Otolemur_garnettii Locus ENSOGAG00000008181
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000008181
Otolemur_garnettii
ENSOGAG00000008181
scaffold_101218
SNORA27
2039..2164
4157
ATCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGGATGTTTTGGGAACACAGGAAAG
ATAGAATTCTGAATGCCTATAGGAGAACTTTAAGATGATAATTAGTTACTAGTTAACTAC
TGAACACTGTTACCACATGCCAAGAATTGCCCACTACTTTGCAGACATTACCTCAGTCAC
AAAAGTGTTGACCCCATTTTACAGATGAAGATGGGAGCTTAAAAAAGGATCTCCCAGCAA
GTGGCAAAGCCTGTGTCAAATTTACAATGCTAATTACAAAGCCTGGTTTCCCCTCCTGTC
CTATATTCATTTCCCAGTAAATAGGTGGGAAATGAGTGAGATTTTTGACAGTTGAAGTAA
ATGATAAACTGTCATAGAAAATTTGATTGATAAAGGTGTTTAATATGCCACATAAAAATG
GAAGACTGGGTTTTACTCTGTTTGCCAATAAATTATCTAGTTAGTAATCCCAATATCATT
AGCATTCTAGACTGAGGTTTACAGATGCAGTGTAGTAGTTTTGTTGTGTTTTAACATTCT
GATAGGGAAAGTGCACTGGTTTGTATTCTCATCCATTTCTAGGACTTAGAAGAAGTTTTA
ATGCTAAAGAATTTAGAAAGTTTTGACAGTGACCTTATTTGCTGAAACAGTTTTTTTTAC
CTTTTGAAAGAACTAATTGGTGACTAGCCTTTGAAATTGTTCCTTAATTCTCACATTGCT
ACTGAAGTGCAAACATTTTAAAATTGCTGGCTTTCTGTTTAAATGGCAATTTTTAGTTAT
ATTTGACGGTTAACATTTTCTGGTTTCAGTAATTCACCAAAATGACGAACACAAAGGGAA
AAAGGAGAGGCACCCGATACATGTTCTCTAGGCCTTTTAGAAAACATGGTAAGTAGGTTA
CCCTCCTTGAGAGGTACACATTTGTGTTTTATAATACATGTGTGATGTCTACCACTTTGC
TAACTTGGGGTATCTAACATGCAGGCCACATGCTGATTTTGTGAGGACTTATTTTTTGCT
TATCTGTGGTGTCAGATACCACGAGAAGTATACATGGATTTTTTCCCCCTCTTTGTTTCT
GCTAATCAGCTTTCATTAGCGTTTTAGTGTGGCCCAGGACAGCTCTAATTCTAACACTGC
AGGGAGGAGAGAGGTTGGACACCATGCAAAAGCATAAATTTAATAGTTTCATAATTAAAT
ATCAGTGCAGGATTAAATGTTGGATAGATATTGTGAGTTAGAGTGATTTTTTTTTTCTTT
CAGGAGAAACTCCATTAATAAGATTTTAAAATTTATGTAATTGTCAATGGTGATGGATGT
GTTGAAAGCTAGTAAAATGGCATTTCTTCTGCTTTACACTTTTTGATACTGACTAAAAGC
AAATTGTATTTTGCAGGAGTTGTTCCTTTGGCCACATATATGCGAATCTACAAGAAAGGT
GATATTGTAGACATCAAGGTAAATTATAACATTGGGAAAATAAAACTACAGAAGTTTCAT
AAGCTGGATTCAATCCAGTATGGAAGTTCAGTTTATGTATCTTGGCACTCTAGAAGATTA
TCTTGGCACTTAAACGAAGATTATCTTTTTGATGGCTAAAACAATGTGAAAAACATTTCA
TCAGCTCTGAAAGTTCTTGAGTTGCCATTTAAAAGAAATCTTAGAGTAGCTTCATTGCTA
ATATAATATTTGTCTCCTTAACAGGGAATGGGTACTGTTCAAAAAGGCATGCCACACAAA
TGTTACCATGGCAAAACTGGAAGAGTCTACAATGTTACCCAGCATGCTGTTGGCATTGTT
GTAAACAAACAAGTTAAGTAAGTAATGTTGTAGTTCTTTGTAGCTAAATAGTATTCCCAT
GCCCCCTTTTCACTTTGCCAGTTGGACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAA
GGAAATATCCTTTTAAAACTCAGGCAAACTGGTGTTTGTCTTGTATCCTGTCAAAGGAAA
CAAATGGAAATAGACCTATTGCAAAGTCTTTGCAATATGGTATTAGGCAGTGTAAAAACA
AGTTTAGTAAGCTTTGATTTTAATATTATTAGCGATCTGATTTTGGTAAAATTACTCTTG
TTTCAAAGGATGTCACCTCAACCGAACAGAGGGATATTCTGAAAGCCTCATCCAATAAGA
TTAATGATTGTGAATTAAGTAATAAAGCCACCACCTTGTTAATTTATCTGGGTAAAAACA
GCTTCACATTTCTGTTAAATTTTTGGTGAAGCCCTTATAAGAATTTCTGCTTTCTTCAGG
GGCAAGATTCTTGCCAAGAGGATTAATGTTCGTATTGAGCATATTAAGCACTCTAAGAGC
CGAGATAGCTTCCTGAAACGTGTGAAGGAAAATGATCAGAAAAAGAAGGAAGCCAAAGAG
AAAGGTACCTGGGTTCAACTGAAGCGCCAGGTAAGAGCTTGACAGCTTCTTTTTTTTTTT
TTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGTAGAGTGCCATGGCATTACAGCTCACA
GCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCAAGTAGCTGGGA
CCACAGGCACCCGCCACAACGCCTGGCTATTTTTTGGTTGCAGCCGTCATTGTTGTTTTG
GCGGGTCCCGGCTGGGGATTCGAAATCGCCACCTTAGGTGTACGTGGCTGGTGCCTTAGC
CGGTTGAGCTATAGGCGCCGAGCCTTGACAGCTTCTTTATACCGATCTTGGGGAACTTTA
AAAGTTGTTGGTCCCTGATAATTTCCCTTGTGAAGTTTTAAAATTGAATATAATTTCATT
GGTTTAAGCACTTTAAAGTTGGATTTTAATACTCTACATAATTAATTTATTCTTTTTTTC
TTTAATAGCCTGCTCCACCCAGAGAAGCCCACTTTGTGAGAACCAATGGAAAGGAGCCTG
AGCTCCTGGAACCCATTCCCTATGAATTCATGGCATAAAGCGTATAACATAGCACACAGG
AGTACCGTGGACCCATGCTTTTAGGTACAAGAACCTATTTACTCTCCATGAGCTCGTGAC
ATGATAAGTGTACAGCATAGCACACAGGATGACCAATTAGACCCCATGTAACAGTGATAC
AAGGTGCTGGAACCTATTTCCCATGAATTCAAAAGTCAGTGTTCTGTCACATTCAATGGC
AAGATGCCTCTCTGAGCTACTGGAGCCTCTTCCCTATGACTTCATCGGATGGTAGTTAAA
AACAAACAACAATAGCCCAAAGATGTGTGTTGTTTGTTGACTACAAATGTGATTTTTTTT
TTTTGCCACAAAGAAATATTAAACCAAATTTTAATGTATCCTAATTCATTGTGTAATGTC
TTTATTCAGATTTACTCTGTATGCTGCTCTAAGGTATAAGGCAGCTTATTGTACAGTGGA
TATATGCAATTGGTTAGGAAATGGCCAGGTAATATATATGAAAAACTTAAACTGGTTTGA
AGATGGTCTCTAAAATCATGGGAAAGAAGTGGAAAATCTCACAGTTAATAAGCCTAATGT
CATAATTATATCATAATTTCAGTAGCTAGATTTTAAGGGTCAAGAGAACACCCGATTCTC
TTGAGTTACGTACTAGCTTAGAATTGCTTTGGTCATTCATGAAACTGCTGAGAGAACAAT
ACTGTGATGGCATTTGTGTAGGGTCATCTGTCCTGCTATAACAAATTACCACAGACCTAG
GAAAACAATTTTTTGTGGTTCTGCAGGCTGGGATGTCTTGAGGATCAAGGCACTGGCAGG
TTTAGCATCTGAGGGTCTGTTTTTGTGCTCCCAAGATGGTGGTAACTATGTCTTCCAGGG
GGAGGGTCTGTCCTCATCCAATGCTGAGTTAACTGCTTTTATCCCTTTTCTCTCAGGTGG
AAGGGGCCTGTCTTCCCTCCAGCTGTTTCATAAAGCATTAATCCACTCAAAGATGTTTAT
CCCTCACTTCCTCAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1576..1637, 1884..1996, 2459..2609, 3068..3157
1001..1067, 1576..1637, 1884..1996, 2459..2609, 3068..3154
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved