Otolemur_garnettii Locus Poly:12:SNORND104
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:12:SNORND104
Otolemur_garnettii
Poly:12:SNORND104
GeneScaffold_641
SNORA76
1271..1404
2404
GGAAAAAAAACTCCCCAGGAAGACAACCAGAGAGTGTGACTGCTCACTGTCCACCGACC
GTCCCTCTCCCAGTAAAGCCTTAGAGGGGAGAGCCGCATTCTTATTCATACACGTGGATA
TCCAGTGAACAGCCCAGCCTTTGGGCTCACAGAGTGAACTCAATAAAATCTGCAAAGCAG
TTTTAGTTTTCTCAAAGTTAGGCCTTCTCTATTTTGAGTTTTGCAGTCACAAAAGTTTTC
CCCATCACCCCAGTCCTTTAAAAACATTTTTTTTTAATCAGTAAAAATGTGCCAGGTGAC
TGACTTTTAATTCACTTAATCCTTACAACTTTGGGGGGGGGGATATTCCTAATTTTCAGA
AATTGAGGCTCAGAAAGGTTAAATGACCAAGGTCATAGAGCGAATGCATCACAAACTCAG
GATATGGTTGCAATCTGTCTGCTTGAAAGACAAGCTCTTTCTACCACCACAGGTTATGCT
GAACTCGGGGGCAGTTTTGTTCAATTTTACTCCTCAACTCCTAACCTAACTCTTGGCACA
GAATTATCTCATACCAGTTAGGCATTACTTGTCTCCTGTTGTTTGTAAAGCTTTCTTTTG
CGTACCGCAGAGATGTGCACCAACTAGACACCTGCGAAGATGGCAATATAAACGCCGGAG
TACTCAAGACACCGCGTCACTCAAACGCTCGGCGTCTCCTAGACGCCCGCCTCTATGGTT
GGTATGAGAGCTGTCTACACGCTGGAGGACTCAGCAAGCGCGGCCAATCGTCAGGCCACT
TTAAACGCACGTGATAGAACTTTGACTTACTATTGGTTAATAGCGGCAAAGCCCGCCCAA
CCACCTCCAGTCTGCTCCCTTAAGTAGACGCGGTAGGCACGCCCCGTTCTTTTCGCGGTT
GCAAAGCTGAAGAGGTGAGGTGTGTCTACCGAGTTGGCTGTGCGGCCGGGAGGGCCCGGG
AGCGGGGAGGGGGACGCGCGGGCTGGCTAGCTGGCCGGCCGGCCGTGATGACTTTCTAAT
TAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTAGAGTCTGAGCCGGCTGCAG
CGGAGGCGGGGGTGGGACAGGCGGACGGGCGCACCGCGCTCACCTCTCGCGGTCCATCTT
ACAGGTCGTGGCCTGGCCTGGCCGAAGACGTCGGATCTCATCATCCCGCGTGCTTCTTTG
TTCCCTGCTGCCAATTCTTTTCAATAAACAATTTGAACTCAACGCTGGTGTGGGTATGAT
TCGTTGGCGACGCGCTGCCTTTGAGCCCCCGCCGCGCTTCCTCGTGGCGCCGGGGGTCAG
GCTGCAGCGCCAGAGCACAAGCTTGCGTATAACTGGGGCCGCCTGCCTTCTCCGCGGGCG
GCCCTTTTAACCGCGAGCGACACGGCGGCGGCTGTCGTGGCGTGTTGCGGATGGCCGTTT
CCCAGACGCTTGCGATGACTGTACAGTTTCGCCGCCAGTTCGAACTGGGCCGCAGAGCTC
CCGCCTCCCTCATCCCCCTCTAGTCCTTGGAAAGCTGTCTTGCCCTGAAACATAAGACTG
GGCCGCGGGGCGCACGAGCAAGGGAAGGTGCTTTATCTGTATTTACAGCAGCTCGACACA
CCATCTCTGAGCTCTGCCTCCCGCCACCCCACCCGGGGTCTAACACAAAAACCGGTCCCA
GGTGCCCAAAAGGTTGGTCGAGGCACTGCTTACACGAAGAATGAAATGTCCAGGTGGGGG
TGTTGGGGATGTTGTAGCCTCTGCAGTGAGTGACCAGCGTGTACACCCATACGTTCCTCT
GACTTCCTTGGGTTGCACGTCCCTCAGTGGTCAGTGAGATAACCGAGGTTCAGTCAGAGA
CGGCGCTGAAAGTTAACTCCCCGCTAAGGTGATGTCATCACCTATTTAGAATTACTGTCA
TGCAAGTGAACTGCTTATTTAGGTCCTGTGTAACAGGTCTGGGGCTTGAGCATATTAAAA
CACGTGGTTGTGAAGATGATTTTATACACAGGTGGATTTAACAATAAGGAACCTAAATAC
ACAAGTCACCCGTTCACAGTCCATGTTCTATTACTGATGTCAGATCTTAATGGGGACTTC
AGGTACTGAGCATCTAAGTAGTGGGTGGTAACGGTGGGCAAGGAACCACAAGTACTTTAC
ATTCAATAACTTGGCCCCAAATTGACTGGATTACAAGGGACTAAGGCTGTCAACTTTTAA
CTTGGTCCTTTAACTGTGGACCTAGGATGTGCAAGGTTAAGGTGAAGACTGCCTTGCATC
TTTATGAGGAGTAGGCCACTGATCGCTCAGTGAATAAAAGCTATTGCCAGGTGAGGGCCC
AAGTATTCGGTACTGTTTGCTCTGTCCCTGTTATCTGAAAAGAATTCCATAAAAATAAAT
TAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved