Otolemur_garnettii Locus Poly:18:SNORA1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:18:SNORA1
Otolemur_garnettii
Poly:18:SNORA1
GeneScaffold_3088
SNORA1
1001..1128
3164
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNACCCTAATAACCTTTAACGAGTCACCAAATTTTTTGGTATT
TTGCCATGTTTGCTTATCATCCTCTCTCTTACCATGTATGTGTGTGTATACGTATTCTTT
CTTCTGCACCATCTGAGAGTAGACTGCACTCATTATGTTTGTTTATCCTTTCCAAGATAC
TTCACTTCAGTGTATCTTTGTTACAAATTAGAATATAGTCTCTTAATCACAGTAGTTATC
AAATTCAGTATTATCTAATTTACAGAAAAAGGATATAGAATAAAACTAAAATTTATTTTC
ACATTGGAATTTTTTATTCCAACTTCATCAATAATCAGTCAAAATTTAATATTTTTCTTT
TCTTTTTTTTTTTTTTTTTTTTTTTTGAGACAGTGTCTCAAGCTGTTGCCCTGGGTAGAG
TGACATGATGTCATCATGGCTCACAGCAACCTCCAACTCTTAGGCTCAAGCGATCCTCTT
GCCTCAGTTTTTTCTATTTTTAGTAGAGACAGGTTCTCCCTTTTTGCTCAGGCTGGTCTC
AAACTTATGAACTCAAGCAATCCACCCACCTCAGCCTCCCAGAGTGCTAGGACTACAGGC
ATGAGCCACCATGCCTAGCCAAAATGTAGTATTTCTCTACATGAATCTATCACACAACTA
AAGGATACTAAGTTGTATCAAAATTAATTTTCCATTAAGAAAATGAAAACTATAGCCAAG
TGTGGTGGTACACTCCTGTAGTCCCAGCTACTTGGGAGGCTTAGGCAAGAAGGTTGCCTG
AGCCCAATAGTTAGAGGTTGCTGTGAGCTAGCCTGATGCCATAGCACTCCACCCACAGCA
ACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAAAAAGAAAAAAGAAAACTAGCT
TTAAGTTCAGGATTTTTTTAAATTAAAAAATAGAAAAAGAATACCTCATTCTAGATGAGA
CTGGGCACTGTAATATCCAAAAATTGTTAATGTGGCTCAATCGTGGCACAAGTTATGCTT
CCATCACAGTGTATTTGTTGCAATAGTGACAATGAGACCTGTGACATTTTGCATGGCTGA
TGAGTGGAAATCATGTATAAGAAAAATGTTGACTTTTCAATATTAGAGATGATTAAAGAA
TAGCATACAGTCGTGCATTGCTTAATGACAGGGATGCTTCTACGCAGGCCTACACAGGTC
AGGATCATCAGTATCACTGTCATCCACATCTTGTCCACTGGGAGGATTTCAGAGGCAGTA
ACACGTATGAAGTTATCTTTTAGGATAACAATGCCTTATGAAATATCTGCCTGAGACTGG
TCTACGGCTTAATGTTTTTATAAGCAGAAGGGGGGGAAGGAAGCATTCTAAAAAGTATAA
TATAGACAAGCATTGACTACTATACGTAACTGTATGTATCATATTTTTATGGCAGTATAG
GACACATGTTTATACCAGCATCACCACAATGTGTTAGGTCACTACAAGGAAATTTCCAGT
TTTATTATTATCTTATGGGAACACTGTTCTATATGCAGTCTGCTGACTAAAATGTTATGT
GGTGCACGACTGTATTAGATCATGTGTTAAAGTACCAGTGTACTTTCTACCATGTAACTT
TTATGACTCTGAAGTAACTTGGTTAAAGAAATTAGATTCCAGAGATTCTTAGTAAGTCAT
CCACCAAAAAGACATACAGGTTTTCTGTTGAACACTAGTTTTCTGTTTTTGTTTTTGTTT
TTTTTTAAACTTATTTCAATATTATTGCACATGTTTACAGGCAGGCCCTACATTGTGAAT
GAGATAGGTAAAAGTTCCTGCTGTTCTAACTTGTATACAAATATAACAACAAACACCTAC
AGAACCTATTACCTGAAATTGCCCCATTCATAATTGTGAGTTATATGTAAGTCAGATGTT
CGTAACTTAGGGGCAGCCTGTATCTACTAATACAATTGCAACCAAGCCTCGCAGTTAATT
TGTCATGAGTAGATTTTACTTTGTCAGTGTGCACTCACATCAGTTATCAAGGATATATGA
TGTTATGATGATGGCTAAATTGTTCAGCTGCTCTGAATGGACTGAATATAGCCTTCTGAA
CACTGTGAAAATAAATAAATTTATGAATAAAATAAAAATAGAAAAATAAAAGACCTAAAC
TTCATGATTTAAAGTCGACAGAACTATAAATCTTTACCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved