Otolemur_garnettii Locus Mono:433:SNORA24
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:433:SNORA24
Otolemur_garnettii
Mono:433:SNORA24
GeneScaffold_4421
SNORA24
1001..1131
2131
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACTCCTGGGCTCAAGAAATCT
TCTTGTCTCAGCCTCCTAAGTAGTTGGGACTACAGGTGTCCACCACAAAGTCTGGCTAAT
TTTTCTATTTTTAGTAAAGACAGGGTCTCACTCTCACTCAGGCTGATCTTGAGCTCCTGA
GCTCAAGTGATCTACCCACCTCAGCCTCCTAGGATGCTAGAATGACAGGCATGAGCTACC
TTGCCCCACCAAGAATTTAGTTCTTATTGTGAATTTTGTCACTTATCATTTAAAACTATT
ACACATGAAACTGAGTAAACAATTCATCTCCTTTTTAAATTTACAACGAGGCTTGGCATG
GAAAAATAAGCTGGCTATTGGCAATAGAAACTGTATTCCTAGAAAAGGAGTGTGGGCCTA
CTTAAAGTTTGTTTCACCAATATGACCCAGCATGTCATTTAGGGCAAAGATGGTTTCCTG
TTCTTCTTTCAATTCTCCAGTGCTTCTTTCCTTCTTAATTTATATGGCAGATATATAGAG
AGTCCATGAACTATCAGTTGAATTGAAATATCTGGTTCTGTTACTTAAACAAAACACTGT
AATAGTTCAAAGTTTTGTGCCATGGATGATGGCTCATGCCTATAATTCCAGCACTTTGGA
AGGCCGAAGCAGCAGGATCACTGGAGGCCAGGAATGTGAGATCAACTTGGGCACCAAAAC
AAGCCAGGTGTCTTGACACAAGTCTGTAGTCCCAGCTACACAAGGAGGCTGAAGCAGGAG
GACAACTTGAGCCTGAGAGTTGAAGTTTACAGTGAGCCATTATCATGTCACTGTAGTTCA
GCCTGGACAATAGAATGAGACTCTGTCTAAAAAAAAAAAGTCTCCATGTGTCTTTGGGAC
CTGTTGACTATGGCAGTCTCCCTTCCTAGCCATGGAAGAGCATATTCTTATTTATCCGCA
AAGCTGTCACCATTTAATTAGTATCAGATTCTGACTTGCACAAGTAACATTCTTCACTAT
TAAAAATCTGAAGAGTGGGGCAGTGCCTGTGGCTCAAGGAGTAGGGTGCCAGCCCCATAT
GCTGGAGGTGGTGGGTTCAAACCCAGCCCCAGCCAAAAACTGCAAAAAAAAAAACAAAAA
AACAAAAAAAACTGAAGAGTGTACCCTGAACCCCGTAAATGCATCAATGTACAAAGTTAT
GATTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCACCCTGGGCAGAGTGCCGTGGCA
TTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCC
AAGTAGCTGGGACCACAGGCATCCGCCACAACGCCCGGCTATTTTTTTTGATTGCAGCCG
TCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCGCCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved