Otolemur_garnettii Locus Mono:404:SNORD113
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:404:SNORD113
Otolemur_garnettii
Mono:404:SNORD113
GeneScaffold_5247
SNORD113
1001..1072
2072
CTGGGCTCAAGCCAAGTCTCCTGCCTCAGCCTCTCGAGAAGCTGGGACCACAGGCGCCC
GCCACAACGCCCGGCTATTTTTTGGTTGCAACCGTCTTTGTTGTTTGGCGGGCCGGGGCT
GGTGGTTTGGTGGCCGGGGCCGCCACCTTGGGTGTACGTGACTGGTGCCTTAGCCACTTG
AGCCACAGGCGCCGAGCCCAGAGAGTTTTAAAATTAAAAATAGTGAACAAGGTGAAGGGA
CATGGAAGGTAGAGTAAAATGTCTAACATATTATCAATCCAGAATTCTGGAAGAGAAGAA
ACTTAAGTCAGAAACAACATTTTAAAAAGATAATCAAATTCCAGAATTGATGAAAGACCT
AGTCCATACATTCTAGACGCCCCATGGGATAAAATAAAAAGAAATCCACACTTAGGCACA
TCACAGATATATTGCACAGCTACAAAGACTAAAGGAAATCTTAACAACACCCAGAGAAAA
AGACACGTGAACTTCAAAGGAATGAAAGTTGGGCTTGCTTCTCTATACCAAAAACAGAAG
CCAGAAAACAGGAATATATATTGTCAATACACTCAGTGAAATCCTGTACCTCGCAAAAAA
CTCTCAAGCTTAAGTGTAAAATAAAGACGTTTCAGACACACACAGAACTGACTTTCTTTC
AATAGACGCTGTCTTGTGCTTGCTTCGGCAGCACATATACTAAAATGGGAACGATACAGA
GAAGATTAGCATGGCCCCTGCACAAGGATGACACACAAATTTGTGAAGCGTTCCATATTT
TTAGTTATTATCTTCTGGTGAAGATCCTGCCTTTTACCTCTATGAATAAGAAGAGAAGAG
ATCCACATTGGATTTGGTCATTCCCCTATGATGAAGAATATGGCTAATGCTTCACTGGGT
ATTGATCTGGGAATAGATATTACTGCACAGATATTACTGCCAGTGAGTCAATGAATGGAT
CAATAAACAAAAATATAAATGAAGAAAAAGTTTGCTTATCGTGGATCTATGATGAGTACC
CTGGGGTGTCTGAATCAAAGATTTTGATTAAACCCTCTAACGCTGAGGTCCACTGCAAAA
AGATTCCTGTTCATCATCATCATGAATGGATGCACAATAATCCAATCATTCTCTGGATTC
AGTGAGAAATATCTTGGTTATTACCTTTTTGAAAAATATATATAGAAACCTGTAAGTTAA
AAAAAAATTAAAAAAAAATAGACACTGTCTTGTGGGATTAAAAGAAAAGATAAATACGCA
ACACGAGAATATATTTAGAGACGACAGTACTAATGTGTTCTAAATGCCTGGTATTTTTCT
ATGGGGGGAAATAAAGGCATTAATTTCATTTGAACTTTTGAGTTCAAGTCAATAAGCTAA
TTTTTTTTTTTTTGTAGTTTTTGGCCAGGGCGGGGTTTGAACCCGCCACCTCCAGCATAT
GGGGCAGGCACCCTACTCCTTGAGCCACAGGCACCACCCAATAAGCTAAATTTCTAGAAT
TTTCCCTAAAAGAGAAAATAGGTTGATGTAACTTCCAAACTAGCAAAGGGAGAAAGAATG
GAAGGGGGGAAAAAACAATCTAAAAGAAAGCAAGAAAGGAAAAAATTCATGAAAAAGATA
GGACAAATAGAAAGCACAAAATAACATGTTAGAATAACGTTATTCTACCAGTAAATCAGT
AATTACAATAAATCTAAATGGATTAAATGATCCAGTTAATAGATTAAGATTGTCAGGCTA
AAAATAAAGATATATAATTGGTCCCTAACTTACAATTTTTTCAACTTTACAGTGGTGTAG
AAGTGATGCACATTCAGTAGAGACAGTAACTGTGAATTGTGATTATTTCCTGGGCTAGCA
AAATGCAGTTCCATACTCCTTTGAGATTCTAGGAAAAGGCAGTGAATGAGAGAGCCACAG
CCCAGTCAGCCAGGTGATGACAAGGGTGAGCAACCACTACTTGTAAGTTTACGATGTACA
ATATTTTCAACTTGAGATAGGTTTATCAGGATATAACTCCATCGTATGCCGGGTGCAGTG
GCTTATGCCTGTAATCCTAGCACCCTGGCAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved