTCGGTATGATATTCAGTGG
TGGTCTGTGCCCTGTGACCCCAAACTCTCCTCTTCCAACCCCTCCTTTTTGCCAGCTCCT
CCAACAGCCACTCTGATACACAGGCTGGTGCCAAGTGCTTTAAGAGCAGACTCAGCCCCT
GCCACCCAGATTCTCACACATAAAGACCAAGGCAAGGTGGAGAAGCCAGGCCAGTCGAGG
GCGGTCAGCAGAAGATCAGAAGTCAAAACGCTGGGGGATTTGCCTCTGGCCGCCCAGCCG
CAGGGTGTGAGCAGACAGCAGGGCTTGCCTCTGCCCCAGTCTGCTCCTCACCATTCAGTC
CTGGTACCCATGATTGCCAAGAGCCTTCACAGATGCTACAGAATGAGAGGGCAAGTTGGC
TGAGGAGTAGCACAAATACTCCTGCCAAATAGATGCGCTGAATAAAACAGGCCATTTAGA
AGCTAGGGGTTGACAGCAGACTGACAATGAAAAGCCAAGTGTCTCCTCCTCCAGGAGGCC
TTCCCTGAGTCTCTGAACTCACACTGTTCCCTTCCACCCACGAGTCCTTGAATTAGCACC
ACAAAACCCATCGCCTAGCCGAATGGTTTCCTACCTGAATGTCTCAGATAGTAAAGCCAT
GTGGTTGCCCTTCCATCACAAGCATGGTTAAGGGGCTTATTGGGCCCATTGACAACTGGT
CGCCAGTGAAGAAATGGGTTCCAGACTGCTAAGCACTAAGATCCAAGGTTCGCCCTCGGT
GGACCTGCTGTGACTCAGCACCTGCAGTTCTGACCTCACACACACAGCGCTGGCTGAGAA
GAAGTCGTGAGGTCCTCAGGAGGAGACAGCCTCCATTCTTACATGATGGACATTCCCTCA
GAGACTGGACGCTCTTTCTCTAACACAACTTCTCAGCTTTGGATATTTTAAAAAAAGTTT
TGGGGGTGATTCGGTAAAAATTTCAACACAGCTGTTCTTTAAAGGAGAAAATTCAGATAA
AGATGAACACCACTGGGTCAGACTACCACTACTGGGTCTTCCAGCTGCACAGCTGGAATT
ACAGTAAAAGTCCCTGGACTCATGCAGTGGGACCTCCATAGCTGGCCACCTCCCTGTGCT
GGCCACCTCCCTGCACTGACCACCTCCCTGCACTGACCACCTCCTTCAGTCGACCAGATT
TTCTTAGACCAGACAGGCACCCATGTCCATTTCAGCACAGCAGGCCCTGGTCCTTATGTT
GACCCCCATATGCTGACCAGTTTGTTAGAGTCCCTTGGGTGGTCAACTCTCAGAGGTTCT
AGTGCAGACGTCCTCAAACTACGGCCCGCGGGCCACATGCAGCCCGCCTAGGACATTTAT
CCGGCCCGCCGGGTGTTTTTGCCACCGCTGCCTGTCCTGCTTAGCAGCTGACTCGTCCCA
GGGCCCATAGTCTGGCCCTCCGACAGTCTGAGGGACAGTGAACTGGCCCCCTGTTTAAAA
AGTCTGAGGACCCCTGTTCTAGTGTAGCTTTCTGAGAGATCCACATTCTTTCATAAAATC
ATTAATATGCTTAAAATACAGATGGTTCCCCTTCCAGAAATATTGGTCTCTGGCTCTGTA
AAATTGTGTCTATTTTCTTTTCATTTCTTTCTTTTTCTTTTTTTTTGAGACAGAGTCTCA
CCGTGTTGCCCTGGGTAGAGTGCTATGGCATCACAGCTCACCGCAACTCCAACTCTTGGG
CTTAAGTGATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGGATTACAGGCTCCCTGCTGCA
ATGCCCGGCTATTTTGGTGGTTGTTGTTGTAACTGTCATTGTTGTTTGTCAGGCCCGGGC
TGGATTCAAACCCACAAGCTCTGGTGTATGTGGCTGGCACCCTAGCCACTGAGCTACAAG
CACTGAGCCTCTGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCAAGGAGTATGGCCTGATAG
AGATCGACACGTCCTTTTTCCAGAACATGGACGGCAAAGAACTGTGTAAAATGAACAAGG
AGGACTTCCTCCGCGCCACCACCCTCTACAACACAGAAGTGCTGCTGTCACACCTCAGTT
ACCTCAGGGAGAGTAAGTGCAGCCCAGGCCCCTGGGCGGGGAGCTCTGCTGGCCCTGATG
GCTTCCTGGAGCCAACCCAGGGGAAGAGAGTCCATGTACCATTTCCGTTGGGGAGACGCG
GCAAGAGCAGCCTGGCTAGGCCTGTGATGTTGCTGAGGTCACCTGGGCCTCTGCTGACCC
CCTCCTGACCTGTCAAGGGCAGTACAGCAAGGGATGGAGAGCGATAGGGAGCCACTCCAG
AGGGAGTTTTAAGAGGCTAGCTATGTCTTCCCAGGAGAGCCCCTTTCCAGAAACTTCTTC
AGCCTATAATTAGATAGAGATGGATGCCCTGGCTGGTGTTTTTCCTAAGCAATGATTTAA
AGTTCTTAGGGGAAATTCTGGGTTCATGGCTTTTGGACTTACAAGTTTCAAAAATTTATG
TATTAGCTTCCTTTTATCCTTGGGGTACTCTGGCACCCCTGACGCTGCCCCACAGGGCTG
CAGTCTGCACCCTCCCTCACTAAACAAGGAGAGCAGCCCACACTACAGGTGTGTTCAGGT
TTATTGGAAGCACTCTCCTGCCACGGCCAGGAGAACAGAAAGAGCTTTGGAAAGGAGAGT
CTAAGAAGAAAGCAGGCAGTTGTGCAAGGGGCTTATCCAGTAGGAAGTCTTCCAGCACCA
TGCACCCACCCGCCTGTTAAGAATCTTACTTGCTGGTACGCAGAGCAGAGGAATGGAACA
ATTTGAGATCCGCTGACAACCTCAGCTCTAACTCTTACCAGGGCAGGTGGTATTTGGATG
CTACCCCAAGTGTTAGAGGGCTGTTTGGGCTACCTCAAGTGTTGGTGGCCTGAAAAGACA
GCACTAGCACCACAGAGTTGATGCCCCAGGAAGACAGATGTGGGCTCATGGGGCTTTCTA
GCAGCCAGCGCTGGGCACAGACAGACAGGGCAGCCTTGGGACACTGTGTTTGCTGTGATG
GGCAGAGCTGCTGGGAGTTTTGCAGGTGTTAAGCTTTGGGAAGGTGTCAGATGGTGAGCC
CCTTTCAAAACCGAGATCCCTGATAGCACCTCTGGGGCCTGTTTTTTGGACTGTGTTGCC
CCTGTTCACTCCCCATGTTCAGGGGGCCTGTGACGCACCATCTCCGTAATTACCGTCTCA
TTCAGCAACAGTACAAACGTACACTGGCTGGAAAAGTTAAAAATTTTTTTTAAAATGCCT
TTGGAAGTTTCCACCAGTGACTCTGGGCTTCCCAGCCCCCTCAGCGCGTCTGGGAAGCAG
TGGGTGAGGGTGGGGGACGCCGTAGATGTCATCACCAGAGCCATGACCTCACGTCTGAGT
CCTGGCTGCGACATGAGGTCAGCCCCAGAAATGACAGTTTCAAAAAGGGGGACTAGTTTC
CACCCAGTTTTGGATAATTAGCATTTTCTAACGATCCGTATTTTTCAGCCTTTAAGTGTT
TACAGAATGAAAAAAACCTAAGGCTCTTTGACCAGAGTCCTGCAGTGGGGTAGGCAGGGG
TGGGAGCAGGGCAGGCACACAGAGGTGGGAGGGAGGGGCCAGCAGAGCAGAGCAGAGCAC
AGACCCATTCTGCCTTCCCACTCCTCCCAGAGTCTCTGTGTAGGAGGCTGTGGGACCCCT
GGCCCCTTTCTTCATTTGTGGGAGGAGCACAGCCGGATGGTATGCTCAGAATGGGGAGAG
GGCCCAGGGCTGTGGCTCCATGGCAGATGGCCTTGTTACTCAAGTGCACGCTGACCCCAC
GTGGGGATAGGCACTCAGAGCCGTGGGACCCTAGGCCCTGACGAACCCATAAATAGCCCA
AGTCCCCGGTAGTACTTCCTGTCACCAGAGAACCTGAGCCACAGGTACCAAAGTGCTCAA
CTGGCCCAGGGAGTTGGCAGCTGGGAGCTGCTTCAGAGAGGGTGAGGCGGCAAGCAGACA
TGACAAAGCAGAGATGCACAGTTTGGCGTTTTAGGGGGTACAGCACAGCAAGAAAGAACA
TGAATTGCTTCTTCCCTTTCAAGGCTATTTATATGATGTCCCAGACGAGGTTTCCAGACA
GGGGCTTATTCTGGAGCAAACTTCCAGAGTGGGAAGGGGGTAAAGTCAAGCATGTCTATG
GCAGGCCCCTGAGGATATAGGACAGACTTCCAGAAACTGGAGGGTACGTGGCTCACTGAA
GTACCAGGCAGCCACAGAGGAGTTGTCCTGCCATGAAAGTGATTCTGGTTGAAGAGCGCG
AGCCGTCCTTATGATACAGCGTGGGGGGAAAAGCCTCACTAAAAAGCGGCAGAAAAACCA
TGTCTGCCTGCAAAAGCAAAAATAAATACTACTAGTTGTATGAAGCTTAGAAACACGCCC
CAACATAGTACTACAATATCCTTCTGAGGAACCTGGACCAAAAATGATCTGCTGTCAGGG
AAGAGACTTCCCAGTCAAGCATCTCCTGAGTTGATGTCTGGGGCAGGGCTCCTGGCATTG
GTGGCCTCTGTGCACCTGCAGGAGGCTACGTGCTGGTGACTCTCCCTGCTCTCCGGACTT
CTGGGAAATCCCCAGAGCTGACCAACACGTGAAATGCTTTTCAATCCTTCAAACTCTTCA
TTGTTTTTCCAGAGGATGTTTTGTGCTCAGGAGGGAAGGCCAGCGCTTGGGATGCATTTG
GGGTGACCGCATGGAGGCGGGGAGAAGGGGTACTAATTCCTTGCACTCCGTTGTCTGGTC
CTTTTGTTGGGGGTGGGGGGTTCTGACATTTCTAACTTTGGCAAGAGGTGGAAAGAAAAT
AGTTGAGAGCCTCAGCACAGATCGGGGAGTCCTACAGGGCAAAGGGAGATCCAGAGGGAA
GCGGGGACCTGACCCCAGCCTCAGTCAGAAGACTCCAAATTGGTGGCACTTCTCTGAGAA
AGTCTTTCTGGACCTTGATAAAAAGTCTAGAAAAAGGGGAACCTTGTCAGATAAGAAGCT
CTGTCATCAAATTAACCCTTTCCCAGAAGGACCTTGACTCTTTATGCTGCCTGTCTAAGA
GAACTATATTCTTAAATTTTGAATGCCAAATTTTAAGTTTAAAGATGTATTTTCCAGGGT
GGAGAAGAAAAAGCAGTGCCATGAGCCACTGTATACCCCGTGTGCCGGCCTGCATGCTAG
GACTTAGCCCAGTGGGCCTAGAGGTGCTGTTCTTTGTACCAGGCAGAGTGCCTGTGCACC
AGTACCCACCCCTGAGGTCTGGCCAGGGTGCCCATGGGCTTGGTCATTCTGAACTCTCCT
GGGGAGCACCAGACCTCAGGCTCATCTCTGTCCCAGTGTCCTTCACCTTACATAAAAGGA
AGCCCCCTTGTGGGCAACTCTTTATAAGCCCATTTTAAAGCCCAAACAACTGAGGCCCAG
AGTACTTCAGAAACTGGTTCAAAGGTTTTATACAGCCAATGCAGAGAACCTGGTATCTAA
GACACAGACCTCTTAACTCCCAGTCTGCAGCCCAGGCCCCTGCCCCTAGCCCTGGACACA
GCAGCAAGCCAGCTTACCCGCAACCCGCCCTACTGACTTCAGAGTTAGCCTCACTCCCTG
GGGGTTCCACATGGAGGGTTAGGCCACTGTCCCCACAGAATTTTCTGTTTTTATTTGTAC
CCAGAGATAAATGTGTTCTGAAAACTTTTCTGCGGCCTCCTGAAAAGAGGCTGATTAAGC
CAAACCTATCACTACCCCTAGCCCGTCCGTCTGTGGACCTGACTAGCAGCCCCCCAGTAT
CTCGTCCATACACACCATGCCCAGGCAGGGGGCTGCACTTGCAGATGGCAACTGGGGGAA
ATGACATGGGCCCTTCACAAGCCAAAGATTGGAACTGACCTCAAAGAATGTGAGGGCTTC
CTGTCCCCAATGGCAGTTATGGCTCCAGGCCGCTGGGGGGAGTTAGGGGATGTCTGGGCA
CCCAGTAGGTCCAGGTGGGGGTGGTCAGAGACAGGAGGAAGATGTTCATCTGGGTCTGAC
CTGGGAAAAATACTAAGGAACTGCATTTTCAAACAGTGGCTACTCAAGAGAATGAAATAT
ATTGTGTGACAGGGAGACCACAGAAAAGGTATCTATCTTGAGTCCCATTTTTAATTTAAA
CTTAATAGAAAACACATTTTACATTTTGTGGTCTTTCCACCTGCAACCTCAGATGGTCGG
GCAAAGGTGATGGCTCTGGGCAATTATACTGGAGAACTATTATCCCTTCCAGGCCTGGCT
TTGCCGGGTAAAGGAGAACAGGACTCCAGCAGAACAAAAGACCAGATTTCACTAGACTCG
GTAGTAAGCCAGGCTTGTCGCTGAAAGAGTACAGAACCCTGTGCCCCCTCCCTGCCACTC
CCTGTGCTCAGCCACTCAGCCAGGACTATTGACACAGCCCAGCACAGCCCAGAGAAAAGG
GAGCCCCAGATTCAATAGGCTGGCCGTGAGGGGCGCTGAGGATTCTATGGTCACAGCCAG
CCAGGAGACAAAAGCTTGGCACTGGACGCCTGTCTCCCTGGCTCCAGGTGTCCCAGATGA
AAAGCAGGTTAGGTGAAGGGAGTGTGGCGCTAAAGAAAGCAGGATTGTGGGGCGCTACCC
ACCTGCACCCCGCTCATTTCAGACCCCAAATACTGTGGCCAGCGACAGATGGGCTCAAAA
ATGGAAAATGAATTTTCTGGTATGTTTTCACTTTGGGAAGGCCATTCCAATTCTCAGCAG
CAGCCACTTCATGTTTTTAGAGAACAGAGTGCCTCAAATAGAATACATGCATGCACTTAC
ATCCGTACAACCTGCGTGCATGAACAAATAATCAAGCGAACAAATGCTTTAGCTGCAATG
GAATACAAACAAGTGCAAAAATCGTAAATGCACAATTCAAGGAGTTATCACACAGTGACT
CCACTCACCCATGTAAGCACCACCAGGCCCAGGAGTAGGAGAGAAGCCCCTTCTGCCCTC
CTTCCATCCCACCGCCATTTCCTCCCCAAAGGGAAGCACTACCCTGCCTTCCAACCCATA
GGGGAGTTTGCCTATTTCTTTGATTTAGCCTGGAGGCTGCAGCGTCTGCTGGGCTGAAAG
CAGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATACATGAC
ACTGACTTTGACTGAACAAGGATTAAGGGAAAGACTAGAAAGAGAGTGTCCAGCACCAAG
TGCGTGTTTGAAAAGCGTGGAGCTGGGGCAGGAAAGACTAGGAGCCCAGCAGTGAGTGCA
GGACCAGCCCACAAAGAGTCTCCAACCTGAAAAAGCAGTCAGGAGACAGAGCAGAACAGG
CCCCAGGGAGGAGCTGAGTGCCCTCTCTGCAGCCTGGGGAGCTCACTGGAAATCAGAAGG
GAAGGGAATGTGGGTCCCTTGGCAAGGCCAGACGCCCCACGCCAGCCCTTGCTTAGGGAA
GGCAGCCTTTCCTCCTAGGAGTGAAACCTGAACCAAGAACAGTCTTCAGGGCAAAATCCT
TTTCCTAGGCTGCCATGAAATATGTATTTCATGCAAGCTCTGGAGAGGTCAAATAACCCT
TTCTCTGGCTTTCTGGGAGTTTCCTGTGGAATTCACATGTGCTCAGAGAAGAACTTTCAC
CAAGGGGGAAATTTAATAAATGTGGTTTATCTGAGCTCCGTGCTCTCGGCTAAGTCTGCT
GGATGGCTCAGGTGGTTTGCGCCTAGGAGCCCACCGTTTTTCTTTATTTGCTCCAGCAGT
GAGGTTGCAGCCTGAGGGAGAGAATGCCGGGGACAGAGAGGCCGCATTCTTGATTTCACT
CCTGGGATGTTTTTCTATCCCCTTGGAACGTTTGATTCCATTTCTTAACCTCCTTTCAGT
CACGGAGGATTATTTCTTATTGCAGCAGAACCCATTCATAACTTTAACTCCAGGGCACAA
GAGGAATGCTCAGCAGTCTCCTATAAAGGGGGTTATTGTGTGTAACTTTGGTGTCTGCGA
GAGAAGCGATATAAACAGCCGTGGTGGTCGTTAGCATTCGCTGAACATTTAAGAGACAGG
AGCTGCTCTGAGCACTTCACATTATTTTATTTAATCTTCACAGCAACCCATTTGCCGGTG
AGGGACCCATGGTTCAGAGAGGAAAGCTAGACATTGCTGAGAGGTTGGTCTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCTCTGGGACTATAGAACATTTAG
TGCATACTCCTGACGTTTAGTTGTGTTCTCTCAGACACAGGTAAAAGGAAGCTAACGCTC
CTATTTGGAGTACTGCCTCCCGCCAGCTCCCCAGCACTCTCTCCACCAGTAAGGAGCACC
CACCACCTCACCCCAAATAAAACCACATGCTATCAGAGCAGGAAGGAATGGTACTGGCTT
CTCCTCCAGGGCTTGGCAAACTACAAGCTGCAGGCGAAATCTGGCGCATGAACAAAACTA
AACAAGAGCTAAGAAGAATGTGCAACAGAGATAGCACATTGTAAAGCCTACCATATTTAC
TACCTGGCCTTAAAGAAAAGGTTGGCCAGCCCCTGCTCTAGTTCAGGAAGCAATCAAAGT
GGAGACAAGTCAGATCGCATGGTGACTTAGCAGTAGAACAGGACAGGATAGATTAGCATT
CTCCCATCCCCACTCCTGGGTCCCCACCTACCCAGCCCCGAGGCCTGGTGTGCCCAGCCC
TTAAGGCCTATAAATATGGAGGCATGGGGCGGAGTTAGGCGCGGGGGGCGGGGTGAGGCG
CGGCGGGGCGGGGCCTGTTCGCCCAGGTGGGTTCTAACTTCCTTCTGCAGCTCAGGGACA
CCCTAACAGTCCCGTGCATGAGACTGGCTCCAAGGAAATGGCTTTCATTCGCTTTTATTT
TCTCTCCAGAAGTCCCCTGTCCCTCTTCCCTCCTCCCCTCCCACCTCCTTTCTCCTACTG
TTGATCTCATGAGAACGTTTGGGTGATGAGATGTTTTTTGCTTTGCTCCTCAGGTTCACT
GCTGGCCTATAATACAACCTCCCACACGGACCAGTCCCCGCGACTGAGTGTCAAAGAAGG
TGAGTCTTCTCTCCAGCGCCCCAGAGTTTCTGTAGCACCGCATGTGGGGTGAACACAGCT
CCCCACTGTTAAGACTGCCAGGTCTTTAACCAGCTTCCTTGTTCCACTAAGTTATTTCTA
CCGTCCACGACAAGAAGGCAAATTTTTTTCCCATTTGGGCGACTAGTTGCCAAAAATAAA
ACAAACGAAGCTTTCGAATTTCTTGTGATAGTATCGTAAAGCTGTCACTTGAAGTTGTAT
GGCAGGAAGGAAAACTTGCTGCTCTTGGAATGAAATGGACACTGCTCCATTTCAAAGCTG
AAAGTTGGGGATTTTCTCTGCTGAAGGTAATGAAATGAAGATTCTGAGGATTCTGGCATG
TCCAGCTTTGAAGGTGTTTTCCTTACAAATTTTAGCGACGGCAATTGATTTTTAAAGTGG
TAGTTGGAGGATTTGGTCTGGTCTGGTAAGCTTAGTTTGAGAAAGAAAACCATCTCAGCA
AATGGTTTTGGCCAATGAGTTTAGCAAACATCACAATAGCATTTTTCAGCATCTTTATTT
ATGAAATAACATTGTGAGGACTGATCCAGACACCGTGTTCGATTTCAGGCATTTCAACAA
GTGAATATTTCATGGTACTTGGTTTACGGGAGGAAAAAAATGTGAACAAATAATTATTAG
GAAGCGGAAGAGAGGGAGCAAAAACGTTGCCCCATGGCAAAAGAAAAGTCCCATGGAAGA
GAGAACTTGTAAGTAGGGACAGGCAGACGTTTTCAGCACAGTTGCTTACAGCGAAGCCCA
GCACAGCACTTCAGAGACACGTGAGGCTTTCCTAAGGGAAAGGACCATTTGGTTCAAAAT
CCTCCTTGGGTATGGCAGAAACAAAGACTCCAAAACACCAGCTGAGTGTCTTGCCAAAGG
TTACACCTTTGATCACACAGGACTTTATGGTTTCTGTTAATTTGCGATCTGATGACTAGA
ACATTAGAGGGAGAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCACTGAGCCGGAGTCCTTGGCCTCTAAGGAGATGACCCGTG
TGAGCGCACATGTGAGGTCCCCAGCGTGAGTTTCCTTCCACTTGTAGATAGGGATCCATT
TCTTTGGAGGAAGGAAAAAAGAGAGAAAGGGAAGGAACTGCTGGAAGGAGAGGGAGAAAG
GAAGGAGGGGAGGAAGTAAGCAGGAAAGGGAGGCAGGAACCCCCAGTGTGCTGCTAGGGA
TCCTGACAAGTTCCTCCAACTCCAGTCTGCATCCTACAACAACACCAGAATTAGTGAGGC
TATGCGGCAGAGCCAATGAAAGAGTTCCTGATATTGGGCTCAAAATGTAGGTTTCAGTTT
AGAAACTGGCTTGTCCGGGTTGCAATGTGGCACTAGGCACCTGCCCCCTCCTGCAGTTCT
CAGCGCCCAGGCCTCTCCTCTACCTGCCACTGTGTTCCCTTCCCTTGGTCCTTTTGTTTC
TGGGGAGTGTGGCTGTAATGCTGCTGGCTCCGTCAGGCATATTGGAGGCGCAGCTTGCTC
TGGCTGGGTAGCAACCCCTCTTCTGAAATGAATTAACTGTAGTATCCAGGCAAACGCAGG
CCCATTCAGGTGCTGCTGGGTATTTATCTCCCACATCAGCCTGGCCTCTAGAGACGATTA
AATCTGCGCTTTGCAGGTGCATCTTTTGTCCCCAGGAAAGCTCTCCACTTGAGCCGTCTT
GCTCTTCTGTGTATCCACCGTGAGGTGGTCTCGATCTGTCTGAACAACCCACAGCGCCAC
AAAACAAAGTACATTAGCAAGACAAAGCTAGCCAAGCTCTCCCTCCCGCCCCTCCCAGCC
TCTCTCCTGCAGTGCTCTAATAGCTATCTATTAGCTATTAGGGGCCATCCTGCGACCTTG
ACTCCATCTTCTTTGAATAAGACACACACAGCCCCAAACAACCCCAGAGTTCATCAAGAG
TCCCAGAGCTCTGTGTGCGTGCGTGTGTGCGTGTGTGCGCGCGGGCGCGCTGTGTGCACT
CCACAAAGGGCAGGTGCTGGCATCAAACACAAAGGGGAGAAGTTAAGGAGATGCTGTCTG
TGCATCTTCAAAGCACTTAACAGATTAGAAAGCCTTTTACTATAAAACGGCATAATTGCC
CTTCCATCTCATTTCTTGAAAATGGCTGCAATCTCTAAAGGTTATTGGTGTCCAGGAAGC
AAGATTATATTTTAAAAATTGGTTTATAACAATCTTTAAGCCCCTTTTTATTTATTTTTT
GTAAAGACAGAGTCTCACTTTATTGCCCTCGGTAGAGTGCCATGGTGTCACACAGCTCAC
AGCAACCTCCAACTCCTGGGCGTAGGCAATTCTCTTGCCTCAGCCTCCTGTAGCTGGGAC
TACAGGCGCCCGCCACAACACCCAGCTATTTTTTTGTTGCAGTTTGGCCAGGGTCATGTT
TGAACCTGCCACCCTTGGTATATGGGGCCGGCTCCCTACCCACTGAGCCACAGTCGCCGT
CCCTTTAAGCCCCTTCAAAGTAAATATCCTGTGGACACCACTGTTAGAGCAATCGGCTGT
GCTATCTCTACCTTCAGTGGTCAAGGCCAACGTACCGACGCACTTGGAAAATAACGACAG
AAGCTGTTGTCCCTTTACTCAGCAGCCTCGACCATCATCTGTGAAGAGTCTGGGGTCAGA
CATCTTTATATGCTTTGCTTTCAAGCCTTACAGTGTCCCTGTACAGTAGACATTATTACC
TCCACTTTGCAGACAAAGAATGTGAGGCTGGGCGGTGGGGACTCCCTGAAGGGTACACGC
TGTTCAATGGCAGAGCAAGCCCCCAGACTCAGCTTGCAGGATGGCACTCCCTTGCCTCTG
AGGGGCTTCTCCATAAACACAGCCCTTCCCTTCCAGCTGCCTCCTCACAAAAGCGGTGCA
GTAGCCTGAGGTGATTTGGGTGGACACTTGAAACTTTTGCATTATTTTTCTCTTCCCTAT
CCTTTTCCCACTTTCAGCTCCAAACTTTTCCCAAGAGGAACTCACCTCAATCTCTGCTTG
GCCCCACCCTCGAGTTCTAACCTGCTGAAGGGCCACCTGGACAGCTTTTAAAATACGGAG
CTCTAGAGTAATGGCATACGACTCCACTCCTTATAACTGAGCAGTCTAATTTAAAAGAGA
CAGAGTAGATGGGTGGTACAGGGTGGTAGGGACTGGAGACAGGAGTTATTATTTACAGAT
TTCGAGCTTTAGTTTGGGAAGATGAGAAATTCTGCAGATAAATGGTGATGGTGATGGTTA
TACAGCCATATGAATGTACTTAGCGTCACTGAACTTTGCACTTAATGATTGCAACGATAA
ATTTTATTTATTTCAAGACTGAGTCTCATGGTGTTAGCCTAGCTCACAGCAACCTCAGAT
TCCTGGGCTCAAGTAATAATGCTCCTGCCTCAGCTTCCTGAGTAACTGGAACTACAGGTG
CCTGCCACACAACAGGCTAATTTTTTTCTATTTTTACTTGAGACCGGGTCTTGCTCTTAC
TCAGGCTCTTCTTGAACTCCTGAGTTCAAGTGATCCTCCTGTCTCAACCTTGCAGGGTGC
TAGGATTACTTATAGGCATGTGCCACCATGCCTGGCCTGGTAAATTTTATATTATATATA
TTTTGCTATAATTTTTAAATGAAAAAAAATTTTAAATGAAAGATGCTGAGGACGTTCAAG
CCCCAAGAATGCCCCACTAATGCAGAATGTCCAAGGGTGACTCCTGGGCCCTGGAGTTTC
CTCCTATAAGCCAAGCTAGGGGCAAGTTTGAGAAAAAAAAAACCTGCATTATAGAGATGA
GACACAGTTGATACTCTGGCTGTTTATCTGGACCTTGCCCAGCTCCAGCTCCATCCTAGA
AATGGAAGACCTATTTATTGCTATCCTGATAAAGGCACCGATAGGAGAAGCCACCGTATA
ATCATTATGTATTTTTGAGTTATTGTTGTTGATGATTGATTATATTGATTTGTGATATTA
TGATTTTGACAAACTTAGTAGAGAGCTTCCCATCTCAGAAATTCCTTCCCCTAAAAAGTA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAGGATATTGAGTTCCTTGTTTATTAACTCCTGGAACTCATCACG
CTCGGCCAGGGCCCATGGAGCCCGGAGCTTCAGGCCCAGGCCAGGAGCCTCGGGACCTGC
GGCTGAGTACGGAAGCTGAGGCCCGCCTGGCTGCGGGCGGATTGCCTGCCTGCCTGCCTG
CCTGCCTGCCGGCTCTAGCAAACGCCTGGCTGATGGCTAAAAAGTCTGTCTGCTTACATG
CCAATTATGGAAAGGAGAGGGGTGGAGCTACCTCTCTGCCTCCTTTAGCTTTGAAAAGCC
TGGCTTCTCTGAAGCAGATCTCTGGATGGTGGGGGCTTGCACGGAGTAACGACCCCTTTT
TTGCAGTTCTCATTGCTTGCCGAGCGTTTTCACAACTGGTGTCTCGTTTGTGCCCCCCCT
CGTGCCATTGCCGTGAGATGACCGGGCTGGGGTTATTGTCTCCACTCCACAGATAACGGA
AACCAGACACCAAGGAGAGGAGCTGAGCTTCATTACAAGTTGGCAGGTCTCTGGGCACAG
AGGGACTCAAACCTGGGTCTTTGGTGTGTCCTTTCTTCCCTCCAGGCTGCTTCTCACATC
TTTATCTCAGCATACTTGAGTCTGGCATCTGAGGACACCTTAAAGGTTCTTTAATAAACA
TTCTTTAAGGAATAGTCCCATCTCTCAGCTGGAGGTGGGCCTTGATCCCAACTCCTTCAG
GGTGCGTGTGGACTAAGGGCTGGGGCTCCGCACACAAGCAGACAGAGCCCTGAGCAAGGC
TTTCATTTTTTCCTGCCTTAGTTTCATGATATAATGCTCAGAAATCAGCACAGTGTCTGA
CACACCAATAAGTGGCCAATAAGTTATTAATAATAGTACATTATTATTCTGACTCATTAT
AGTAAAATCATAATAGAAATTAACATTAGTATGGTAAAATAATTACAGTCTGGGTTTGTC
AGATGCCCCCAGTGTGCCCAGGGTTGTGAAGGGGACTGCCCCCTTCACAGGTAGACCAGA
TAGCCACCTTGCTTAAAAACTTATGAGGGGGATATGTGCCTAAAAATTAGTGAGGAATAA
TATGCAATGTTGTGTGATCAAAATACAAAAACGCATGCCACATACAGAAGTTCTCTAAGG
GTAACAAAGGGGGGAATCATTAAATGCTAAAGCCCAATGTCTACTCCAAACTTCTCTTCA
TAGAAGAGGAGATCTGTGGGCCCAGCTGGTCACACAGGTAGGTGAGGACAAATGTATGAA
TGTATCTGTATGTTGGCACACGCCGTGGGCGACTCAGTCCAGAACAGGCCTAAATTCTGT
GATTCCTGCCTTCCTCCACCCCACTCATTCAGTGAGAACCCACTCTGTACAGAACCCCAG
CCAAGCCCTGGAAATATGAATGGGACCCAGCCCCTGCCCTCGGGGTTCTAATTAAACTGA
GAGTTGCAAACAGGCAAATAAACACTGCATTGGCGTCTGGTGAATAGGTCGCCCACCTTC
CCATTCTCCCCTGCACTCACATGCCCAGGGTGTCCTGCACGGTTTAATTTTAGGGATCAG
AGTGAAAGGTGAAGCCCTCTAGAAAGACACCACCCAGCAGAGCTGAGAACAGGTCAGGGA
AGGGAAGGAGGTGGACGCCAAGGAGACCAGCGTGTTTGCTGGGGCGCATGGGGGGTGTGG
TCTGGGCAACCCTGTGAGTTTTCAAGTTGCATTTTGCAGGTAAAGAGCCCAGGTGAGTCT
CTGTGGGAATAGCCAAGGTCTCTGTGTGACACAGGTCTGTGACTTGGGTGTGAGGAACAG
AGCCTTGGGTAGCTCTGTTTCAAGGTGGCTTCCTTGAAACTGGAAGACAGGAAGCTCAGC
AAAGGAGCCGGGAGGGAGCCAGGATTTGCTGCAGAATGATCAGGGGGTGCCAAGTGTGGA
AAGTCACAATTGTCAGCGCAGGTGACAAGCTCCCAGGTTTCCTTACTCTTCTCCCTCCTC
TATGTATGTTTGAATCTTTCCTGACTTAAAAGATAGGAAGCTGATTGGTGGGGTCACCTC
TGTGGTTAATCTTACAAGGGGACAAGTGAATCTTTCTAAAAGCAGAGTGTGAATGTCTTG
ACTCAATAACTAAGCAAATGACATGAAGGTTATGTTAACTAGTTTGATGAGAGTATTTCA
AAATGTATATGAAGGCTCGGCGCCTGTGGCTCAAGTGGCTAAGGTGCCAGCCACATACAC
CTAAGGTGGCGGGTTCGAATCCAGCCCGGACCCGCCAAACAATGACGGCTGCAACCAAAA
AATAGCTGGGCGTTGTGGTGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCGGAGGCAGGA
GACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGAAGTCACAGCACTCTACC
CAGGGGGACAGCTTGAGGCTCTGTCTCAATAAAAAAAATGTATATGAAAACAGCACATTG
TATCCCATGATTGCATTAATGTACATAGTTATGTTATAAGAAATTAAAAAAAAAAAAGAT
AGGAAGCTTTGTTGTAATGGGTAGATGTGAAGATGAGCTCAGAATGTCTGCCTCGTTCTG
TCACTGTGTGGGAGTGTCACATGGCATATGGTCCTAGGAGAAAGTGTGCATTTGGCAGCC
ACACATGTGAGAGTGTGTGTGTGTGTGTGGCCCGTGTAGCTCAGTGCATGGAGGAGATTG
GTCGGGAACACATGTCCCCAAAGGAAGAGGCCTGCAATGCTGTGAGGTAACCTCCTGTCA
TTTTTAGGGAGTAAATGTCATCTCTTAGGCAGCAGGTGGTGTGGGGCACAGGCTCTGTCT
AAGTCAGCAGCAGGCGCTTACATTGGAGAGGACGCGGCCTCACAGGACAGCCTGTGAAGA
GCCGTGTCGTTTTGTGTTTTTCCTTTGTGATGAAACACCCCTAATCCATTTTTAGCCAAA
GCAGGGAGGTTGGCGGGTCGTGAGTGAGCCGCGCCTGTGGTCCAAAGGCAGGATTTATGA
TTATAGGATAGACAGTAGCTTGCTCCCTCCATTTTATTTTTTTAAATTGTTTTCCTTTGA
AATTCCAGAGTTAATGTTTTGTCTGCTTTTTATCTGACCCTCTTTGGAGAGTTGGGTGTG
CGTTTTTTTTTCACCAGAAGAGAGAAAGAGAAAAAGAGAGAGAGACACACACAGAAAGAG
AGTAAGAGCAAAATTGAGAGAGAGAGAGAAGGAGAGGGGAGAGAGAGAGAGAGAAGGAGA
GGGGAGAGAGAGAGAGAGAACTGGAAACAAAGAATCCTTGTCTCTAGGCTGTAGCAGGCA
GGAAACCCCAATCCCGGGAGAATTTAGCCAGCCAGCCCTGTCCCGGAGTCAGACTCCAGC
TCTCTGAATTCAATTTGACAGCTTGTCTGGGACACTTTCTAAGTAACCATTATCCTTCCT
TTCTCCAAGTAAAAGGACTGTTATTTCTTTCCGTGGGTGTGCTTTGTATGCTGCCATTGC
ACACGCGCGGGGTACGCAGTGACGAGGGCACACTTTCTCTAAATTATTAGAAACAGCCTG
TTTCCTAAGACAAGTGTAAATTTGTTCCAGGATAATGAGGCAAAAGGCTTGTAAGTATTG
TACGCTGCCTTGTTAGAGGCCGGCCAGGCAATCCGGGAAGAGCTTTGTTGTGGCTCTATG
TGTATACATGTTACTCTTTGAGGATTCCCTTGAAACATACACAAAAATATCTTCCATCCA
TCATTCTCAGCCTCCGAGTGGATTGAATGATTAAAGAAATGCATCACTGTACACTCACTG
TAGAAGGGAGTCTACAGTCCCTTCTACAGTCACAGTGAGCCCCCAGAGGTCGTGTGGGAT
ACAGGCACCAGGAGTGACCACCTAGGCCGGGCACAGGGACTCATGCCTGTAGTCCCAGCA
TTCTGGGAGGTGGAGATGGGTGGACTGCCTGAGCTCAGGAGTCCAAGAGCAGCTTGAGCA
AGAGCAAGACCCTGTCTCCAGTAAAAATAGAATAAAAAACTAGCCAGGTGTTGTGGTGGA
CACTGGTAGCCCCAGCTCCTCAGGAGGCTAAGGCAAGAGAATCGCTTGAATTCAGGAATT
TAAGGTTCCTGTGAGCTATGACACCATGGCATGCTACCCAGGGCAACAGAGAGAGACTGT
CTCAAAAAAAAAATTTTTTTTATATATATATATATATATATATGGACCACCTAGAGTTCA
CAGGGAACGCTGCTTTCCCTGAGAATAGAACCACCAGTTACACAGAGCTGGTTGACTCTG
CCACCATGAGGGACAGTCAGGTCACCACTGTCCTCCCAGTGTGTTTCCTGTATTTCAGGA
GTATCACGATTCGGCTCTGCAGGCTGCTAGAGGCACATTGCAAACTTTCTAGACAACCTT
GGAGGTCAGAGGTGAGACAGCTTTGCCCATTCGGGTCATGATCAAAAGATCCTTCCTTCA
AATATGAGTTGATTCCTGCTAGTCTATTTTCAAGCACGAGGTGGAATGTCTCCCCTTCTC
TCCCGCCTGGTATATACATCCTTCTCCTCATGTCCCTGCCCATCCCTAGTCCACATTCCT
GGAGCCGTGCTCACCCTTTAAGGACCAGGTCAGATCACAGGGCATCTGACCCTCCCCTCC
CCTGTGGGGCTCAGCTGGCGCCCTCCATTTGCCACATGAGCACTCAGCAGACTCTACCAC
AGTCTTTCATCTTGCAAGACGTGAAGCACCGTGGAGTTGGGACCATTGGGTGGATAGACA
AAAACAATAGGAAAAGTGCCTCAAATGGCTCCCCAGGAAGTGGTGTGGCTAGCCCCTCGT
GATGCTCTGGCCAGGAGGTTAGTGTTTTCTGCAGCTGCTGGCCTGGCTGCCTCCCCTCTT
CATCCTGCCCCAAATTTCCACCTGTGGGTCTCCAGGGTGACGCCTCTGAAGCTGTGATCA
ATCCCTTCCCCAGTGAGGAGGCAGGAGCTCTCAGAGAGCAGGTGTCCAGCACAGAGTCAC
AGCACCACCCTTAGACCACCACAGGCTGCTTTCATCAGCTTGAGCTTCCCTTCTGGGCCC
CTCAGGCCTGTGTCTCTGCTGACAGAGGTGGGGGTCACACCCAAGCCACGGAGAGGTGAC
TTTTCAGAGAAAATCTACCTTCTGCTCATTTCAGCCCTCCTCTTCCACTTCTCTTGTCAT
GCCTCCCCATCCCCAGCCCCGTAACAATAAGAGCTAGTGTTTATTAAGCACTCCTGGGCA
GCAGGAACTGCTCTGTTCACTTCACATTGGCATGGCATAAAACCTTGTTAGGTTGGCCCT
AGGACTGTTCCCATTTTACAGATTGGTTAGTCCCAAATCATAAGGCTAAGATGAAGCAGA
AACAGCCCCTGCTCCTGCAGGCCCTCCCCACCCAGGCAGAGACCAGGGCTCCACAAGGAC
CTTTTCCTCACCCGGCCACCACCCAAATCAAAAGGACCATTCCCTCCCAGAGCTGATAGC
TACCTGTTAAGGTGACATGATTAGATCAATTGATTCCTGCTATGGTCCAAAAGAAAAGAA
CCAAGAGCCTGACTCCAAGGACTCAGTCTTACACGCATTTCAAGAAGCATATTAGGTGGT
TTTAAAGATTATTTTTCATTATTAGGCTTTATAATTTATATATCCTTCTGTATTTAATGC
TACATTAAGGATAATAGAAATGAAGAAGAGACTTAGAAAACTAAATTTATTGAGTAACAC
TCTGTCAACAAGGATCTTTTTTTTTTTTGAGACAGAGTCTCACTCTGCTGCCCTGGGTGG
AGTAACCTGGCCTTATAGCTCACTGCAACTTCAAATGCCTGTGTTCAAGGGCTCCTCCTA
GCCTCAGCTTCCCACGTAGTTGGGACTATAGGCACCTGCCACAACGCCCTGCTAGTTTTT
CTATTTTTAGTAGAGACAGAGTCTCACTCTTGTTCAAGCTGGTCTTGAACTCCTGAGCTC
AAGGGATCCACCCTCCTCAGCCTCACAGAGTGTTAGGATTACAGATGTGAGCCACTGCAC
CTAGCTATCAATAAGGATTTTTAAAAATGTAATATATAGGCTCGGTGTCCAAAGCTCAGA
GGTTAGGGTGCCCGCCACATATACCGAGGCAGGCAGGTTGGAACCTGGCCCAGGCCTGCT
ACACAACAATGACAACTGCAACAACAACAAAAAAAAATCAGCCAAGTGTTGTGGTGGGCA
CCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAAGAGAATTGCTTAAGCCCAAGAGTTTG
AGGTTGCCATGAGCTGTGACATCACAGCACTCTACAAGGGCAATATAGTGAGACTCTGTC
TCAAAAAAAAAAAATTAATATATAATATAGCTATAAAGTGCTGTGTTTATTATTCCCTTA
GTTCAAAATAAAGTGTTTCTTAACTATACCTGTCTGCTCTACCCCTGTAGCAGACAGGGA
TGCTTGGACTCAAATATGCTGATAAAAACAAAAGAAAAAAATTTTTAATTTAAAAAACGC
AAGCTGGGAGTGAATAATAGATCAATAAACCAAATTGTAAAGTTTCCTTAAAAAGCGTAC
AGGTAAGCCGTTCTCTGCCACTGCAAGCTTCATTGCCCCAGGGTCTGAAGAAGGAGAAAG
AAAAGCTATCCCAATCCCCTTAAAGACATTTGCCAGAATGTTCTGTTGCAGCCACGCCCC
CAACCACCCACACTCATAGATTCAAGTCTGCCCTTGGTAGGGGAAGGAACAGAGGGGAAG
TTGGAACTAGCACTTGTGTTCTTAGAATAAGCTCATCTCTATTGCCTTCCTGCCCTGGGT
CAGCGTCCCTTCCCCCACCACAGAGCCACTGCTGCCTGTCCCTCTGCCAAAGGGCACCAG
GCCACCTGTGTTGTTTTGGCTGTTCAGAAGTGCCCACCTTGGCCCTCCTGCCTGCCTTGG
GCTGTCTTTGGCCTTTTTGTTTCTCAAAGCTGCCAGGCCACTGGAGCTCACCAACTCTTA
GTGGGGGTTCACACTAGGTGGGCCTTTGGAGTTTTAATTTGTAATTTATCTCCAGACTCT
AGGCTGTTAGTATTTTAGGTCTGCTGTCTTACCAAGTTTCACTTTGACTGGGCACATTGA
TCTCAGTACAGACAACACAGCTAAGACTCAAAAAGGAATTGGCCTTGGTTGATGGGGCTC
CATTGCCGTGGCCATGTGGTCTTGGTTTGTAGCAGAGAGTAGAAGAGGCCCCTGTTGGCT
GTTCTCAGAAATTGGGTCCCAAAATACTCTGGAAAGAAAAGGGAAGATCCCTGGTGCTCC
AAATGACCCACTGGTGGCCACTTCAACACAAAATATTCCAAACACATTTGTCTCCCCAAA
TACACTGATGTAGAAATTCTACTGCAGGGAGGTTGTTTGAAGGGCAGTGGTTGGGAACCA
TTTGCAAGAAGCTTGTTTAGTCCCATGCTCATAAGCCAAATTCTTTCTGCATGTCTATCT
ATCTAGACAGAGAAGCTGTTTTGTGCCAGAGGGAGATGTACGCGCTTGGGGCTTCTTCCA
CTGAAAAGCTAAAGTAGAAGCATCTTTTGTTAGTTTAATATTAAAAAGTTTCCTAAGCTC
TTTTTATAACAACTTTCTCTCTTCAGAGAAGACCCTATGTAAGATAATAAAGGGCTTATT
TCTCATGAAATATCTTTGTGCCAGAAGAAAAAGTCTTTGAGGATGAAAAACTGAGAATAT
CAGGGGCTTTTCCTCTCTGGTCTCAGGGACCTGTAAGCCCCCACGTGTGAAGGTCCAGAA
GTTCAACCTGCCTCTTTGATAAAGTGCGAATTCTTGTGTCTAGCATAATCTAATGAGAAA
ATAAGGGATATTAAGTGGGATAATTACTGAATCTGTCAAAGTCAAGTCCCACCTGCCTGG
AGAAATTTTTCCTTACTCCTAAAGACTACAGTCTCTTCTCTGAACCCCACCATGTTCAGG
AGCTATTTATGGACCTAATTATAGATTATCCTGCAGTCTTTGTGAGTTTTTCCCTGTCTC
CCTTTTTTCCAGCTCTGTCGATATTCAGTAAATACCATTGACAGTTGATGAATTAAATCC
GCTTTTTGTCAATTTAATTAAATATTTACTTGGTCCTTCTGATTCACTATCTTTGGTTGG
CATAAGAAAGATTAACTTCTTAACTCTTATAAATTAAATTCTGGACAAGAATAGCAGTTT
TGGCTCATGCCTATAATTCTAGTGCTCTGGAAGGCCAAGATGGGCAGATTGCTTGAGCTG
AGCCATAGCAAGACCATGGCTACTCTACTAAAAATAGAAAAACTGAGGCAAGAGGATCAC
TTGAGCCCAAGAGTTTGAGGTTGCTGTGAGCTACGATGCCATGGCACTCTAAGCAGAGTG
ACAGAGTGCAACTCTGTCTCCAAAAAAAAGAATCTGGCTTTAATTGTGTAGGACACTTGA
AGTATATGAAGCATTTCCACATACATGATCTCATTCATTCTCAAAAGAACTCTGCAAGGA
TTCAGTGTGCTGTTTGCTTTTCCAAACTCTTAAATTCAGGAAGAATCATTCCACCTACAT
ATACACAGTTATCCACCTTTCACAGATAGATTAACTGAGGTTCAGAGAGGTTAAGCCACT
TACCTAAGTTCACACAGCTCACTCCTGGCAGAGAGGGAAGACAAAGTTCTGACTCGAGTT
CAGAGTTCTTTCCTTCACAATGAGCCATTTCCCTGTTTAGAATAAAGAGAAATTATGGAA
TTTCTTGCCATCAAGTTCATTCAGAATCCTTAAAACACCAAAAATGGTCCAATGCTTGAT
AAGATTTAAGTACCACTCATCCAAAGAAATGGAAATTGGTTTTCGTATAATTTTGAAGAA
TCTTTGTGCTTAAAAAGACTTTGGCTTGTCTGCAAAATAATTATCAGTCCTGCCCAATAT
CCTAGAGGAGTTTAGAGAAAGGCAGTTTTTATGCTCTGAGTCATATTTTCAATTTCTATT
AAAATTCTTACATAGCTACACATGCTTTCTCTCAGGCTCTGGGCCTCCAGGCCTGTGCTA
ATTTGCATGTCTGGTTTAGATAATGTCTGAAGGTCTCTTGCAGTCTGAAAAGGAGCCTCT
GATTCTATGATACAATAAGCAAGACCACATTCTATCTACAAGGAATTGAAGGTTCCCTTT
CTCTTCACTACTGTGCTGTGTCTTACATGTGGATACAGGGCTCAGGAAGCATGTCACACA
CCCCTGCCAGGCCAAGAAAGGCGGAGTGTTTGTTCAGGATGAACTCACCTGTCCAATTCC
CCCACACTGACCCCAGAGGCTTACTCTTTCCTAAAACCACTTCAGACATAGGTTAAAAGG
CGATTGTAAGCAGTGTTGGGATTTTAAGTTTCTTCATTTGAATGGCAATTCTAGTTCAAT
GTGTGTCTAAGACCACAAATTGGTTGACTCTTTAATAATAAGACCTATCACTATATCCCT
CACCCAAACATTGAAGAGATGCTGTAGACTTTTTAGCTAATTTGTCTGTCCTCCAACATA
TGACACTTCTCACTAAAGAAGTAATTAAAAAGCGTGGACTTTCCAGAAGGGCTTTGAGAT
CAATGTAGAGTGATCTAATCGCTTTTCAAAAAATAATTACAGTGCTATATAGAGCTCCAG
TTCCATAATGTTAGACAGATTAAGTCTTTGCTGAGATCACGTATTTTCAGGGAGGCCCTT
CCACCCCAGCACTGCCTACACTCCTCCCCTGGTTTTCTATTTACCATAGTATCCCTCAAC
TTCTAATATATAATGTAGGTTACCATTTGTTTTGATGTAAGCTCCACAGAGGAAAGGTGG
TCTAGTCATCATTGTATTCTGAGCACACAGAAGTGTCCCCCACCAGAGCAGATGTTCAAT
AAAACCTTGATGAATGAATGAATGTGCAGTGGGATACAGGTTTAAATTAAATTCAGTAAG
TCGATGTTGGGGGGCGGGGCAAGAACTAGTTCTCCAGGGAAAAAGGTGATTAAGGTATAG
TCCCTCTTTTCCAAAAGATCGTCCCTTTCAAGGGAGATCCGTGCACAAAGAATCACTCTA
GAACAAGGAACGTGAGACAACATACCAGTGAGCCTTGACCTGCAGAACTTGGAAACAGAT
GACGCAAAAGCTGGATTGTGGAGCAGATATAGGGTTGTGTCCCCCCCACCCCCGACCCCA
AGGCCAGGGAGCGGGAGGGCAGCCTCGTTTCAACATGAGAGGGCAGGTCGGGGCTCTCAG
CAGGGCCGAGAGGGTTGAGCAGAGGCTGCCTCTCATTTGCACTCTAGCCTGGTTACCTAA
GTGAACAGTTATGTTTTCTTTTTCCTACCTGGAATCCTCCTAAACTTGAGGCAGATTTGA
CCGGAGAAGTATGCAATTTAGTTGCGTCTATGTGGCCCAATGTGCAGGGGAGTTTTGGCA
AACACCCAGTTAATCTAGTCAGTATGAATTGCTTTTCCACATCTGAGTGGCCCAAAATCC
CACTTTGAGGCCTTATCAAAATAAATAGGTCCTTTAGACATCTGTGTCATTTAAACGCAG
AGCCTACAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGAG
CCAGTGCTGAGCTTCCAGGGGCCGTTTGATTCCAGGATAAGATCCTGGAGCAAAGGAATC
CGATCCAGGATTTTTTTTTTTCTATGAGTTCCAAGTTTGGGGAAAACCTTCCCCAGATAT
TTCCCTCCTCCTGAGTTCTCAATGGAAGCCAAGCCCCTCTGTTGCTCTTTGGGACATAAA
ATGCCACTCAAGCAAGGGCAGAGTGGCTTCCATACAATACAGAAGGTGGGATGGGGACTC
ACCCTGAGCTTCAGGGCCAGCTGGGCAGGACCCTGAGCCACTGACACTCTGGGAGAAGAA
CAACACAGGGTGATAACTGGGCCCAATATCCCCACCCGCCACCCAGGCCAGCAGCCCTCT
CTGTCTTCTGGGGCAGTGTTTCTCAAACTGGGGCCCAGGATAATCTACCTCTTCCTTTAA
GTTTGGGGATCATGGATCCTGGATCGTGCTCCTGAGGTTGGTGGCTAGAAAAGGCTGCTG
CTCTTCCTGAAAGACTGGGCCTGCCAGAAACACAGGGCCTCAGCCCCAGAGTGAAACTGT
CCTTCCTCCTCTACGGCCCTGAAGCTGCCCTTCCTTTCCAAGGCCTTCTTGATGAGCTTT
GCAACATCATTACACCAAGATAAACATGGTAGAGGAACAAACGAGCCTGAAGACACTATA
TGTGTGTGTGTATACATGGGGTATATTTTTATCGGCGCTCATTTAACCTTCATAGCAACC
CTAAAGCCTTTATTACTAGTTCTTTCAGAGACACAGAATCTGAAGTCCAAAATGGTGCCG
CAGCATGACTAAAGGCACTCACCAGTCAGTGGCAGGGCTGGGGATTTGGACTCAGAGCAA
ACTGATCTTAAATCTCATATCTATGCTGCAGAATAGCCCAAGGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCTTGGCCCA
TGTTCTGCAATATTGGGTTGGCGCCCACCCCACCCTACACAACAAAGGCCATTGCTCCAC
ACCAGAAAACCATCCCTAGTCTTCCTCTTGTGTGAGCCTTGCCTTTCCTTGGGAGATTGA
GGGGTTTGAATCTCAGGGCTGCCGTTAAATTGAGCGTTCCTCCTTTTCAATCTCTACCCT
ATCAAAGAAAACAGAGGGCTGCATCATGCTGGCTTCTGGTTGACAAGGCCACCCCTCTGC
TCGGGAGCGTGAGCAGCCTTGGCCCACTCCCGGGGCTGAAAAGGCCTGCATTCAGAGGCC
AGGCTTCCCCAAGAACAAACAGAGCTGGGTGCCGGCCAGCCTTCTCAGCAGCAACCCAGT
AATTCAATGAGAAGTTTCAGGGAAACATGCATCTGTTTTCCACCAAATCGTTGAGAGCGA
GGTTTTATGTCATAGGGCGTGAAGAGAGAGGCTTTTGTGGGCTGGCGTTGCTGTGTCTCT
GCCTCTGAGTGAGGTCATAACACACGGGAGAACTGCTTGTGGCCTGACGACAGGCAATGG
AGCGGGGAAAGATCTTTCCCAAGACGTGTGGCCGTATTTCTAGAACCCGTCTAAAGACTT
CACACGGAAACTGAGTTAACCTTGGTATGTCTCTGAGAGGGACATGTCCAAAAAGGGCTT
TTTCCTTCCAACAGGGACTTTTCAGAAAAAGAAAAAAAAATCCACCATGCTCATATTTCT
CTACCCCAGGTGGTCTCTCCTGGAATCCAAGAGGCCATTTAGTGTCAAATCCCAGCCACA
GTGAGCGTCACATAATGGGGATACTGTTAGACCATCGCCCACGTGAGGCTGGGTGCCCAC
AATGGCTGGCAAAGCACTCCTTCTCCAGAACGGGGCTCCCATCTCTGCTTTGGCAGAAGT
TGATCTCAGGACCGCCTGAAACCAGAAACTCCAAAAGAAGTGCTTTTTGGTGACTCTTCC
GAAAAGGAATCACAGGGAGATCTGTCATCTTGGTACTCGGTCAAGTCAAGTCAGCCTTCA
CTAAAATAAAAAGCGAGTTTGTCTGCACTGGGCTGTGATTTTCTGCTGATGAAGCCATCT
GTCCCCCCAGGGAAGTTCTGAGAAGGTGGCACTTTTTTCACATCGTGCCTCCGGCTGCTG
CCTCAGGCTTGTCTTTGCAGAACTCTGCTCTCAGGAAGGAGACCGGGCCTCAGGGCACAC
TCAGGCTGTTTCTGGTCAGGCGTCAGGGAGGGAACGTGGCTGTGCAGCCGCTGGGCCAGC
TCGCGGGTCCAGGACTTTCCATTTTGGTTATCGACATATTTCTGTTTGTATGTCTGGGAC
TGGAGCTGACCGCACTGCTAAGTTTTCACTTGTGTGACTTTTAGTAGGAAAGAAAATGAA
CCCTGGTTTCCACAAAGACATTGTTAAAAGCACATAAAATCACATGCAGGCCTCTCCATC
AAGTAGCAGCTCGCCCTTGACTCCCCGTGGAAACTGCGTTCAGCCTGTGCTTTATAACTA
GATGGACTGCCGTCTGTCATACTCAGAGGGGACATGGGGTGACAGTGTCTGCACCATTCC
TCATCTCAGGCTTAGACCTGGAGCCTGGAGACTTACTTGAATGCAGAAGTGGGGGGCAGG
AACTCTGGATGCTTTTAAGCTAGTGATATAATAGACAAGAAGAACTGTGTGTGTTTAGCA
AGAAGGAGATGCCGGCCAAGTTTATTCATTCATTCAGGTGCTTACAGCACGCTTCCGGGG
CTGTGCACTGCCCACGGTGCTCGGGTACATCAGGGGGTGCAACACACATCCCTGTGATCC
CCGCCCTGGTGGCATGACAGTCAGGTGGAGGAAGCAATCAACAAGAACGTGAATGAATGA
TTGACTAAGCCGGGTGAGAAGTGGGAGAATAGGAGAGCAGGGGAAGGAGAAGGGGGGGGC
AGGGCAGGCACCATGGTTCTAGCTCTGAGTTTGCCTGGTACACAACAATGATGCTCCCCA
GTAATAATGATGCTGACCCCACCTGGGACAACCCCGTGCCAGGCCCCGCGCTGGTGTTTC
CTTGGCCCTCCCATACACTCTGCAAGGCTGCCCCAGTTTTCAGATCTCCAAGGTAGGATT
CCAGGCTCAGCTCTTGGCCTTGGCACCCCCATCTTCATTCTTTGTCTTTGGAGCAGAACT
TGCTCCAAAAATGCTGGTTTTAATTTAAATCTTACATTAGAACCCCAGAGCCTACAGAAG
ACATTTGTTAAACTCCTTAGTATGTGGGCCCAGGCTGTCCTCTGTGGATTTGGGTGTCAG
TGTGTATGTGGGGGGAGTATGTGAGTATCAGAATGCAAACACACAGGAGACACAGGGGTG
GGGTGGGGTGGGGGGACAACTAGCGTCCTGCTGCTCTGACTCCACGCCCTGCTGGGGGTC
TCCTGAAGACACCAACTTATTTACAGCCTGGCCAGTGCTGTTTATGGCTCTTTTAACCTC
AGTAAGAAAGCAGTTCAGGCTGGGGCTGGGTGGCTTTCTGTTCCTGTCACTTGCTGTTTC
ACCTGTGAAAGGTGAAACAGGGTTGGGTGGAACATCCAAAGTCCTCTCAGCCAGGCTTCT
GCCCCAAGAAGCTCGGTGTCCCTTCTCAGGTCACTCTGACAAGGCACTGTCTGCAAACCA
GGCCTGGTTTCTTAGAGTGACAGAAAGATCCCACGATCACCCGCCTGTTGGGGAGAGGGA
ATTTGTGCCTTGTGTAACTTTTACATGCTCCCTCTGTCCCTGGAGGAAGAAAATGTAACA
AGGGTCAATAGTAACTCTACCCACGGACAAAATTTGGGCTTGAATTTGGGCTTCGGAATG
GTTACGAGATAGGTTTTCGACAGACTACCGACTAAAGGCAGAAAGACTTGAGACAGAGAG
TTCTGGTGCACTAAGCTGATATCAAGTCAGAACTTGAGATGACACTTCAAGACGAAATTT
CATGTTCCTGGAAGTTGGTGGTTTTTTGTTTGTTGTTTAAATTTGTCATTGTCAATTCTA
CTTTCTGTTCTGTTCCTGCTAAGGTGAGCCACCCTCCTACGCCCTCACACACTTGTTCTT
CCCCACACCTGTTTTCCTGTTTCATCACTGCGTGTCCCACACTTCTTTCCATTGCCTGGA
ACCCCAAGTCCAGGCAGACCTGAGCGGCCATCAACAACCTTGAACATGCCCCGGCTCTCC
CGCCTAAACTTTTACATCAGCAGTTCTCAACCTGTGGGTCGCAGGAACTGCAGTAAAGGG
CTGCAACATTAGAAAGGTCGAGAACCACTGTTTTACGTCCCTTTAGTATGTCAGTTCCAC
CTGTGGTTGTCCTTAGATGTCACCTTGGCACCGCACCACCTGCTCTGTCTTGTTCCTGCC
GCCTCTGTTCACTGTCCTCCCTCCAGAGAGGTCTCACTCAAGTCACACAGCCCCCAGGAG
GGCCTCTCCTGCCCCAGTTCCACTCCCCTGTCCCTGCCGCACCTGCAGTGGCCCCGAATG
TCTCCTCACCATCTTATCTGCTCGTATGATTTACATGCAGGACAGGGAACCCTTCCCTAT
CATTCATATCCACTCCACGGCCAAGCACTCAGGGCAGCGTCCGCACTGGGCCCAGATAAA
CTACTGGAAACCTAGCCAGCACCTCTTCCTGCCCCAAGAAAAGCTTTTATCGAATCTCCC
CTTTCCTTTGGCGATGCTGACACTGCACGTGTCTGCAGCCTCAGCAAGGCAGCTCTGACA
GTGCCCACCAGAGCCCTCGACCTCATTCCAAGCTTGTGCGCACGTGGGTCTTCTTCATTT
GCATGGCTTGTTTTTTTAAGCCAGAAGAGGAATCTATTTACAAGAGGAATTGTGAAAGGA
AAAAAATCAAAAATAAAAGCAGATGACTTAAAGGCATTGAGCTTGGTCTCTCTCTTCTGT
CCTGGCCCTACCCCTCCTCCCAGCCACACCCCCTCACTTTCTGTTTTGCTTTTCATGCCG
ATTGCTAAAGACTGTAATTTAAAAACTGAACAGACTTTTCCAGAGGCATGAGGAACATGC
ATGTGCACATGGGTTTTTCCAACAGAAAACTGTTCTTGTCTATTGGTTCTTCTTAGCCAG
AACCAGCAAAACCAGGCAATAGGAAAAGTCCATCTATGTCCCCAGGTCTTCTTCTAATTT
GTCCGAGGGGCTCAGAAGGGGTGGGGGGGAATGGTTTGTGTTTCACACTGTCAGCCTGTT
GTTTGATGAGGTTTGCGCTCCATTTGTTGGGATGGTTTTTATGGTTTCTTTGTTGTTCAT
GGAAAGACTTTGAAAGTCATAATTCTGTATCCTTAAGCTCGTCTGCTGTTCCTGCCCTCT
GTCTCCTTGGGACTCACACCACCAGAGAGGAAATGAGGGAAGTTTCCAGCCAGTTAGTTG
AGCAATCTCTGAATGGGGTTATGGAGTCAGGTGGAATCTTTCCGCAATGAGGTTGGGGGC
ACAGAATTTTAAGTTTGGTGGAGTATTCTCCAACATAATCTAGAAGCAGGCCTGGTGTCA
CGTCCACACAGGAGGTATGTCTCCATCCACTGGTTTCTACCACACACATCACTGGCCTTG
TCCCTCTCTCTGTGGTCATTGGGCCCAGCCCTGCTCAATCAGTAGCAAAGTCTGAGAGAC
CCAAGAGAGCCTGAATGTGCCCAGTGCTCTGAGACAGCTTCCCCACTCAGCATGCTGGAC
AGGGGCTGAGTCAGCCCCCAGGGAGGATTTTGCCACACAGCTGGGACATGTTTTCTTTCA
CTCATGTAGTTTTATGTGTAGAAGCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTATCTCATTTAATCATTACCACAACCCCATAAGGTACATGATTCACATAAAG
TTTTATTTCCATATTAAAGAAAAATTGAGGATCAGAAGAGTCTTAGGTTTCTTCCAAAGT
CTCACAACAAATAATGACAGAGACAGAACTTGAACCAATCCTTGTACTTCAAATTCAGGC
TCTTCCCATCACACCAGCTCCCAAGTAAGACTGAAACCTTCTCAGAATCAGTGTTACTGT
TCTGTCCGCCACCCCAGCCCTACTACAGGGGAAGACTACACTCCCAGAATTTTGTGATGC
TTAAAAAGTTTCTGCTGAAGTAACTTCACTAATTTTTTTTGTTTGGAAAGAATAATTTTT
TAATCCAGATTTATAGATAATGTTCATAACGTACATGTTGTTTTAAAATATATATACATT
GTGAAATGACTAAAGTGAGCTAATCAAGATAAGTATTATGTCACACACTGAACATTTTTC
TGGTGAGAACACTTAAAATATATTCTCATAGCAATTTTCAAGAATATAGTACATTGTAAT
TAGCTGTAGTCACCATGTCGCAATCTCTTGAACATATTTCTCCCCTCTAACTGAAATTTC
ATATCCTTTGACCACCATCTCCCCAAACCCTCTCCCCCCAGCCCCTGATAACCAGTCTTT
ACTTCTGTGAATTCAACTTTTAACGCTGTACTTATAAATGAGATTATGTCGTATTTGCCT
GTTTTGTTTTCTTGAGGTTTGCATTTATTAATTTTTTTAGAGTTTTTTAAACTTCAAGAT
ATTAGGGGGCATACATATTTTTTTAATATGCTTTGTTTTTGTATGAGTTGAATGAAAATT
ATACACCTAAGCGTGCCCTTCACAGAATAGTATGGTGTGAATTTACTCATCCCGTCCTTT
CCACTCCCCCTAGCTTGATTTTCACTGACATTTGTTTCCATAAGCGCCCTTACGTATCCA
TCAATTAGTTCTGATTTGCTATTGACTACGTGTCTTTGTTCCTCCATTCTTGGAATGTTT
CACTTAGAAGAATGGTTTCTAGTTCCCTCCATGTTGTCCAAAAAGATACTGGATCACCTT
TTTTTTTTTTTTTTTATGGCTGAGTAGTAGTCCATAGTACGCGTATACCACATTTTATTA
ATCCATTCATGTATTGGTGGGCTCTTGGATTGTTTCCACATCTTTGTGGTTGTGAATTGC
GCCACTATAAACATTTAAGTGCAGGTGTCCTTTTTATAAAATGCCCTTTTTCCTTTGGGC
GCATACCCAGCAGTGGGATTACTGGGGTCAAAAAGTAGGTCTACTTTCAGTTCTTTGAGA
TGTCTCCATAGAATTTTCCATAGAGGTTGCACTAGTTAACAGTCCCACCAACACTGTATA
AGAATTCCTTTTTCTTCTCATCCACACCAGCATCTGTTGTTTGGGGAATTTTTATCCTAG
CCATTCTCACTGGAGTTGGGTGATAGTGTAGTTTTTTATTTGCATTTCCCTAATGATTAG
AGATGTTAAGCGTTTTTTTCATGAGTTTGTTATTCATCTTCATTTGAAAAATTTCTGTTC
ATGTCTTTTGCCCACTTTTTAATGGGGTTGTTTGGTTGTTTCTTGCTGTTTTGCTTGAGT
ACTTTGCAGATTCTGGGTATCAGCCCTTTATCAGAAGTACAGCATGTGACTATTTTCTCC
TGTTCTACAGGTTGTCTATTTGCTCTTTTGTCCTCAGCTTTGCAGAAACTTTTTCATTTT
ATCAGGTCCCATTTATTTATTTTTGTCATTACTATGATTGCTTTGGGTATCTTCTTCATG
AATTCTTTGCCAGGCCAAAATTTTCTTTTAGGAGGATTCTTACAGTTTCCTGCCTTAGAT
ATAAGTCTTTTATCCTTCATGAGTTAATTTTTGTGCGTGGTGAAAGGTGCAGACCCTGTT
ATAGTCTTTTACATGTGGCTATCCAGTTTTCCCAGCACCGTTGAAAGGGATTTCATCTTT
GGGTTCTCTGTTCTCATCTATAGGTCTGTGTCTCTGGTGCCAGTACCATGCTATTTTGGT
TACTATAGCCTTGTAGGATAGCTTAAAGTCTGCTAAAGTGATGCCTCCCACTTTGTTCTT
ATTATGTAAAGTTGCCTTGCCTATCGGGGTCTTTTTGTTCTATTATGAAGCATAGAACTA
TTTTTTTAGATCTGCAAAAAATGGTATTGGTATTTTAATGGGAACTGCAATGAATCTGTA
AATCAATTTTGGTAGTATTGCTATTTTTACAATGTTGGTTCTGCCTATTCATGAACTTGG
TATATTTTTCCATCTGTTTACATCTCCTCTGCAATTTCTCAATGTTTCATAATTCTCCCT
ATAGGTCTTTTACCTCCTTTGTGAAGCAGATTCCTAGGTATTGTATTTTATTATTGCTGA
TGAGAAAGATATTATGACATCTTTTGTTTGATTCTTAGCACAACCATTGTTGGCATATAT
GAAAGCTACTGATTTCTGTACATGTATTTTGTAGCCTGAGAATTTACTAATTTTATTTAT
CAATTTCAGTAGTCTTTTAGTTGAATCTTTGGGGTTCTCTAGATGTAAGATCAGATCATC
AGTAAAGATGATAACTTGACCTCTTTTTTCCCTATTTGGATACCCTTGATTTCCTTCTCT
TGCCTGATTGCTCTGGCTAGGATTTCCAACACTACATTGCACTGAAGAGGTGACAGTGGG
CAACCTTGTCCAGTTCCTGTTCTAAACAGGAATGCTTTCAATTTTTCCCCATTCAATATG
ATGTTGGCTGTGGATGTATTGTATATGGTCTTTATAATTTAGAGGTGAGTCCCATCTATG
CCTATTTACTTAAACATTACTATCATAAAAGGATGCTAAATTTTGTTGAGTGTTTTTTCT
GTGTCCATTAAAGGGATTCTATGGTCCTTGTTTTTTGCTGAAGTAAAATTAATCTTTCCT
GATAACTTAAGAGAGAATCCTCACGCAACCTTTCTTAAAGCAGACAGTGCTAACATATCC
CTAACTTGTTGTTTCTTGCTAGATCCTTCCTATGACTCAGTAAGGAGAGGAGGATGGAGC
AATAACATGAATTCTGGCCTCAACAAAAGTAAGTAACTAGCATCCCAGTCTTTGAGGGGA
AACATTTTCTGAGGACTGGGGTAGAGAACAGGGTCACAAGACAAAGGGAGACAGGAGCAA
GCATCTACTTCCCCACTTTCTGAGTAGATATCAAAACTAATTGTCATTTGAGGGCCTGTC
CATGATACCTGTTCCTTGAAAGATGACATGGGATTTTCATTTAGACCTCTGAGTTTTGTC
TCATATCACCTGGTTTAGAGATTTGAAGTTTGCAGGCTTCTTAGAAGAAGGTTCTGGATG
AATGAAAGGTTGCTGGATTGGAGTCAGCACAATGACCCACTGTGACCTTGCCCCTCTGAT
TGGTTTTTTGTTTTTTAGGGGGTTTTTTGTTTGTTTTTTGAAACAGTTTCTGTCACCCTG
GGTAGAGTGCTATGGCATTATCATAACTCACAGCAACCTCACACTCTTAGGCTCATCTTA
GGCTCACTCTTAGGCTCACTCTTAGCCCCTTAGCTGGGGCTACAGGTGCCTGCTACAACA
CCCAGCTATCTTTTCTATTTTTAGTAGAGATGAGGTTTCACTCTTGCTCAGGCTGATCTC
AAACTTCTGAGCTCAAGAAATCCACCTGCCTCAGCTCCCCAGAGTGCTGGGATTATAGGT
GTGAGCCACCACACCACACCTGGCTTTTTTATTTATCTTTATTTATTTATTTGCCCCTCT
GATATGTTGAGAATCAGTCCTGCCAATTCCCTATCCCCATTGCATGAAAGATTGAGACAA
AGGGCAACCTAATGAGGAGATGGGAGGAGTTGGAGAGATCAACTTGCGAAGTGATGATAC
ATTGAAGTCTAGCATGTATCTCCTATAAGGGAATAAGGAAAGAGAATGACTTGTGGACTT
AAGAACTCCTCGACCAGTATGTGTCAGTCTTGCTATCTCTAGAAAGTAAAATATGCCCAT
GAATGAGTGATGAAGGGAATTATTTCAAGACAGAGATTGAGATTATGAATTAATGCCCAA
GCAATAACGAGGATCCTTTTCAATTTTAATTATTATTTGTTTACTCTGCACACAGCACTG
TGCACTGTGGAATCCATATAGATGAGTCAGACATGGAAGAGTCTCATAACCGGAGGAGAG
AAATTATTCATACAAATTACTTATCATCTGGGTGGGATCAAGGAAGACTGTGTAGACCTG
GTGGCATTTGAGTTAGCTTTGGAAGTAAGAGGCAGGAATTGGACCTGTGGAGATGGGAGG
GCAGATATTTCCAGTTGAGCTGGGACAGGGAACAATGTCAAGCTTGGCATGTCTGACAGT
CAGTGAGGGCGCCAGGTTCCTGGAATCCAGGATGTGTGATGGGAAAGAAGACTGCAATGG
TAAGAAAGGAGCTGGGAATGATGCTATGAAGACAGACCTTAATTCCTTAGGCACACAGTC
ACCAAGGTTTTGAAAGGAGAGGGTACGATGGGTCTGGGGGAGAGAACAGAGGGGTGACAA
CACTTGTCAGGCACACAGCATTCCCACGGACCTAAAGGTCTTAATTGCAAAGAACAATAA
CGAGGATGGATGGGTGGCACGAGAGACACCAAAGAGAGGAACTCACAAAACAAAGGAGCA
CAGGCAGCAGGTGACCTTTGCTCAAATGTCATCTCCTTAAGCACCTCCCTCAATTGCCTA
TTTAAAAATGAAACCCTCAACCCCAGTACCATCAGATGTGCTATACTATTGATTTACTCT
TTAAAAAATTGTTAATCCCTGTCTTCCCCATAAAATGCAAACTCTTCCATGAACTGCTTG
TTCACTGCTGAATCTCCAGCATAAGGAACAGGGTCACGTGTAGGTTCTGTATAAAGAGTC
CTAAAATAAAATAAATAAATGTGTCAGTGATGAATGGGTGAATGAACCAATGAGAAAGGA
CATCAGTCCTCCTTCTGTTTGTCAAGGTGTGTCTCTCCCCTGATGGACAATGGCCCTACT
CACGGCGTTTCTTGTCCCTTGTCATAGGTCCCCCCCTCGGAGGAACACAAACGATAAGTA
AGAGCACAGAACAACGGCCCCAGCCAGGTATCTGTCCAGGATGTGCAGTCTCTCCCTTGC
TTCTCATGCAGCTATTGATTCCATGTGGCCACTGTTGGGATATTTAAATAATAATATCGC
ATATGTCGTTTCTTTTTTCCTCTCAAGGAGAGTCTATATCTGATGACCTGTAATAGACCT
GTGAGTGAAGTAACAGGTACTGAAATCAGATAGAGACTTTAAATATCAGAGGTAAAAAGA
AGCTTTAGGATTAAATTTCTGATGCTTTATTTTGTAAAATGAAGAAATGGAGGCCCAGAG
AGGTCAAGCGATTTGCTAAAAGCCACACAGATAGTTCAGAAGAGAATTAGAACTAGGACC
CCAGAGTCCCAAATTCCTGTCCATGCCTCCTATGCTTCACCAAACCTTATTTAAAAAATA
TGCTCGTTTGATGGCTAAATAATTTTTCTATGGCTAAATAATCATATAAGTTTTAAGTAA
ATCGAGATTTTAAGAACAGTCATTTTATAGCTGAAATACAAATTCTGACTAGTGTTGAAA
TGTCTAAGCTTAAGATCACAGAAGGGAACTGGGGAATTTGGTAGCCCAACCCATTCATTC
TACAGATGAGGAAAGGCTGTACCCAGAATTTGTCCCACAGTTTGTTTGTTTATAACTTAG
CTGGGGCGGGAACCCAGGCTGCTTGGTTTTCAGGTCTGTTTCTTTCATGTCACATCAGGA
AAAAAAGGGATTTGAATGTTTCCAGTACTGGGTGGAGCTAAGACCAGAAGCCTCCCTTAA
GCCCACTGCACACTCCACTTATTTCTTGTATGATTGACTATTAGACAGTTCTTTCCCAAA
TGTTTCCTTATTCTCTTTTGCGTGTGGACAACATAATCTACAAATTTTAGGCACCAAATA
TGAAAAAGTGATGCTGTGAGTATTCTTGTTGTCTCCGTAATTACTGAGTTGAAAACACAC
CAGCCATTAGGGTTTTTGACTTGTGCAAATAAAGTAGTAAAGTGTTACGAAATGAGTCCT
TTCGAGAAAGCCTAAACCGTTGGAGTTTTCATATTATTGATGCTATTGTTGTATTTTTAG
CAACACTGAAGCAAATTTCCTTTTTGGTTTCCGTAGATCCATATCAGATCCTGGGCCCAA
CCAGCAGCCGCCTAGCCAACCCTGGTGAGTTTACCTTGGCCCCCTTAGCTTTGTGAGGTC
ACAGAGACCTCTGTCCTAGGTCTAGACCTCTGAACTTGGGAGTAACATGTACTCCCTTCC
TTGAAAGGTTCAAGGTCTGCTTCTGTAGCACGTAATTGAAAGGTCAGGGCTTCTTACTAG
GTGGTAGTGCCCCTTGTTGAGGGTGCTTCTAGCAAGCAAACATGAGCCCTGCACATCTGC
ACTGAGGTTTAGGTTAGTCATGAAAGGCACAGGTAGATGTTTCAGTAGGGAAAGACAGGG
ACCAAAAGAAAAGGAAACCATTCCAATGAATTCTCAGTCATCTCCCCCATGTGCGGCACA
AGTGAGTAAATATTCCAAACATGTCTTATTCTTGATTTTCGAAAGAATTGCAGTTTACTG
GCCTTCTAAAAGAGGTTAATTCAGCGGGGTGCAGTGGCCTGCACTATGGGAGGCACTATG
GGAGGCCTCAGCACTATGGGAGGCTGAGGAGCGAGGATCGCCTGAGCTCAGGAGTTCAAG
CCAGCCTGAGCAAGAGCGAGACCTCACTTCTATTAAAATAGAAAAATTAGACCAGGCCTT
GTAGCTCACGCCTATAAGTCTAGCACTCTGGGTGACTGAGGAGTCTGGATTGCCTGAGCT
CAGGAGTTTGGACCAGCCTGAGCAAGAGAGCAAGACCTCATCTCTACTAAAAATAGAAAA
GCAGACAGGTGCTGTGGCAGGCACCTGAAGTTCCAGCCTCTGGGGAGGCCGAGGCAGGAG
GATCACTTAAGTGCAAGAGTTTGAGGTTGCTGTGAGCTACATTGATCCCATGGCACTGTA
CCCAGGGTGACAGAGTGAAACTCTGTCTCAGAAAAAAAAGAGAGAGAGATTAATTCCACA
TAAAGTAATTTGACTATGTATTTTAAGGATTTATTATTAAAAATAACTCTCAAGTGAGTT
TTTCTAAGCCGCTGAGGTGGTGAGCTAATCAGCTGTTTGCAATTGTGAGGCCCGGTGCAG
ATTGCTGCTGGTGTCCCCTTACCCTCAGTGCCCAACCATCCCTGCCTGGAGGAAAAAGAA
GGCACCAGAATCTTCTTCTGTTGTTTTTCTCTGTGCCCAAGTTCTCTGCAGACCTTAGAG
CTAGAGCCAAGCCTAGGGCTCTGCCAAGGAGCAGTCAACCTCAAGCTCAGGACACACCTT
CTCCCAGACTCTCCAGGCGCTGATAGAGGCTTTATCACTAAGTAGAAATCAGACAGTAAT
GTGGCCTTTATAGAAGAGAGTCAGAAATCTTGCCCCTGATGGCCCACATTCCATTCCCCA
GGATTTGGGGCAGATTGTCTTAAGCGCTAACCTCGCTTATTATGCCTGCCCCCCTCAGTG
GCAAGCAGAAAAGCTAACCGGCAGGGATAAGAAGGGGGTGTTGAGCTGACCCTACATAAA
AGGAATCCCAGGGTTTCCTGTGGAGCGTGAGAAGCCACCCACTCAGGGTCCTGGGTGGTG
CCTTCTCCAGGCTGAGGCACTTCTCTGGTTTGCCTCCCTGCCCGTAGGAAGCGGGCAGAT
CCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGCATCAC
CTGGGAGGGGACCAACGGGGAGTTCAAAATGACGGACCCCGATGAGGTGGCCAGGCGCTG
GGGGGAGCGGAAAAGCAAGCCCAACATGAATTACGACAAGCTGAGCCGTGCCCTGCGATA
CTACTACGACAAAAACATTATGACCAAAGTTCACGGCAAGAGGTATGCCTACAAATTTGA
CTTCCACGGCATTGCCCAGGCGCTGCAGCCGCACCCAGCAGACCCGTCCATGTACAAGTA
CCCGTCCGACATCCCCTACGTGCCTTCCTACCACGCTCACCAACAGAAGGTGAACTTTGT
CCCTCCCCACCCGTCCTCCATGCCCGTCACCTCTTCCAGCTTCTTTGGTGCGGCCTCACA
ATACTGGACCTCCCCCACTGGTGGAATCTACCCCAACCCCAACGTCCCCCGCCACCCCAA
CACCCACGTGCCTTCACACTTGGGTAGCTACTACTAGAAGCTTAACCTTGGTGGCCTTCC
AGCTGGAGCCCCAGCCCTCACTCTTCCTGGATACTCTGGACTCCAGAGGACACGTGTGGC
CTTGAAGAGAACACAAAACTGGATGTCGTTTCTTCTTGAATAGAGCCTTTGTTATTTGTT
CCTTAAAAACAATTTTTTTAAAATGTTGGTAACTTTTTTTGCTTCCTCTACCTGAACCAG
CAGATGGTTAGTTCCACAGGCCAGTATGCCAGTTTGTATTCTGAGTCGCCTGTCACCTTG
TGAGTATTTAGAGTACTGGAATGGTTATCTCATAGTTCTCAGAAAGAAGCTGTACCTTTT
CTCGATGTTTCTATGACCAAAGCAGTTTCTTATGAACACACGGGTCTCACCATTGTAGGG
CTCAGAGTCATAACGCACCATGGACTTAACCAGTGATGTCCTGGTTTGAGACTTAGTGAA
AATAGAGGTAGGGAGCTTATACTCTTATAAGCTGATTCAGTGGATGGCCACTGGAACATT
GGATTATAAAACTAGTGAAGTTTTCACCCAACTGGAATTTAAAAGAATGCTTGTGAGTAT
TTCAGAGCCTCAGGCCCTGCAGAGTCACGTCTATGGTCCACCAGCATTCGTGTGATCATT
CTGTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTAAAAATAAAAGAAATAAATAAACGAGTTGACCTCGTCA
CAAATGCAATTTTACTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1212, 10539..10693, 15468..15671, 23453..23518, 47902..47967, 49947..50006, 51096..51147, 52671..53196
1001..1212, 10539..10693, 15468..15671, 23453..23518, 47902..47967, 49947..50006, 51096..51147, 52671..53193
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved