Otolemur_garnettii Locus Mono:194:SNORD89
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:194:SNORD89
Otolemur_garnettii
Mono:194:SNORD89
scaffold_58987
SNORD89
1001..1116
2116
GCCACTGTGCTAGCCAGTTTTTAAGCAAAGTTAAAATCATAAGCTTGCTTAACCATTTG
TTGTCACTCGTTTGCTCGTCTTACTTGTAGGTCAAAGCAGCAGTCTAACGTTGGAGACCT
TGCTAGCTTTATACAGTGATTCAGCACACTACCTGCTCTTTGCTCTTTTGCTCCCTTCCT
GGAGGTAGATGTCAAGGAGTATGAGGCAGTTGCTTTTCAGAGTGTGGAATTACAGTCTTT
TCTTGTTTCTAAACTAGTTGCTCTGTGTACCTTTATTTTATAAGTAAAAATGTTTATCGG
TGGGTGTGGTGCCTCATGCCTATAACCCTAACACTCTGGGAGGCCGAGGCAGGTAGATTG
CTTGAGCTCAGGAGTTTGAGGCCAGCCTGAGCAAGAGCAAGAACCCATCTCTACTAAAAA
TAGAAAAACTAGCTGGGTGTTGTGGCAGGTGCCTGTAGTCCCAGCTACTCAGAGGGCTAA
GGCAAGGGGACATTTGAGCCCAAGAGATTGAGGCTGCTGTGAGCCACGGCACTCTCCAGG
GCAACAGAATGAGACTGTGTCTCAAAATATAAAAGTTTATTGAGAAAACTATTTTTAAAG
TTTAAACATTTTTAAAGTGTATTTAGATGGAAATAACAAGAAACTTTAAAGTTGATAAGA
TGCTGGGAATTTGGGAAATGTCAGTGAAGAGTATGGTATATTATTTATAGCAGTAATCAC
TTTCCTCCTGATAGTTGTCATAAAAGCTGCTTGTTCACTTTTAATGTAGAACAGTGTTTT
AACTTTGAAAACCACAGGTGCGCTGTGAGAGAGGCAGCGTGCCTGCAACTGATCCTCTGT
ACCCCTCCCTGCCTGCCATCCTGCTTCAGTCTCCAGTGTCTAGCCGCAGAAAACAACAAA
GGGCCAGAGAGATGTAAGAGCACCCACTGTTTCTCAGGTAATAATTTCCACATCTGTCTC
TTTAGGGATATAGCCTTTCCCAAAAGACTGCTCCCACAGCTACTGAGGAATGATGACAAT
AAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCTCTGTGTGGGCACACGATGAC
AAAACCTCCTGAAGCGACCCACTGGTCTGACCTCAGTAACATCAGGATGGAAGCTTCATG
CCATGGGAGTGGTCGTGAAAGGCATCCCAAAGACAGCTGAGCTTTTTTTTTTTTTTAAGA
AAAAAATAATCAGCCTTCAGACAACACTGGGGCTTGAATGGGTAGTGATACTAGTCTGTG
TTCCATAAGGTACATTTACTTGAACCAAGGACTACTAGAAGTTTAAAGATTATAATAATA
AAACCTTTAAGAATAGGTGTGCATCCCATACACTAGAAATGAGATATCCAGTGTAATTAA
ATTCCCCAGTAAAATACAGAGTGTGCCCAAAAATATTTATACACATGTTAAGAAAGGAAA
AAAATTATATTAAAAGTGTAATACTTGGGCAGCAGCTATGGCTCAGTGAGTAGGGCGCCG
ACCCCATATGCCAAGAGTGTGGTTCGAAGCCAGCTGAGGCCAAACTGCACAAAAAAGTCG
AGTGTTGTGTGGGTGCCTGTACAGAGTCCCAGCTACTGAGGAGCTGANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved