Otolemur_garnettii Locus Mono:50:SNORD32
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:50:SNORD32
Otolemur_garnettii
Mono:50:SNORD32
scaffold_97206
SNORD32
1001..1079
2079
TACAATTCCATCCAGGTTGCTACAAAAGGTAGTAGGTCACCATCTTTTTATGGTTGAGT
AGTATTCTGTGGCATAGAAATAACACATTTTATTTATACAAATACCCATTAATGATTTTA
TTGGACACTTGGGTTTGTCTCCATATTCGAGGGACTATGAATTGTGCCCCTGTGAACATT
TGTGAGTCTTTTTTATAAAATCTTGTTTTTCTCCTTTGGGTAAATCCTTAGAGATGCTCT
TTTAACGTTCATTTGATAGACCCTTTTTATTTTAAAGACTCATAGTTCCCTAACACCTCT
GGAAGAGATTTCTGTGTTATTTCTTTTGATCACTTCCTTTCTTTTATTTTTTTTTTACAC
CTCCCGGTTAGGAGTGCTATAAGCAGATATGAAAATTCTGCGTCACCTCTCCATTTTGTA
TGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACCAGGCTGAGCATTCTGTATTATTAACCATAAGGTTTCATTTTAGGATGATCAA
GGAAGGAAATGCTTTCAGGTTAAGATATAGGAATCTGACTACCAATGCTTGTAATAACCT
CTTTTTTAAACCTCAAGGGATCATTTATGGAATACTCCTTTAAGTTAGTAATAAGCAGTA
ATCACCATCTTTCCTTTGAGTCTCATGACCAGGAGATCAATCCAAAGGAAAAAAAAAGAA
AGAAATATCTCTTGTAATGAAGAAATAGTCATTTGAAGCTCATTAATTGAACTTTTAATT
AATATTTAAAATTAAATTTAACATTTCTTAATTATAATAGCAGTGATTACATGACATCTT
TTATGTCTATGTCTATTATTCTACTTACTCTTTTTCTACATACGAAATACAAAATAATAG
TTATCTAATATTCGTGGTGTTGGATGAGGTTCATAGTTTTTAGTCTGATCTTATAATCCC
TTCAATTGTTGGGTTATTTTATGTATGTACCTGCAGGTGTAAGTTTAACAAAATCAGTAT
AGTAATAACCAGATAGAGACGTAAGGATGGAATGGAGAAAGCAAAGAAGGAAGAAGGAAG
AGAAAGAAGGAAAAATTTAAACTATGATTCATCCCTATGTAATATTTATTTTTTAACTTT
GTTAATATCTATCTCTTTTTCATCTAGAATAAATTAAATTTATAGGACATGTAATTTCTT
GCTGTGTAAAGAATAGAGGCACATTCACTGTATTAGAGATTCAAGTCAGTTGGCTACATT
ATCTTAATGTGACATCCTTAGAACTAATTTTGGAAAAAGGGAAATTTAATCAGTGTATTT
ACCTTACAAGTTAAAAAGACCTACAGGTCTAATTCATGTAAAGAAGATGTTAGAATGGAT
TTGTGCTTTTATAAATCTTAAAGGAAATACGATTAAAGGTTTTTATCCTTTCTTGACTTT
TCCTATTAAATGTTTATATCTTAGCAAGTGATCAACATGATGGTTTAAAAGGCTAGTTGT
TGATAAATGATTGAAGCACAGTGAAGATATCAATATCCACTGTTTACCATCGGTGTTATT
TGAAATAGAGGTGACCATGCATACTATTGTGCTTGAAGAAGTCTTTGGAAAAAAAAAAAA
AAGCAGCAGCATCTGTTATTTGTAAATTTCCTTGTTCAAAAAAAGCAAATTATCATATAT
ATGTATATGTATATATATAAATTATGTGAATAAAAGTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved