Otolemur_garnettii Locus ENSOGAG00000001309
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii ENSOGAG00000001309
Otolemur_garnettii
ENSOGAG00000001309
scaffold_200
SNORA33
1936..2065
3254
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCATGATGTTAGCCCAAAAGTTGAGAGTGACATCCGTAT
CCGTCCTACAGGAAACCTAGGAAAAGGTATCAGAACTTGGATCTATATAGCCCACTTAAA
ACGTGTGCGTTGCTGTTTAGAGTGGGGATAAAAACTTGTTTTTAGTCAAAGGAAAACTAC
AGTGTTTGAATGATGACTTCAGTTGTCGGATACCCCTTCACTCCTTCTATGAGTGAAACA
TAACAGTCTGACAAACCTGTAGGTTATGGGGTTAGCAGTTTTCTGGAGGCTAATTGCATA
CCCTTGTTACATTAAACAGTTTGCGAAATATTTGGCTAAATTAAGGTCGAGTTGTGCTAA
GGTTTATTGCAGAAGCACTTGGATGTAGATGAATTTAGTAGCTGTGGGAATTTGAGTCGG
GAATTGTCATTATATTGGCAGAACAGCTTGATATAGAGAGCTGGGTTCAAGTGCCCTTTA
AGGGTCTCCACTGCTTGCTTTGGTGTAATCTAGCCAGGTGAATCCATCCACTATGTGATA
CAGTGCATGCTGCAGTGCAGTGGGCCCTGGTGTGAATCTTGTGTAGTATTGGCAGGTCGG
TGTTGCTGCACGGTATTTATTCAGTGGTTGGGCCAGTAACATTACAATTATTTGGTAGTT
GACATCGTACATCTCTTTGAATTTATGAGACTAGTTTACCAGAAAGTTACCGTTTTGACC
ACAAGTTTTTCAGTTACTTCCCCTACACAAATCTGTAATTTTGGATCAAGAAATTCTAAA
TGAAATTTGCTTAGTATTTCTTTTAAGTGAATAAGATGGCTGGTAAGAGTCATCAGATTT
GAGCACTTGTGTGCACATATATGGGGTATTTTTCAGTAAAGTGCAAGAGTGGTGGGTTTA
GGTCTGGATTTTAACTTGCTTGTTGTGTTTTGAATTTCAGGCGCCAAGCCCATCTTTGTG
TGCTTGCATCCAACTGTGATGAGCCTATGTATGTCAAGTTGGTGGAGGCCCTTTGTGCTG
AACACCAAATCAACCTAATTAAGGTAAGCTTCTCACCTAATTTGATATGTCTGGTCTGTT
AGTACATCCTTTAGGTTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCATGTCACCCTTCTGATGACAGCCAGCTTTTGGGTTTGATTTACTGTCAGTAGC
ATTAGTGCCTACTAATGTGATTTTTTTTTTTTTGTTTTTTATTCCCCTGATAGGTTGATG
ACAACAAGAAACTAGGGGAATGGGTAGGCCTTTGTAAAATTGACAGAGAGGGGAAACCCC
GGAAAGTGGTTGGCTGCAGTTGTGTAGTAGTCAAGGTAAGTTCCTTGGTTTTTAGGATGA
AGGTTATGCTGGGTAACTGCACAAACCTGTATTGAGATAAGTTTGAGAACTTTTTAAAGG
AAAAAACAAGATTCTAAAAAGATTTAAAAATATTTTCTGTATTTCAAAAAAAAAAAATTT
GATGATAGTGGTACAGAAGCCAGCCAAATAATCTGCTTACCTGAATGTGTTTCTGCAGAA
AGTTTTTAAAATCTGGCAATAGTAAAGCCATGTTACGAGCCTTACGGACATCCAAGTCGT
TAAGGTCCCTGAAAATGGCTATAACAAATTTTAGTGATTTGATGCATTTTCAAAAGGCAT
AGTTCATTATTAAAGCTTCTTGTGAGTAATGCTATGAACTTAGTGGAATTTCTAAGTGTT
AATAAGCAATTGCATGTAATTTTTTTTTAAAGGATTATGGCAAAGAATCTCAGGCCAAGG
ATGTCATCGAAGAGTACTTCAAATGCAAGAAATGAATAAATAAAACTTTGGTTCATGTTC
CTCCTCTCTGACTTTTTATTTGGGGTAGTAATGTAAGGTCCCAGTTAGTGAAGGGAAAGG
TCATTGAGGAAACTGATCACTATAAATGAGATAGAGACATTCTGTAAAACAGCTCCCTAT
TTTTGACCTTTTTTGATTATAAATCAAAGTGTCTACTAACGAATTAATGACAGTGTTGGG
ACAATTAAAACATGGACAGCCTAAGCAAAGATGGGCCTCTAGGGATGTACTGGTATGTAC
ATGAGTATGGTCATTTGTCACCGAGTAGGCCAACCTAGAACCTGGAGAAAGGCTGAAGTT
AGCAAAGTGGATGTTAGTAGATTGCAATCGTGTGGCGGGACAGTGAGCAGCGAAGTTGGA
GAGTGTAAAGGTGGGAGGATAAGATTTAGGCTGGTATACTTAAAAGTGCATGATACCCAG
GAATGCTTATGAATCTGCCTATAGAGAAGGTCATAGCAGCCATTGCTGTCTCAGACATGA
GTTCTATGCACAGAAGAGATGTTTTAGTTCATCCTAGGCCTTAGGAACCTCAGCAGGGAG
AAATGTATACTCAAGTATGTCCGGCTTCTGTACGGTCAATGTTTTGGAGGCTGTGTACTT
GGATCTTGTGTTCCTGTTTTTTTCCACATCTTTGGTATTTAAAGTTGGAGGCTTTCATAC
ATAATCTGCCACAAAGTAGGGTCTTCTGTACAGGGTAGCTTTGTGCTTTAAGCACTGCAG
TCGTCTTCACCTAAAAGCTGATTGTCCTCAGTAAACCAAGGATTCACTATAGTGGATTGA
GTGACCAGTGATAGAAAAGATGAAGCTCTAGAGCTAATACAGAGTGAGTATACCCTTTAG
AAGCTGTGACTTGTTACTAACATTTAATATGTTGGGTTATATTTGGTTTTTCTAAGGAAA
TTTAATTCTCTTGTGGTTTGACCATCTACTCAAACCATTTTGCCTAGTCATCTGGTACAG
TACAAAGGAAAACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 1673..1774, 2192..2254
1001..1102, 1673..1774, 2192..2251
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved