Otolemur_garnettii Locus Mono:137:SNORA48
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:137:SNORA48
Otolemur_garnettii
Mono:137:SNORA48
scaffold_113384
SNORA48
1001..1136
2136
TAGCCCTATGGCTCTTTAGGTGGTAGACACAGCAGCCTCGGATGTTTAGAGCTGCAGAG
AAAACGGTGCTCTCCTGTCATAGCGCTGCAGATAGCTCCAGAAGGTAGGAGCCCTGACTG
ACCAGATCCAGGTATGGGCCATCAGAGCCTGGCCTACTCACATAGGTCCTTTGCCCTGTC
GACTGTCCTTTTGGTCATGTCATCTCCTACCTTCAAGGGGCAGGGACAGCATGAAGGGTA
GGATCCTTGGACTGAGTGTCTCTGTCGGTTAAATGGGAATGGTGGCTTCCAGCCTGCTGG
CTTCTTAGGGCTGCTATGAAGACATTGTTTTTGGTAAGCTACCAAGAGCCAATATTTGAT
ACTTTGGAAAACTACTGATATTTGTTGAGACCATCCCATTCCTTAGCTGGAGGAAAACCA
GCTGTCCCTTTGTCCTCAAAGCTGGCTTCAGGGTCCATGCCATCAGGAGCTTCGCCCTGG
AGGGCAGGCCCTGCTACCAGGCTGGTCTGCATCTGTGCCCAGCTGCTTTCCCTTACCCTG
AGCTTTCTGCCACTGACAGGCCAGGCACTGTCTCCTGGACATGGGCAGGGCCATCTCTCT
TAAGTTGCTCTCATGAACTCCTCAGAGCTGATAAATCTAATCAAGAAATTAAGAAACAAA
TTTATCCACAATGACGTTTGGCTTCCTGAATGCCCTCCCTACCCCGCTAAAGTCACAAAT
CCTTAGCTGACACCCTTCTAGAATGAAAGTTTCCAATTTTCACTGGAAAAAGAGAATCAC
GAAGAGGAAGCTGTGTCTATTGGTGCCCAAGCAACACATCAAGCCCATTTCCTACTGTTG
ACTCAGTGTGACTTCAGAGCAAATTAGGGAGAGCATTACCTGAAAACAGAAAGTGAGATC
CTGTGCCATCTGTAGTTATCTATCGAAGAAAGAAATACATTTTAGTGCCTGCTGCATGCT
TGGCCTGTGCTGGTCCACACTCAATTGAATTGCATGCCCCTTGTCCCAGACCTGGGTGGC
GTGGCATCTGGTTGGTGGTGCCCATCTCATGTCAGCCAGGGACAAAAAAAACCCTTTGTT
TATCCCAGCTTGGCTTTTGATCTGTGCTTATGCCTGGTTCATGCCTGGGGCACATGAAAA
AAAAGAATTGCATGCCCCTCCCTGCTCACAGATGGCCAGGAACAGACACAAGGAGGGACA
ACCTAATATCTGGAGCATAGAAAAGGCTGGGAATTGATCAGGTCCCGGATCAGCTGGGGT
GACAGACCTCTCTACTCCACCTATGTGATTTAAGGCTATTCCTTGTCTCTGTTCTCAGGT
TGGTTTTGGGTGCCAACTGGGAAATCAAGAGAATACCTGGATACTCTATAAGGGGTCAGG
CTGGGCAGAGCTTGTGGAGGAATGTGAGTGGGGACAGGGCACCTTCCTAGGATTGCCTCA
TGTGAGGGAGGAGAGACATGGGTGACTACTCATCGGCAGTCCTAATCTCTGTGGCTGCCC
TAAACTTCAGGCCAGGGTTCTAGCCAAGCCCCAGGCCTTCCAGTAGTATGAACGATCTTC
TTTTCATTGGCTGGTTCTGGGCACTTCTCCCCCTGGGTAGGAGGGATCACACCAATCTCT
TGGATGGAGTATACAAGTAAGAGCATTAACTCTGCAGTTAAACTGCTTAGGCTAAAATCC
CAGCTCTGCCTCTTGCCCTGTCCGTGATCTCAGGCAAGGTATTTAATCTTTCTATGCCTC
AGTTTCCTCATCTGAACAATCTGGTTAATAATGGCACCTTCCTCACAGCACTGCTGTAAA
CATCAGTTGAGTTATTATGTGTAAAACACCCAGGATATTGCCTGGAGTAAGGTAGGTACT
GTGGAAGGAGTACAGCTATCATTATTAAAGGGCTGGTGGAGTGGAGAGGGCACTGCGCCT
GTTGTCCAGTTAGAGCCACCCAGGTTCCAATAAAGGGGGACTCCTGAGTGGCTGTGTAAT
CCTCAGGGAACAATAGGGGTGAGGGTGTCACATGGCCAAGACTAGCTCCACTCAGGAAAG
CTCCTTCCAGATTCAGTTGTAGGTAGAGCCCCTGTTCCAGGGATGGCAAGGATATAGAGT
GGGGAGTTAATTCTGGAGCTGAGAGGAGTAGACAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved