Otolemur_garnettii Locus Mono:422:SNORD55
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:422:SNORD55
Otolemur_garnettii
Mono:422:SNORD55
GeneScaffold_2671
SNORD55
1001..1079
2079
GGGCTGGGGCCCTACTCACTGAGCCACAGGCACCACTTTTTCTATTTTTATTAGAGACA
GAGGTCTAGGCTTGGTGCCTAGAGCACAGTGGTTACCGCATCAGCCATATACACTGAGAA
TGGTGGGAGCGTGGCCCAGTCTAGCTAAACAATGACAACTGCAACAAAAAATAGCCGGGC
ACTGTGACCAGCACCTATAATCCCAGCTACTTGGGAGGCTGAGGCGAGAGATCGCTTAAG
CCCAAGAGTTTGAGGTTGCTGTGAGCTGTGATGCTACAACACTCTACCAAGGGCCACATA
GTGAGATTCTGTCTGAACAACAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGAATCTATCCCATGTTTTCTTTAGGATTATGGATTTTAATGTAAATCC
TAAAATTAATTTCAGGTGAGTGCAGTGGCTCATGAAGGTAATCCTAGCACTCTGGGAGGC
TGAGAAGGGTGGACTGCCTGAGCTGACAGGCTAGAGACCAACCAGAGCCAGGCGGGTAGC
ACCCGTAGCTCAGTAGGTAGGGCACCAGCCACATACACCCAGGCTGACAAGTTGGAATCA
AGCCCAAGCCAGCTAAAATCAACAACTACAACTGCAACAAGAAAATAGCTGGGCGTTGTA
GCGGACGCCTGGTCTCAAAAAAAAGAGTTCGGCCACAAGCGCATGACGACACACACCCAG
GAATGCTGCAGACTGCCAATTGCGCAGTGAGGAAGCCAACCTTGGAGAGCTGAGCATGTG
GTCCACGTGGCGCGAGGATCTGGAGCTGGTGAGTCGCCATCATCGAGTCCCCATGTTTGA
GGTTGCTGTGAGCTGTGATGCCACAGCACTTTACCGACGGCAACACAGTGAGACTCTAGC
TCAAAAAAATAATGACAAAATAAGGAAAGACATAAAAAATAAGCAACGAAATAAAATTAA
AAAACCAAAAAAAGAAAAGTTTGTGGGCTCAGCGCCTATGGCTCAAGTGGCTAAGGCGCC
AGCCACATACACCTAAGGTGGCCGGTTCGAATCCAGCCCAGCCCGCCAAACAACGATGGC
TGCAACCAAAAAAAAATAGCCAGGCGTTGTGGTGGGCACCTGCGATCTCAGCTACTTGGG
AGGCGGAGGCAGGAGACTTGCTTGATCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATGC
CACAGCACTCTACCCAGGGGGACACGTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAA
GTTTGCGGAGTGGCGCCTGTGGCTCAAACGATAGGGCGCCGGTCCCATATGCTGGAGGTG
GCGGGTTCAAACCCAGCCCCGCCCAAAAAGTTTGTATTTACCTACATAAGAAAAGTTTGT
AGACCTCTCTTTTACGCTTTCTCTCTAGATTCCATTCCTTCTGGTGGCTTTTACTAGGAT
TTATATATTAAGGATTCCCAACATATTCCTTACACAAGAACGACCAGGCATGAATATCTA
GCTATCATTCCCATTTATATAAATTGCTCTCTCCTATCTTAGTTCACGTAACAAACGTGT
TGGGAACATGTCTAGAACAGCTCCTACCTTAGCCCACCCTATCTCAACAAATAGCCCCCA
AACTGATCTAATCGACCAACTGAGAACTTAGAATCCTCGACACCTCCCTCTTTCAACCCC
CAAGTCCAGTTTACCACCAACTTTTTTTTTTTTTTTTTTGAGACAGAGCCTCACGCTGTC
CCCCTGGGTAGAGTGCCGACAGCAACCTCCAACTCCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved